Accompanying drawing explanation
Fig. 1. accept local 5-HT1AR-targeting-siRNA (naked or put together) is little to dorsal raphe nucleus (DRN)
(R) in Mus-(+)-8-hydroxyl-2-(two-n-propylamine) tetrahydronaphthalene hydrobromate (8-OH-DPAT, selectivity 5-HT1AR is exciting
Agent) induce hypothermia response do not exist, as 5-HT1AThe example of the functional measure of R presynaptic activity.Mice accepts:
I) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-siRNA), iv) naked 5-HT1AR-
SiRNA or v) 5-HT1AR-NLF-siRNA (0.3 μ g/1 μ l/2 days to DRN).5-HT1AR knocks out (5-HT1AR-KO) its of mice
Its group have also been made evaluation.Body temperature is administered before (1mg/kg lumbar injection) 5 minutes and 15,30,60 He afterwards at 8-OH-DPAT
Within 120 minutes, it is estimated.Data are shown as the SEM of 5-7 mice of the meansigma methods of Temperature changing ± often organize.* p < 0.01 is respectively
With carrier, there were significant differences for ns naked siRNA and ns NLF-siRNA, utilizes repeated measure ANOVA (variance analysis), in tested
The factor of variable and processing between the time, (Newman-Ke Yiersi examines to carry out multiple comparisons Newman-Keuls inspection subsequently
Test).
Fig. 2 .5-HT1AR-targeting-siRNA (naked or put together) is locally implanted to dorsal raphe nucleus (DRN) and induces 5-
HT1AThe specific downregulation of R protein level.Mice accepts: i) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense
NLF-siRNA (ns NLF-siRNA), iv) naked 5-HT1AR-siRNA or v) 5-HT1AR-NLF-siRNA (0.3 μ g/1 μ l/2 days
To DRN).It is bound to 5-HT in figure post display mice DRN1AR [3H] photodensitometric quantitation of-8-OH-DPAT, it is expressed as 5-
HT1AMeansigma methods ± SEM (2 observations of the 3AP level of the dorsal raphe nucleus of every animal, the often group of Rfmol/mg histone
4-5 animal).* p < 0.05, * * p < 0.01, with carrier, there were significant differences for ns naked siRNA and ns NLF-siRNA, utilizes single
Factor ANOVA, carries out Newman-Keuls post hoc subsequently and checks (Newman-Ke Yiersi post-hoc tests).
Fig. 3. Intraventricular (i.c.v) is administered the 5-HT puted together1AThe selectivity 5-HT that R-NLF-siRNA causes1AAutoreceptor
Reticent.A) 5-HT in rapheal nuclei1AThe expression of R is assessed by situ hybridization.Mice acceptance is single is administered to dorsal part ventriculus tertius
(D3V): i) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-siRNA), iv)
Naked 5-HT1AR-siRNA or v) 5-HT1AR-NLF-siRNA (30 μ g/2.5 μ l/1 days).A1-a555 shows before 3 different
Afterwards at (AP) coordinate, with33The coronal section of the mice rapheal nuclei that the oligonucleotide of P-labelling combines is in terms of mm: from bregma-
4.84/-4.96 ,-4.36/-4.60 and-4.24/-4.36 (kiss tail is from left to right).Scale, 2mm.B) aobvious in a111-a555
The magnification at high multiple of the part shown.Scale, 500 μm.C) post figure shows 5-HT1AIn the dorsal raphe nucleus of R-NLF-siRNA induction
5-HT1AThe reduction of R mRNA level in-site.The 5-HT measured on film1AThe photodensitometric quantitation of R mRNA positive particle is shown as average
Optical density (OD) percentages ± SEM (n=4-5 mice often group and 2-4 sight of the 3AP level at dorsal raphe nucleus
Examine).* p < 0.01 and carrier, ns NLF-siRNA and naked 5-HT1AThere were significant differences for R-siRNA, utilize single factor test ANOVA with
Rear Newman-Keuls post hoc checks.
