CN103031328A

CN103031328A - Improvement of expression quantity of foreign proteins by fusion label

Info

Publication number: CN103031328A
Application number: CN2012104767920A
Authority: CN
Inventors: 陈卫; 王光强; 宋元达; 陈海琴
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2012-11-22
Filing date: 2012-11-22
Publication date: 2013-04-10
Anticipated expiration: 2032-11-22
Also published as: CN103031328B

Abstract

The invention belongs to the field of molecular biology, and relates to application of previous 50 amino acids of Bacillus subtilis l68 flagellin Hag, and a novel method for improving the expression quantity of foreign proteins in Bacillus subtilis, and in particular relates to a method for improving the expression quantity of foreign proteins by way of fusion expression. A fusion label Hag 50 coding sequence is fused and recombined with that of the foreign proteins to construct a recombinant plasmid in fusion expression and convert the Bacillus subtilis. The obtained recombinant bacteria have already improved the expression quantity of foreign proteins successfully.

Description

Utilize a kind of fusion tag to improve the expression amount of exogenous protein

Technical field

The present invention relates to a kind of novel method that in subtilis, improves the exogenous protein expression amount.Front 50 amino acid (Hag50) that more specifically relate to subtilis flagellin Hag are realized the overexpression of exogenous protein as fusion tag.

Background technology

Intestinal bacteria are the first-selected expression systems of expressing foreign protein always. but since foreign protein in the expression process easily by the host cell proteins enzyme liberating or form inclusion body, and intestinal bacteria have the thermal source lipopolysaccharides like that, its application is restricted. because the genetic background of subtilis (Bacillus subtilis) is clear, and be a kind of food-grade microorganisms, so subtilis is developed rapid as the host of exogenous gene expression and shows good prospects for commercial application in recent years.Although mainly utilize subtilis to realize the secreting, expressing of exogenous protein, the example of successful intracellular expression also a lot (Zweers JC, Barak I in subtilis, Dorte B, et al.Micro Cell Fact, 2008,7:10).Egfp (Green Fluorescent Protein, GFP) is widely used in reporter protein, merges the fields such as mark, protein positioning.GFP has been applied to all respects of biotechnology widely as a kind of novel detection by quantitative means.

The protein expression amount is the emphasis that researcher is concerned about always.By optimizing promotor and ribosome bind site, the coexpression molecular chaperones reduces the proteolytic enzyme expression amount, and the means such as codon of Optimized Coding Based gene can significantly improve the expression amount of exogenous protein.But for some exogenous protein, although by above optimization expression the amount still very low or requirement that do not reach suitability for industrialized production.So, find that the new method that can improve the exogenous protein expression amount is particularly important.The present invention is take GFP as reporter protein matter, merges the expression amount that the Hag label attempts improving GFP by the N end.

Summary of the invention

Purpose of the present invention improves the expression amount of reporter protein matter GFP by fusion molecule label H ag50 (front 50 amino acid of Hag).

The technical solution adopted in the present invention is:

Front 50 amino acid (Hag50) of subtilis flagellin Hag improve the expression amount of exogenous protein as fusion tag.Concrete, that to utilize front 50 amino acid (Hag50) encoding gene hag50 of subtilis flagellin Hag be molecular label, merge with the encoding sequence (GFP) of external source target protein gene, structure can the amalgamation and expression recombinant protein plasmid, and transform subtilis and obtain the subtilis recombinant bacterial strain, thereby realize the expression of fused protein.The present invention selects front 50 amino acid (Genbank sequence number: M26948) as fusion tag of flagellin Hag, selecting easily to detect and express the low GFP of toxicity is foreign gene, with have conversion capability and genetics characteristic clearly bacillus subtilis strain as the conversion bacterial strain of recombinant plasmid, such as Bacillus subtilis 168 and derivative strain thereof.

The present invention relates to front 50 amino acid (Hag50) of flagellin Hag, be built into recombinant plasmid pMA5-Hag50-GFP after the encoding sequence of the encoding gene of this fragment and external source target protein gene merged, the encoding gene and the external source target protein gene (GFP) that contain strong promoter HpaII, Hag50 in this plasmid, it can be in subtilis expressed fusion protein.

