CN103045741B - Kit for diagnosing cerebrovascular stenosis and application thereof - Google Patents
Kit for diagnosing cerebrovascular stenosis and application thereof Download PDFInfo
- Publication number
- CN103045741B CN103045741B CN201210576126.4A CN201210576126A CN103045741B CN 103045741 B CN103045741 B CN 103045741B CN 201210576126 A CN201210576126 A CN 201210576126A CN 103045741 B CN103045741 B CN 103045741B
- Authority
- CN
- China
- Prior art keywords
- gene
- cerebrovascular stenosis
- mutation
- stenosis
- cerebrovascular
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to a kit for diagnosing cerebrovascular stenosis. The kit disclosed by the invention is characterized in that a gene segment with c.541C>T is used as a primer pair of a specific amplification human NF1 (neurofibromatosis type 1) gene in the target sequence design; and the mutation position is started from a first base in a gene coding region of NF1. The invention finds an NF1 gene mutation nucleotide sequence related to cerebrovascular stenosis by research; compared with a corresponding nucleotide sequence contained in NF1, the NF1 gene mutation nucleotide sequence is mutated at the following position: c.541C>T; the mutation position is started from the first base in the gene coding region of NF1; and the mutation causes a patient to suffer from cerebrovascular stenosis. The nonsense mutation exists in all NF1 family patients suffering from cerebrovascular stenosis, but does not exist in normal people in the NF1 family. The kit disclosed by the invention provides a novel technical means for carrying out super early diagnosis and prevention on the sporadic potential cerebrovascular stenosis of NF1 patients.
Description
Technical field
The present invention relates to a kind of kit for diagnosing diseases, particularly a kind of for diagnosing the test kit of cerebrovascular stenosis and at diagnosis of cerebral vascular disease or diagnosing I type neurofibroma to merge the application of cerebrovascular stenosis disease, belonging to medical diagnosis on disease field.
Background technology
Cerebrovascular stenosis is the common disease of harm humans health, can cause the cerebral infarction of high disability rate, high lethality rate.Its pathogenesis imperfectly understands, thereby the control of cerebrovascular stenosis is absorbed in " bottleneck ".At present, although along with popularizing of 1 grade of prevention of cerebral apoplexy, 2 grades of prevention knowledge, the application of the outer artery bypass technology of arterial bracket, undergoing cervical endarterium denudation and encephalic, the symptoms of cerebral ischemia of some patients were is eased, disability rate, lethality rate are controlled to a certain extent, but because pathogenic factor, the pathogenesis of cerebrovascular stenosis still imperfectly understand, and the current control for cerebrovascular stenosis is only in disease downstream level, consequently cures the symptoms, not the disease.The sickness rate of cerebrovascular stenosis is more and more higher in recent years simultaneously, age of onset is more and more tending towards rejuvenation, and usually can not find predisposing factors, so search out the mechanism of cerebrovascular stenosis from gene level, fundamentally reducing this sick incidence, is one of new breakthrough mouth of control cerebrovascular stenosis.In recent years, the relation of Nfl gene and vascular conditions is becoming new study hotspot, but Nf1 gene mutation site is changeable, type is indefinite, and the relation between sudden change and cerebrovascular stenosis is still not clear.
NF1 is a kind of common autosomal dominant inherited disease, and the cause of disease is clear and definite, by due to the Nf1 transgenation on No. 17 karyomit(e)s.Sickness rate in general population is about 1/3500,20% ~ 60% family history, and morbidity is without obvious gender difference.Clinical manifestation is mainly the multiple neurofibromatosis that involves whole skin, and simultaneously NF1 also can involve multiple tracts, occurs in renal artery stenosis, cerebrovascular stenosis, optic glioma, scoliosis, canalis spinalis or intracranial tumors etc.
1989, Nfl gene was located in human chromosomal 17q11.2, and cloned this gene in nineteen ninety.Nf1 gene is gene larger in human genome, total length 350kb, and containing 60 exons, it transcribes the about 11-13kb of length of part.NF1 gene is NM_001042492.2 in the accession number of Genbank.Function, Nf1 gene is cancer suppressor gene, the protein being made up of 2838 amino acid of its coding is that neurofibromin (neurofibromin) is a kind of tumor inhibitor, all there is expression at the multiple tissues of body and organ, as smooth muscle cell, vascular endothelial cell and schwann cell.Major function territory (the GAP-relateddomain of neurofibromin, GRD) by 21-27a exons coding, there is homology in family with gtpase activating protein, can swash intravital Ras-GTPase, cause the GTP hydrolysis of bonding state, Ras inactivation, therefore GRD is a kind of negative regulatory factor of Ras signal transduction, and Ras is the oncogene of body, as Nf1 gene is undergone mutation, matter or the amount of neurofibromin change, Ras activity increases, thereby can produce even malignant peripheral nerve sheath tumor (Malignant Peripheral nerve sheath tumor of neurofibroma, MPNST).