Fig. 4 .5-HT1AR-NLF-siRNA induces presynaptic 5-HT1AThe specific downregulation of R, and not at postsynaptic sites.The back of the body
Seam nucleus (A), prefrontal cortex (B) and the 5-HT of hippocampus (C)1AR protein level is combined with by autoradiography3
[H]-8-OH-DPAT assesses.Mice accepts the single dorsal part ventriculus tertius (D3V) of being administered to: i) carrier, ii) nonsense is naked
SiRNA (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-siRNA), iv) naked 5-HT1AR-siRNA or v) 5-
HT1AR-NLF-siRNA (30 μ g/2.5 μ l/1 days).Figure post represents 5-HT1AThe meansigma methods of R fmol/mg histone ± SEM (n
=4-5 mice often group and in 2 times of 3AP level observations of dorsal raphe nucleus with in prefrontal cortex and the left and right of hippocampus
2 observations in site).* there were significant differences for p < 0.05 and other process all, utilizes single factor test ANOVA to be followed by Newman-
Keuls post hoc checks.
Fig. 5 .5-hydroxytryptamine-5-HT transporter (5-HTT) and 5-HT1BReceptor (5-HT1BR) in the combination of dorsal raphe nucleus
Level is not by 5-HT1AR-siRNA processes and is changed.A) the 5-HTT protein level in dorsal raphe nucleus is tied by autoradiography
Close and utilize3[H]-citalopram is evaluated.B) 5-HT in dorsal raphe nucleus1BR protein level combines profit by autoradiography
With125[I] cyanoindole Luo Er blocks beta-adrenaline site in the presence of isoproterenol and evaluates.Mice accepts single
One is administered to dorsal part ventriculus tertius
(D3V): i) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-
SiRNA), iv) naked 5-HT1AR-siRNA or v) 5-HT1AR-NLF-siRNA (30 μ g/2.5 μ l/1 days).Block diagram shows: A) 5-
HTT fmol/mg histone meansigma methods ± SEM and B) (n=4 mice is every for average optical (OD) percentages ± SEM
Group and in 2 times of 3AP level observations of dorsal raphe nucleus).
Fig. 6. (R)-(+)-8-hydroxyl-2-(two-n-propylamine) tetrahydronaphthalene hydrobromate (8-OH-DPAT, selectivity 5-
HT1AR agonist) hypothermia induced responds as presynaptic 5-HT1AThe functional measure of R activity.Mice accepts single giving
Medicine is to dorsal part ventriculus tertius (D3V): i) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns
NLF-siRNA), iv) naked 5-HT1AR-siRNA or v) 5-HT1AR-NLF-siRNA (30 μ g/2.5 μ l/1 days).Also have rated it
The 5-HT of its group1AR knocks out (5-HT1AR-KO) mice.Body temperature is administered (1mg/kg lumbar injection) 5 minutes before at 8-OH-DPAT
Or evaluate for 15,30,60 and 120 minutes afterwards.Note at the 5-HT puted together1AR-NLF-siRNA and 5-HT1A8-in R-KO mice
The impact of body temperature is not existed by OH-DPAT.Numerical value is shown as the meansigma methods ± from often organizing 7-10 mice that body temperature changes
SEM.* p < 0.01 respectively with carrier, the naked siRNA of ns, ns NLF-siRNA and naked 5-HT1AThere were significant differences for R-siRNA, utilizes
Repeated measure ANOVA, in the factor of tested internal variable and processes between the time, is finally multiple comparisons Newman-Keuls
Inspection.