The recombinant bacterial strain that obtains behind the recombinant plasmid transformed subtilis of the amalgamation and expression recombinant protein of the structure that the present invention relates to, the expression external source target protein GFP of composing type, it is strong and weak to detect the fluorescence of recombinant protein GFP by fluorescence spectrophotometer.Blank among the present invention is that the GFP gene is directly connected on the plasmid pMA5, consists of recombinant plasmid pMA5-GFP.The F-7000 of Hitachi type fluorescence spectrophotometer is adopted in fluoroscopic examination, and the excitation wavelength during detection is 488nm, and emission wavelength is 547nm.Fluorescence is strong and weak with " relative intensity of fluorescence unit " expression.

The present invention relates to the primer sequence of front 50 amino acid coding Hag50 amplification of flagellin Hag:

hag-F：AGTG CATATGAGAATTA?ACCACA?ATATTGC

hag50-R：CTG GAATTCTTCAGAGATCGCAAGACCTG

Compare with methods known in the art, the present invention utilizes front 50 amino acid of flagellin Hag to improve exogenous protein at intracellular expression level as fusion tag.Compared with the control, the GFP expression amount after the fusion has improved 12 times.

Description of drawings

Fig. 1 amalgamation and expression Hag50-GFP recombinant plasmid pMA5-Hag50-GFP makes up schema.Amp and bla represent ampicillin resistance gene, are used for the screening escherichia coli transformant, and the plasmid that is used for increasing is used.Hag50-GFP is front 50 amino acid encode fragments of flagellin Hag and the fusion fragment of green fluorescent protein GFP gene, and Promoter HpaII is composing type strong promoter HpaII; Ori is the intestinal bacteria replicon.

Fig. 2 contrasts recombinant plasmid pMA5-GFP and makes up synoptic diagram.Directly the GFP gene is connected to carrier pMA5 and upward consists of plasmid pMA5-GFP.

The relative intensity of fluorescence of GFP among Fig. 3 recombinant bacterial strain PG800 and the PHG800.Recombinant bacterial strain PG800 expresses the GFP protein that does not contain molecular label Hag50; Recombinant bacterial strain PHG800 is with the Hag50-GFP fused protein of molecular label Hag50.

Embodiment

1. the acquisition of front 50 amino acid coding of subtilis flagellin Hag

(the Genbank sequence number: M26948) total length is 915bp to the hag gene of B.subtilis 168, is one of protein of expression amount maximum in the subtilis.Cultured B.subtilis168 bacterium liquid is extracted genomic dna according to bacterial genomes rapid extraction test kit specification sheets.Hag gene order design PCR primer hag-F and hag50-R in the full genome of B.subtilis168 of delivering according to NCBI, introduce respectively NdeI and EcoRI restriction enzyme site in the upstream and downstream primer, primer is synthetic by Sangon Biotech (Shanghai) Co., Ltd..Take the genomic dna that extracts as template, front 50 amino acid coding of pcr amplification flagellin Hag, amplified production detects with agarose gel electrophoresis, and size conforms to expection.The polysaccharase of amplification usefulness is the KOD plus that (Shanghai) bio tech ltd spins in Japan.Primer sequence is as follows, and wherein the underscore representative is restriction enzyme site.

hag-F：AGTG CATATGAGAATTAACCACAATATTGC

hag50-R：CTG GAATTCTTCAGAGATCGCAAGACCTG

The PCR product that the clone obtains carries out product purification, and-20 ℃ save backup.

2. the amplification of egfp gene gfp

Gfp gene (the Genbank sequence number: U55762) sequences Design PCR primer of delivering according to NCBI.Utilize primer GFP-f and GFP-R, take plasmid pEGFP as template, amplify the gfp gene of EcoRI and BamHI restriction enzyme site.Take GFP-F and GFP-R as primer, take plasmid pEGFP as template, amplify the gfp gene of NdeI and BamHI restriction enzyme site.The polysaccharase of amplification usefulness is the KOD plus that (Shanghai) bio tech ltd spins in Japan.Detect through nucleic acid electrophoresis, size conforms to expection.Further product purification also-20 ℃ saves backup.