Nf1 gene structure complexity, mutational site is changeable, and mutation type is indefinite, and has a large amount of pseudogenes at Nf1 full-length gene, and therefore, the examination of Nf1 transgenation will be a challenging job.Show (http://www.hgmd.org/) according to human mutation database (HGMD), by the end of in April, 2011, find altogether 1273 sudden changes of Nf1 gene, comprise missense mutation, shearing sudden change, insertion, disappearance and complicated rearrangement etc., but sudden change lacks obvious hot spot region, most of Sporadic cases are carried special mutational site separately, because different NF1 patient clinical symptoms differs, so even also there is different mutational sites and mutation type between the different members in same family patient.
Before 2000, few people pay close attention to the relation of Nf1 gene and vascular conditions, until in recent years, between Nf1 gene and cerebro-vascular diseases may exist mostly associatedly also be simple clinical case report, rarely has further investigation for the relation between Nf1 gene and blood vessel, but it is found that the vascular lesion course of disease that NF1 occurs together is slow, be progressive injury.The concealment of patient's early symptom, can be without malaise symptoms, and along with PD, the clinical symptom of appearance can be involved because of pathology position and the degree of injury difference of blood vessel.But not yet find mutational site and the mutation type that Nf1 gene is relevant to cerebrovascular stenosis at present.In 1993, Ahlgren-Beckendorf etc. have carried out preliminary experimental study to the relation of Nf1 and vascular lesion, they detect the expression that has Nf1 on vessel wall, and expression and the alternative shear mode of finding Nf1 catalytic domain are constantly occurring to change in vascular smooth muscle cell proliferation process, prompting Nf1 may bring into play certain effect in the middle of the growth of vascular smooth muscle and vascular pathological process, but does not continue deep discussion.After 2 years, Norton has reconfirmed the expression that has neurofibromin in vascular endothelial cell and smooth muscle cell, having thought that at present the inherence infringement of arterial wall is NF1 patient's important behaviour, may be due to due to the changing function of neurofibromin in its vascular pathological process.2006, the people such as Li find that neurofibromin is new negative regulation of elementary vascular smooth muscle cell RAS-inducement signal path, Nf1 transgenation can cause the quality of neurofibromin to change, RAS-signal path restraining effect is weakened, ras increased activity, thus the generation of neurofibroma and vascular disease caused.In Nf1+/-mouse model, find RAS-signal path out of control can cause new vessel intimal thickening and cause the generation of angiostenosis.From the patient of Nf1+/-mouse and shortage neurofibromin, obtain vascular endothelial cell and smooth muscle cell, and identify an independently Ras effector path, this path is strictly subject to the regulation and control of neurofibromin, thereby limiting propagation and the migration of vascular smooth muscle cell, maintaining the stable of vessel wall vascular smooth muscle.The same period, the increase occurring for blood vessel in the height vascularization in Nf+/-heterozygous mutant mouse neurofibroma and Mice Body, Li and Munchhof have inquired into biochemical mechanism and its function in endotheliocyte that neurofibromin regulation and control new vessel forms, no matter find in vivo or external, there is change in the propagation and the migration that lack the endotheliocyte of neurofibromin, this change is relevant with the somatomedin in neurofibromin source.2007; for NF1 patient's cardiovascular disorder occurred frequently, cerebral infarction disease; the people such as Xu obtain smooth muscle cell Nf1 knock out mice (Nf1smKO); there is corresponding vascular lesion in these mouse, inner membrance blood proline(Pro) increases and the protein kinase abnormal activation of the downstream effect device of Ras-mitogen activation.If express Nf1Ras regulatory domain (the associated protein territory of GTP enzyme activation) at Nf1smKO mouse smooth muscle cell, inner membrance blood proline(Pro) increases symptom and can be restored so.Experiment in vitro is found active same the recovery normally of Ras effector, and after prompting smooth muscle cell is impaired, Nf1 regulation and control Ras has keying action in the hyperplasia process of smooth muscle cell.2008, the people such as Lasater sum up and find have neointima to form in Nf1+/-mouse blood vessel, the hyperplasia of vascular smooth muscle cell, at platelet derived growth factor (platelet-derived growth factor-BB, PDGF-BB) under stimulation, highly activate Ras-Erk signal transduction pathway, prompting neurofibromin the stable of the interior environment of vessel wall by the control of PDGF-BB-Ras-Erk signal shaft, comprises vascular endothelial cell (ECs) and vascular smooth muscle cell (VSMCs).The impaired rear PDGF-BB of artery is discharged by thrombocyte or other cell local in blood vessel.That is to say that the arbitrary link on this signal path is suppressed, all can be conducive to and the recovery of the vascular illness of Nf1 gene-correlation, prompting Nf1 gene is a potential treatment target spot of vascular conditions.The sudden change that Milewicz proposes Nf1 gene is equally the important factor that multiple hyperplasia vascular disease occur.In order to inquire into environmental change in vascular conditions due to Nf1 disappearance concrete, Lasater etc. think that neurofibromin can regulate and control the function of every type of cell.Then by the endotheliocyte mouse, vascular smooth muscle cell, and knock out Nf1 gene in bone marrow derived cell (BMDC) cell, to observe the cell of that type actually, inner membrance new in Mice Body is formed and played keying action, the inactivation that has finally confirmed Nf1 in BMDC is necessary to the formation of new intima, Nf1+/-peripheral blood analysis is found to there is the gathering of significant scavenger cell at the inherent new vessel inner membrance of blood vessel place, the existence of prompting inflammatory reaction, this is obviously relevant to vascular inflammation and vascular occlusion illness, again point out the vital role of Nf1 in vascular lesion.
Nf1 penetrance of gene is 100%.But different clinical symptom or performance incomplete penetrance, or show certain age related.Most research shows, between NF1 sudden change and clinical manifestation, seems without clearly contacting.Identical transgenation not necessarily produces identical clinical manifestation, and the clinical manifestation of same family different members also may be different.The patient clinical performance of carrying identical NF1 gene mutation site in family is also different, but in first degree relative, clinical manifestation is closely similar.Upadhyaya etc. have studied from 3 routine its transgenations of NF1 Finding case of same family different, and proposition can not detect to infer according to the sudden change of a certain patient in family the pathogenesis of whole family.The routine NF1 patient's transgenation of the researchs such as Castle 113 has also been analyzed 110 routine patient's genotype and phenotypic relations, finds that the relative risk of missense mutation patient Lisch tubercle is low compared with nonsense mutation and framework drift, but has no other significant contacts.Have in recent years scholar to think, the appearance of serious clinical manifestation type may be relevant with large flanking DNA afunction, and irrelevant with NF1 gene itself.
In a word, Nf1 gene is very complicated, and its sudden change can cause the generation of NF1, but in the different patients of NF1, Nf1 gene mutation site and mutation type " change unpredictably ".And NF1 patient's various diseases that often occurs together, all point out the generation of Nf1 gene and vascular conditions may have cause-effect relationship mainly for zooperal high factor of influence article more in recent years, but very few to the relation research of Nf1 gene mutation site and cerebrovascular disease.
I type neurofibroma (neurofbromatosis type1, NF1) patient and his family that merge cerebrovascular stenosis that occur are clinically definite opportunity that provides of this relation.The NF1 family that the present invention just merges cerebrovascular stenosis taking this is as point of penetration, Nf1 gene to this family and simple cerebrovascular stenosis case carries out full gene screening, seek the mutational site relevant with cerebrovascular stenosis, type and possible hot spot region, and the logical examination again to many cases Changes of Patients With Cerebrovascular Diseases Nf1 gene hot region, be expected to find Nf1 gene mutation site and the type relevant with cerebrovascular stenosis, find new breakthrough mouth for the pathogenetic exploration of cerebrovascular stenosis, find new treatment target spot.
Summary of the invention
One of object of the present invention is to provide a kind of I type neurofibroma NF1 transgenation nucleotide sequence relevant with cerebrovascular stenosis, it comprises a nucleotide sequence, and this nucleotide sequence is selected from lower group: (a) nucleotide sequence of coding cerebrovascular stenosis mutain polypeptide; (b) with (a) described in the nucleotide sequence of nucleotide sequence complementation, there is sudden change in the nucleotide sequence of wherein said coding cerebrovascular stenosis mutain polypeptide: c.541C>T (base that is positioned at the 924th bit base of sequence shown in SEQ ID NO:1 sports T by C compared with the corresponding nucleotide sequence comprising in NF1 with upper/lower positions, produce nonsense mutation), start at from NF1 gene coding region the 1st bit base (being the 384th bit base of sequence shown in SEQ ID NO:1), described sudden change causes patient that cerebrovascular stenosis occurs.
In the present invention, preferred, described nucleotide sequence, it contains the nucleotide sequence that is selected from lower group: (1) coding has the nucleotide sequence of the polypeptide of aminoacid sequence shown in SEQ ID NO:2; (2) nucleotide sequence shown in SEQ ID NO:1; (3) nucleotide sequence shown in SEQ ID NO:3.
Two of object of the present invention is to provide a kind of polypeptide relevant with cerebrovascular stenosis, it comprises the polypeptide with aminoacid sequence shown in SEQ IDNO:2, or its conservative property variation polypeptide or its active fragments or its reactive derivative that contains aminoacid sequence SEQ ID NO:2.
In the present invention, preferred, described polypeptide, it is selected from lower group: the polypeptide (a) with aminoacid sequence shown in SEQ ID NO:2; (b) polypeptide that still can the cause cerebrovascular stenosis aminoacid sequence shown in SEQ ID NO:2 being formed through replacement, disappearance or the interpolation of one or more amino-acid residues.
The expression vector that contains the nucleotide sequence described in above any one and transformed by described carrier or the host cell that contains described carrier of transduction also within protection scope of the present invention.
Three of object of the present invention has been to provide the purposes of nucleotide sequence of the present invention and polypeptide, and this purposes comprises:
Nucleotides sequence of the present invention is listed in the application of preparing in cerebrovascular stenosis diagnostic reagent, and/or merges the application in cerebrovascular stenosis diagnostic reagent in preparation I type neurofibroma.And
Polypeptide of the present invention is in the application of preparing in cerebrovascular stenosis diagnostic reagent, and/or merges the application in cerebrovascular stenosis diagnostic reagent in preparation I type neurofibroma.And
Nucleotides sequence of the present invention is listed in the application building in I type neurofibroma merging cerebrovascular stenosis animal model.And
Polypeptide of the present invention is in the application building in I type neurofibroma merging cerebrovascular stenosis animal model.