GFP-F：GGCG CATATGAGCAAGGGCGAGGAGCTGTTC

GFP-f：CCG GAATTCAGCAAGGGCGAGGAGCTGTTC

GFP-R：GGC GGATCCCTTGTACAGCTCGTCCATGCCGA

3. the structure of plasmid pMA5-Hag50-GFP

Making up flow process such as Fig. 1, at first is that the gfp gene that utilizes KOD plus (flat terminal) to amplify with EcoRI and BamHI restriction enzyme site is connected to the pUCX05 that cuts through the EcoRV enzyme, consists of plasmid pUCX-GFP.By adopting NdeI and EcoRI double digestion PCR product Hag50, reclaim rear clone in the plasmid of the pUCX-GFP that cuts through same enzyme through glue, obtain plasmid pUCX-Hag50-GFP.With NdeI and BamHI digested plasmid pUCX-Hag50-GFP, and glue recovery Hag50-GFP fragment, be connected in the pMA5 plasmid that same enzyme is cut, obtain recombinant plasmid pMA5-Hag50-GFP.

4. the structure of recombinant plasmid pMA5-GFP

Adopt NdeI and BamHI double digestion take the PCR product gfp that GFP-F and GFP-R go out as primer amplification, reclaim rear clone in the corresponding site of pMA5 through glue, obtain integrated recombinant plasmid pMA5-GFP (such as Fig. 2).

5. the Screening and Identification of recombinant plasmid transformed subtilis and transformant

Adopt electric shocking method that recombinant plasmid pMA5-Hag50-GFP and pMA5-GFP are transformed respectively (2.0kv in the subtilis WB800 bacterial strain, 1mm shocks by electricity time constant=4.5～5.0ms 1 time, Gene Pulser Xcell), coating contains the LB flat board of kantlex.After the incubated overnight, picking list bacterium colony point is seeded to 5mL and contains the LB liquid nutrient medium that final concentration is 50 μ g/mL kantlex from the flat board.Collect thalline and extract genomic dna according to bacterial genomes rapid extraction test kit specification sheets, whether transform successfully by PCR checking recombinant plasmid.Be accredited as and contain pMA5-Hag50-GFP bacterial strain called after PHG800, contain the bacterial strain called after PG800 of pMA5-GFP.

6. the detection of GFP in the subtilis recombinant bacterial strain

Recombinant bacterial strain PHG800 and PG800 are inoculated in respectively in the LB liquid nutrient medium of 5ml, cultivate 12h for 37 ℃.The centrifugal 15min of 10000rpm collects thalline, then with PBS washing three times, and is resuspended in the resuspended thalline of isopyknic PBS.Then add the N,O-Diacetylmuramidase that final concentration is 5mg/mL, 37 ℃ of water bath heat preservation 1h utilize ultrasonic disruption thalline (2min, 300W, Sonic, VCX500).Then utilize the F-7000 of Hitachi type fluorescence spectrophotometer to detect the power of fluorescence in the broken liquid, the excitation wavelength during detection is 488nm, and emission wavelength is 547nm.

The present invention relates to a kind of novel method that in subtilis, improves the exogenous protein expression amount.When realizing exogenous protein GFP with front 50 amino acid (Hag50) of subtilis flagellin Hag as fusion tag, can mention raising GFP expression amount and reach 12 times.Its discovery is for realizing that the overexpression of exogenous protein in subtilis provides possibility.

Claims

1. utilize front 50 amino acid of flagellin Hag to improve the expression amount of exogenous protein in subtilis as fusion tag.

2. application as claimed in claim 1, it is characterized in that, utilize front 50 amino acid of bacillus subtilis spore flagellin Hag as fusion tag, with external source target protein gene fusion, vector construction hexose transport protein, and transform subtilis and obtain the subtilis recombinant bacterium, recombinant bacterial strain can effectively improve the expression level of exogenous protein.

3. application as claimed in claim 2 is characterized in that, external source target protein gene has bioactive albumen or enzyme for coding.

4. application as claimed in claim 3, it is characterized in that, described recombinant plasmid is the plasmid that subtilis flagellin encoding sequence and external source target protein gene fusion are obtained, the encoding gene that contains resistance selective marker gene, composing type strong promoter HpaII and the external source target protein matter of front 50 amino acid encode fragments, penbritin and the kantlex of Hag in the recombinant plasmid, the Plasmid Transformation subtilis of structure.

5. application as claimed in claim 4 is characterized in that, described recombined bacillus subtilis is with the sequestered plasmid, and the expression amount of exogenous protein that contains the recombinant bacterial strain of fusion tag obviously improves.