Four of object of the present invention is to provide a kind of test kit for cerebrovascular stenosis diagnosis, it comprises: (1), to contain the primer pair of the specific amplification people NF1 gene that c.541C>T the NF1 gene fragment in mutational site designs as target sequence, start at from NF1 gene coding region the 1st bit base in mutational site; Also can comprise whether (2) exist the required reagent of variation compared with normal NF1 gene for detection of amplified production.
In the present invention, the described nucleotide sequence that contains the NF1 gene in mutational site is c.541C>T as shown in SEQID NO.1.
Preferred in the present invention, the primer pair comprising in described test kit is as follows:
5 ' GAAGGAAGTTAGAAGTTTGTGACA3 ' (SEQ ID NO:6) with
5’CAATCGTATCCTTACCAGCCAT3’(SEQ?ID?NO:7)。
Further, the invention allows for described test kit in the application of preparing in cerebrovascular stenosis diagnostic reagent, and/or merge the application in cerebrovascular stenosis diagnostic reagent in preparation I type neurofibroma.
Five of object of the present invention is to provide a kind of method of diagnosing cerebrovascular stenosis disease, whether it comprises the following steps: detect in hemocyte or vascular smooth muscle cell sample cerebrovascular stenosis transcript and normal transcription and change compared with originally, change and just represent to exist cerebrovascular stenosis risk; Or examined compared with the activity of NF1 gene coded protein in cell sample and the activity of normal NF1 gene coded protein and whether changed, change and just represent to exist cerebrovascular stenosis risk; Or detect NF1 genome sequence in genome sample and whether change compared with normal NF1 genome sequence, change and just represent to exist cerebrovascular stenosis risk.
In a preference, described variation comprises: disappearance, insertion and the replacement mutation of the Nucleotide in NF1 gene extron 5 (base 863-969, its nucleotide sequence is as shown in SEQ ID NO:5).More preferably, described variation is selected from lower group: the 541st of coding region Nucleotide in SEQ ID NO:1 (is started at from the 384th bit base of sequence shown in SEQ ID NO:1 (being " A " in initiator codon ATG), it is the 924th bit base of sequence shown in SEQ ID NO:1, lower same) sport T by C, produce nonsense mutation.
Six of object of the present invention is to provide a kind of transgenic nonhuman mammal (animal model), in its genome, corresponding to the nucleotide sequence of people NF1 gene extron 5, change has occurred, thereby has the risk of suffering from cerebrovascular stenosis.
In a preference, described animal is mouse, and the Nucleotide 541 comprising in the exon 5 of NF1 gene in its genome sports T(c.541C>T by C).
Other side of the present invention, due to the open of technology herein and in conjunction with prior art, is apparent to those skilled in the art.
Brief description of the drawings
Fig. 1 is the I type neurofibromatosis family collection of illustrative plates that merges cerebrovascular stenosis;
Fig. 2 is skin change and the DSA detected result of propositus IV-7;
A: skin milk coffee spot and neurofibroma; B:DSA, the position that arrow indication place is angiostenosis;
Fig. 3 is skin coffee spot and the DSA detected result of NF1 patient IV-3, wherein, and the position that arrow indication place is angiostenosis;
Fig. 4 is DHPLC schema;
Fig. 5 is DHPLC color atlas and the sequencing result that Nf1 gene the 5th exons mutation detects;
Wherein, A figure is the DHPLC peak type figure of contrast wild-type, and its right side is corresponding sequencer map; B figure is that family merges the corresponding detection figure of the 5th exon (acromion has appearred in arrow indication position) of NF1 patient Nf1 gene of cerebrovascular stenosis and sequencer map (in sequencer map, nonsense mutation appears in arrow indication position: c.541C-T); C figure is that (in sequencer map, nonsense mutation appears in arrow indication position equally: c.541C-T) for the corresponding detection figure of the 5th exon (acromion has appearred in arrow indication position) of DNA of simple Patients with Cerebrovascular Stenosis and sequencer map;
Fig. 6 is the sudden change of exon 5 and the relation of its functional area (GRD district and CSRD district) of Nf1 gene.
Embodiment
Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.But these embodiment are only exemplary, scope of the present invention are not formed to any restriction.It will be understood by those skilled in the art that lower without departing from the spirit and scope of the present invention and can the details of technical solution of the present invention and form be modified or be replaced, but these amendments and replacement all fall within the scope of protection of the present invention.
Embodiment 1 merges the I type neurofibromatosis pedigree analysis of cerebrovascular stenosis
1 object and method
1.1 object
Propositus's (IV 4, Fig. 1), man, 24 years old, the larger neurofibroma operation of cause burst elevation of blood pressure in 8 years and head is medical, blood pressure 180/100mmHg is found in health check-up, in the recent period again because occurring that without special inducement severe headache, nausea and vomiting accompany blurring of vision to be admitted to hospital, measuring blood pressure 210/135mmHg.Be diagnosed as renovascular hypertension, neurofibroma is admitted to hospital.After being admitted to hospital, ultrasonic experiments is found renal artery stenosis, and left side MCA is narrow.In addition, this patient's normal intelligence, has many places aneurysmas (AN), arteria communicans anterior (ACOA) knurl in kidney.Other system checks without abnormal.There are 1 ~ 2 centimetre of circle of diameter or oval light brown color spot many places in thoracic dorsal abdomen and femoribus internus, sharpness of border, has dermatofibroma.
This family relates to 5 generations 34 people altogether, and that have genetic association with NF1 disease is 21 people (Fig. 1).Wherein 4 people's deads (3 male 1 female, are NF1 patient, and 3 people die from cerebral apoplexy), in all the other people, patient 7 people, male 4 people female 3 people.This disease passed on from one to another in continuous 5 generations of this family, ill total number of persons 11 people in 5 generations.All occur multiple light brown color spots or flaky brown white coffee spot in childhood, armpit white coffee spot, increases symptom and increase the weight of, and along with the increase at age, the incidence of vascular conditions increased with the age.
1.2 blood vessel monitoring methods
Comprise transcranial Doppler (TCD), neck arteries ultrasonic examination and Technology of Digital Subtraction Angiography (DigitalSubtraction Angiography, DSA).
2 results
The morbidity ratio of Changes of Patients With Cerebrovascular Diseases in the NF1 family of 2.1 merging cerebrovascular stenosis
4 people's deads in this family (3 male 1 female, are NF1 patient, and 3 people die from cerebral apoplexy), all the other patient 7 people, what merge vascular conditions has 5 people (a wherein following institute of people health check-up).Remove the marriage person without this family inherited genetic factors, this disease is ill total number of persons 11 people in 5 generations, account for the 52.38%(11/21 of Fig. 1 total number of persons).Definite number (angiostenosis+blood vessel is out of shape abnormal) of suffering from vascular conditions in 10 people (4 examples of 6 routine patient+death of health check-up) is 8 people, uncertain person 1 people (not health check-up), vascular conditions patient accounts for the ratio >80% of NF1 number of the infected.
2.2 family neurofibromatosis patient skin changes, Vascular Ultrasonography and DSA result
2.2.1 proband
(IV-4) man, 24 years old, thoracic dorsal abdomen visible many places circle or oval light brown color spot many places, sharpness of border, the original larger neurofibroma of head (excision).After being admitted to hospital, ultrasonic experiments is found renal artery stenosis, and left side MCA is narrow.DSA result shows sees Fig. 2.Its grandfather, father and grandaunt all suffer from neurofibroma and die from cerebral apoplexy.
2.2.1 other cases
III-4: man, 39 years old, the neurofibroma that skin many places are not of uniform size, Vascular Ultrasonography discovery bilateral vertebral artery is walked row variation.
III-7: man, 45 years old, except the neurofibroma not of uniform size of skin many places, belly had an especially big neurofibroma, but Vascular Ultrasonography no abnormality seen.
IV-2: female, 31 years old, the multiple coffee spot of skin, the whole latter end-MCA severe stenosis of the visible bilateral ICA of Vascular Ultrasonography; Bilateral arteria cerebri posterior (PCA) severe stenosis; Bilateral arteria cerebri anterior (ACA), basal arteries (BA) moderate stenosis; Splenomegaly; Left side internal carotid artery (ICA) distal segment is narrow; Left vertebral artery (VA) is walked row variation.The visible intracranial vessel stenosis of DSA (Fig. 3).
IV-5: female, 15 years old, the visible large stretch of white coffee spot of the multiple coffee spot of skin and fore-arm.The visible coeliac artery initial part of Vascular Ultrasonography narrow (50-69%); Bilateral VA walks row variation.
V-2: man, 6 years old, visible skin coffee spot and armpit freckle and coffee spot.The visible bilateral ICA of Vascular Ultrasonography, VA walk line bend.
Embodiment 2DHPLC examination merges the Nf1 transgenation of I type neurofibromatosis family and the Nf1 transgenation of simple Patients with Cerebrovascular Stenosis of cerebrovascular stenosis
1 object and method
1.1Nf1 the research object of full gene mutation for screening
The full gene screening of Nf1 comprises blood sample 13 examples that family is collected: referring to 6 routine patient (III-4, III-7, IV-2, IV-4, IV-5, V-2 that merge vascular disease in Fig. 1; Detect number: No. 1-6) and family in impassivity fibromatosis show 7 examples (III-2, III-5, III-6, IV-1, IV-3, IV-7, IV-8; Detect number: 13-18) and 5 examples without the simple Patients with Cerebrovascular Stenosis (No. 8-12, detection) of other Hazard Factor or underlying diseases.
The object of the full gene mutation for screening of the routine Nf1 of table 118
1.2 dhplc analysis (denaturing high performance liquid chromato-graphy, DHPLC), its schema as shown in Figure 4.
1.2.1 sample preparation and pre-treatment
DHPLC analytic sample is not purified pcr amplification product, and heterozygous mutant sample can be directly used in analysis, containing the sample of homozygous mutation need with wild-type sample balanced mix, to form heteroduplex.PCR product is through 95 DEG C of sex change 5min, then, approximately falls the speed of 1 DEG C by below temperature to 45 DEG C, fully to form heteroduplex with per minute.
1.2.2.DHPLC detect the minimum sample size of needed PCR product
The peak absorption value of DHPLC instrument is greater than 3mV.Meeting under the prerequisite that detects aequum, reduce amplification cycles number, 30 circulations are set in this experiment.
1.2.3.PCR the size of product
Although the size of the DNA molecular that DHPLC analyzes is 150-800bp, most suitable clip size is 300bp left and right.In order to ensure the sensitivity of examination, amplified production is preferably 300bp left and right.
1.2.4.PCR design of primers
5’-GAAGGAAGTTAGAAGTTTGTGACA-3’
5’-CAATCGTATCCTTACCAGC?CAT-3’
Primer amplification clip size is 172bp, and PCR annealing temperature is 57 ° of C, and DHPLC temperature is 54 ° of C.
1.2.5. the judgement of positive findings
Because the PCR product (wild-type PCR product) that does not contain mutational site only has single component (being homoduplex DNA molecular), on DHPLC collection of illustrative plates, be rendered as simple spike type (homoduplex peak, Homoduplexpeak).Containing the PCR product of mutagenic components, two kinds of DNA moleculars of heteroduplex and homoduplex after sex change, anneal, are formed.Heteroduplex DNA molecule is owing to containing unmatched base site, under DHPLC detected temperatures, easily unwind into single strand dna, low compared with double chain DNA molecule with the binding ability of DNA chromatogram test column, preferentially eluted by elutriant, form heteroduplex peak (Heteroduplex peak).Therefore,, compared with wild-type DNA fragmentation chromatographic peak, containing many 1 ~ 2 chromatographic peaks on the PCR fragment DHPLC collection of illustrative plates in mutational site, some samples show as shoulder type peak etc.
Mutagenic components minimal percentage in the PCR product that 1.2.6.DHPLC can detect
Containing in the PCR product of mutagenic components, the minimum quantity (percentage composition) of the sudden change product that DHPLC can detect is an important indicator evaluating DHPLC susceptibility.The minimum content that DHPLC can identify mutagenic components in PCR mixture is delicately 5% left and right.When the DNA molecular suddenling change in PCR mixture reaches 10% when above, heteroduplex can be detected effectively.
Some PCR reaction solution contains the composition that reduces the resolving power of pillar and the stability of infringement pillar, should avoid the not clear reagent of composition (PCR stablizer, toughener, additive etc.); The detrimental impurity that may mix in DNA profiling preparation; Mineral oil; Methane amide; Autoclaving water; Proteinase K; The existence of bovine serum albumin.Also have some to answer the composition of controlled concentration: as DMSO, glycerine, PEG, tensio-active agent and betaine (Betaine) etc.When sample that detection contains mentioned component, can only adopt " Active clean " pattern to clean pillar.
2 results
2.1NF1 family DHPLC detected result
Merge 13 collected routine blood DNA Nf1 detection in Gene Mutation positive findingses of the NF1 family of cerebrovascular stenosis and the simple full gene mutation for screening positive findingses of Patients with Cerebrovascular Stenosis Nf1 of 5 examples in table 2.What 6 routine NF1 patients were common sports c.541C-T(Fig. 5 B), belong to nonsense mutation (G181X), produce the neurofibromin of brachymemma.In addition, in the non-NF1 personnel of family, do not detect this sudden change, show that this sudden change is directly relevant to patient's neurofibroma and cerebrovascular stenosis.Meanwhile, there is identical nonsense mutation (Fig. 5 C) in one routine patient in same discovery of the full gene screening of Nf1 of the simple Patients with Cerebrovascular Stenosis of 5 example.The primer sequence that this sudden change detects is: 5 '-GAAGGAAGTTAGAAGTTTGTGACA-3 ' and 5 '-CAATCGTATCCTTACCAGCCAT-3 ' (table 2).Primer amplification clip size is that 172, PCR annealing temperature is 57 ° of C, and DHPLC temperature is 54 ° of C.
Table 2 merges 13 sample gene mutation analysis of NF1 family of cerebrovascular stenosis or deformity
2.5DHPLC peak value figure and sequencing result figure
Corresponding with table 2, Fig. 5 has listed representational DHPLC peak value figure and sequencer map.
In this family, the most stable mutational site is exactly the c.541C>T sudden change that the 5th exon (base 863-969 in Nf1 gene) 6 collected routine NF1 patients occurs, replaced by thymus pyrimidine T at the 541st base position cytosine(Cyt) C, cause forming at mutational site place premature termination codon, result forms the truncated protein (shown in SEQ ID NO.2, Fig. 6) being made up of 180 amino acid.Studies have found that, Nfl gene transcribe the about 11-13kb of partial-length, neurofibromin (the varient 1 that codified is made up of 2838 amino acid, or the neurofibromin (varient 2 being formed by 2818 amino acid NM_001042492.2), NM_000267.3) neurofibromin of composition, its WeiGRD district of major function district (exon 2 1-27a, base 2793-4091), secondly be CSRD district (exons 1 1-17, base 1569-2384).In this research, the sudden change of 6 routine patients' common ground is arranged in the 5th exon, belong to FeiGRD district and CSRD district, but forming truncated protein, sudden change can cause the loss of CSRD and GRD functional zone, or this sudden change affects the montage of precursor RNA, thereby affect the structure and function of gene transcript, cause the generation of the common NF1 disease symptoms of this family and cerebrovascular stenosis.
3 one kinds of embodiment are for diagnosing test kit and the application thereof of cerebrovascular stenosis
One, the preparation of test kit:
1, PCR design of primers and synthetic (5pmol/ μ L):
5 '-GAAGGAAGTTAGAAGTTTGTGACA-3 ' (primer 1)
5 '-CAATCGTATCCTTACCAGC CAT-3 ' (primer 2)
2, PCR reaction solution: distilled water, 10 × PCR damping fluid (TaKaRa), 25mM Mg
2+, 10mM dNTPs.
3, enzyme: Taq archaeal dna polymerase (TaKaRa).
Two, the application in diagnosis cerebrovascular stenosis
1, collecting sample blood sample, extracts genomic dna;
2, the primer that uses design, carries out pcr amplification according to following program:
2.1.PCR the preparation of reaction system:
2.2.PCR the setting of reaction conditions, i.e. setting program on PCR thermal cycler, the condition of follow procedure setting increases.
(1) 94 DEG C of denaturation 5min; (2) 94 DEG C of sex change 40s; (3) 57 DEG C of annealing 50s; (4) 72 DEG C are extended 30s; (5) repeating step (2)~(4) 30 times; (6) 72 DEG C are extended 8min.
Primer amplification clip size is 172bp, for following analysis.
3, dhplc analysis (denaturing high performance liquid c hromato-graphy, DHPLC), its schema as shown in Figure 4.
3.1 sample preparations and pre-treatment
DHPLC analytic sample is not purified pcr amplification product, and heterozygous mutant sample can be directly used in analysis, containing the sample of homozygous mutation need with wild-type sample balanced mix, to form heteroduplex.PCR product is through 95 DEG C of sex change 5min, then, approximately falls the speed of 1 DEG C by below temperature to 45 DEG C, fully to form heteroduplex with per minute.
3.2.DHPLC detect the minimum sample size of needed PCR product
The peak absorption value of DHPLC instrument is greater than 3mV.Meeting under the prerequisite that detects aequum, reduce amplification cycles number, 30 circulations are set in this experiment, DHPLC temperature is 54 ° of C.
3.3. the judgement of positive findings
Because the PCR product (wild-type PCR product) that does not contain mutational site only has single component (being homoduplex DNA molecular), on DHPLC collection of illustrative plates, be rendered as simple spike type (homoduplex peak, Homoduplexpeak).Containing the PCR product of mutagenic components, two kinds of DNA moleculars of heteroduplex and homoduplex after sex change, anneal, are formed.Heteroduplex DNA molecule is owing to containing unmatched base site, under DHPLC detected temperatures, easily unwind into single strand dna, low compared with double chain DNA molecule with the binding ability of DNA chromatogram test column, preferentially eluted by elutriant, form heteroduplex peak (Heteroduplex peak).Therefore,, compared with wild-type DNA fragmentation chromatographic peak, containing many 1 ~ 2 chromatographic peaks on the PCR fragment DHPLC collection of illustrative plates in mutational site, some samples show as shoulder type peak etc.
Detected result is that the patient who c.541C-T suddenlys change is diagnosed as cerebrovascular stenosis or I type neurofibroma merging cerebrovascular stenosis.
Claims (2)
1. a test kit merges the application in cerebrovascular stenosis diagnostic reagent in preparation I type neurofibroma, described test kit comprises: to contain the primer pair of the specific amplification people NF1 gene that c.541C>T the NF1 gene fragment in mutational site designs as target sequence, start at from NF1 gene coding region the 1st bit base in mutational site, and the sequence of described primer pair is as follows:
5’GAAGGAAGTTAGAAGTTTGTGACA3’
5’CAATCGTATCCTTACCAGCCAT3’。
2. application as claimed in claim 1, is characterized in that the described nucleotide sequence that contains the NF1 gene fragment in mutational site is c.541C>T as shown in SEQ ID NO.1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210576126.4A CN103045741B (en) | 2012-12-26 | 2012-12-26 | Kit for diagnosing cerebrovascular stenosis and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210576126.4A CN103045741B (en) | 2012-12-26 | 2012-12-26 | Kit for diagnosing cerebrovascular stenosis and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103045741A CN103045741A (en) | 2013-04-17 |
CN103045741B true CN103045741B (en) | 2014-07-02 |
Family
ID=48058601
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210576126.4A Expired - Fee Related CN103045741B (en) | 2012-12-26 | 2012-12-26 | Kit for diagnosing cerebrovascular stenosis and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103045741B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104878080B (en) * | 2014-06-26 | 2020-06-19 | 首都医科大学附属北京天坛医院 | Kit for in vitro detection of c.602delTG mutation of Neurosporistosis 2 disease-causing gene NF2 |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5227292A (en) * | 1990-07-12 | 1993-07-13 | University Of Utah | Neurofibromatosis type 1 gene |
US5605799A (en) * | 1990-07-12 | 1997-02-25 | University Of Utah Research Foundation | Somatic mutations in neurofibromatosis type 1 gene in human tumors |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009149166A2 (en) * | 2008-06-03 | 2009-12-10 | Children's Hospital Medical Center | Methods and compositions for the diagnosis and treatment of proliferative disorders |
-
2012
- 2012-12-26 CN CN201210576126.4A patent/CN103045741B/en not_active Expired - Fee Related
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5227292A (en) * | 1990-07-12 | 1993-07-13 | University Of Utah | Neurofibromatosis type 1 gene |
US5605799A (en) * | 1990-07-12 | 1997-02-25 | University Of Utah Research Foundation | Somatic mutations in neurofibromatosis type 1 gene in human tumors |
Non-Patent Citations (2)
Title |
---|
Evaluation of denaturing high performance liquid chromatography (DHPLC) for the mutational analysis of the neurofibromatosis type 1 (NF1) gene;Song Han et al;《Hum Genet》;20011011;第109卷;第489页table1 * |
Song Han et al.Evaluation of denaturing high performance liquid chromatography (DHPLC) for the mutational analysis of the neurofibromatosis type 1 (NF1) gene.《Hum Genet》.2001,第109卷第489页table1. |
Also Published As
Publication number | Publication date |
---|---|
CN103045741A (en) | 2013-04-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103045605B (en) | I type neurofibroma NF1 gene mutation nucleotide sequence related to cerebrovascular stenosis and application thereof | |
Chung et al. | Early onset severe and late-onset mild Charcot–Marie–Tooth disease with mitofusin 2 (MFN2) mutations | |
Isidor et al. | Mesomelia-synostoses syndrome results from deletion of SULF1 and SLCO5A1 genes at 8q13 | |
DeAngelis et al. | Novel mutations in the NRL gene and associated clinical findings in patients with dominant retinitis pigmentosa | |
Xia et al. | A novel COL4A1 gene mutation results in autosomal dominant non-syndromic congenital cataract in a Chinese family | |
Nakamura et al. | Novel CACNA1F mutations in Japanese patients with incomplete congenital stationary night blindness | |
Nelis et al. | Autosomal dominant axonal Charcot-Marie-Tooth disease type 2 (CMT2G) maps to chromosome 12q12–q13. 3 | |
Guo et al. | Whole-exome sequencing reveals a novel CHM gene mutation in a family with choroideremia initially diagnosed as retinitis pigmentosa | |
Wang et al. | Phenotypic variation in a four-generation family with aniridia carrying a novel PAX6 mutation | |
CN103045741B (en) | Kit for diagnosing cerebrovascular stenosis and application thereof | |
Whitman et al. | Recurrent rare copy number variants increase risk for Esotropia | |
Wang et al. | A novel mutation of the nicotinic acetylcholine receptor gene CHRNA4 in a Chinese patient with non-familial nocturnal frontal lobe epilepsy | |
CN102732607A (en) | Kit for detecting high myopia | |
CN110241208A (en) | Application of the TREM2 as the molecular marker of early diagnosis coronary heart disease | |
KR102127218B1 (en) | Use of compounds in the manufacture of drugs for the treatment of brain glioma | |
Yan et al. | Molecular genetics of familial nystagmus complicated with cataract and iris anomalies | |
Li et al. | A novel mutation of the VMD2 gene in a Chinese family with best vitelliform macular dystrophy | |
Ponjavic et al. | Autosomal dominant retinitis pigmentosa with a rhodopsin mutation (Arg‐135‐Trp) Disease phenotype in a Swedish family | |
Himi et al. | A case of oculodentodigital dysplasia syndrome with novel GJA1 gene mutation | |
Li et al. | Novel mutation of SCN1A in familial generalized epilepsy with febrile seizures plus | |
JP6052811B2 (en) | Method for predicting risk of foramen encephalopathy or hemorrhage | |
CN108659113A (en) | A kind of marker and its detection kit of auxiliary Diagnosis of Epilepsy | |
Kabzińska et al. | Charcot-Marie-Tooth disease type 4C4 caused by a novel Pro153Leu substitution in the GDAP1 gene | |
Chuah et al. | CADASIL (Cerebral autosomal dominant arteriopathy with subcortical infarcts and leucoencephalopathy): An Australian perspective | |
Nobile et al. | Identification and characterization of a novel human brain-specific gene, homologous to S. scrofa tmp83. 5, in the chromosome 10q24 critical region for temporal lobe epilepsy and spastic paraplegia |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140702 Termination date: 20181226 |