Fig. 7. (R)-(+)-8-hydroxyl-2-(two-n-propylamine) tetrahydronaphthalene hydrobromate (8-OH-DPAT, 0.5mg/kg abdomen
Chamber is injected) Formulations for systemic administration is on the impact of dialysis solution 5-HT level in prefrontal cortex in mice (mPFC).Each group mice is: i) carry
Body, ii) nonsense NLF-siRNA (ns NLF-siRNA), iii) 5-HT1ANLF-siRNA (the 5-HT of R-targeting1AR-NLF-
SiRNA) and iv) 5-HT1AR knock-out mice (5-HT1AR-KO).Mice was injected carrier or siRNA in l/1 days with 30 μ g/2.5 μ,
Intracerebral ventricle injection, Microdialysis Experiments is carried out after injecting 24-48 hour.Notice at 5-HT1AMediation 5-under autoreceptor
HT1AIn the mPFC of R-KO mice, the impact of the 8-OH-DPAT 5-HT level on reducing does not exists.Data representation is the hundred of baseline
Proportion by subtraction is also shown as meansigma methods ± SEM (n=5-9 mice/group).* p < 0.01 is notable with carrier and ns NLF-siRNA group
Difference, utilizes repeated measure ANOVA, in the factor of tested internal variable and processes between the time, last multiple comparisons
Newman-Keuls checks.Fig. 8. Sertraline (selective depressant of 5-hydroxy tryptamine transporter-5-HTT) is to the 5-puted together
HT1AR-NLF-siRNA is delivered to the impact of 5-HT neuron.A) acute Sertraline injection (mg/kg lumbar injection) avoids 5-
HT1AAutoreceptor is by the 5-HT puted together1AThe silence of R-NLF-siRNA, and acute 8-OHDPAT is administered (selectivity 5-HT1AR
Agonist, 0.5mg/kg lumbar injection) reduce the 5-HT level in middle prefrontal cortex.Each group mice is: i) carrier, ii) nothing
Justice NLF-siRNA (ns NLF-siRNA), iii) 5-HT1ANLF-siRNA (the 5-HT of R-targeting1AR-NLF-siRNA) and iv)
5-HT1AR knocks out (5-HT1AR-KO).Mice is little inject siRNA entrance D3V (30 μ g/2.5 μ l/1 days, intracerebral ventricle injection) 3
Selectivity 5-HTT inhibitor, the acute injection of Sertraline (20mg/kg lumbar injection) was accepted time before.It addition, one group of mice connects
D3V is entered by carrier lumbar injection and carrier.Microdialysis is carried out real after intracerebral ventricle injection carrier or siRNA are administered 24 hours
Test.Data representation is the percentage ratio of baseline and is shown as meansigma methods ± SEM (n=5-8 mice/group).* * p < 0.001 is with right
According to and 5-HT1AThere were significant differences for R-NLF-siRNA group, utilizes single factor test ANOVA, followed by multiple comparisons Newman-Keuls to examine
Test.B) selectivity 5-HTT inhibitor is used in advance, in the NLF-siRNA mice that Sertraline (20mg/kg lumbar injection) processes,
8-OH-DPAT is administered (1mg/kg lumbar injection) impact on body temperature.Mice group is similar in figure A.Unlike 5-HT1AR-NLF-
SiRNA group, at the 5-HT of Sertraline pretreatment1AIn R-NLF-siRNA mice, 8-OH-DPAT is administered and creates hypothermia sound
Should.Numerical value is shown as meansigma methods that body temperature changes ± from the SEM often organizing 6-10 mice.* * p < 0.001 utilizes dual factors
ANOVA followed by multiple comparisons Newman-Keuls checks.
Fig. 9. acute fluoxetine (selective depressant of 5-hydroxy tryptamine transporter-5-HTT, 20mg/kg lumbar injection) is given
Medicine is on the impact of dialysis solution 5-HT level in prefrontal cortex in mice (mPFC).Each group mice is: i) carrier, ii) nonsense NLF-
SiRNA (ns NLF-siRNA), iii) 5-HT1ANLF-siRNA (the 5-HT of R-targeting1AR-NLF-siRNA) and iv) 5-HT1AR
Knock out (5-HT1AR-KO).Mice being injected carrier or siRNA, intracerebral ventricle injection in l/1 days with 30 μ g/2.5 μ, Microdialysis Experiments exists
Carry out after injecting 24-48 hour.Notice that chlorine Xi Ting is to 5-HT1AThe 5-HT level that autoreceptor is lowered in the mPFC of mice has
Reinforced effects, is similar at 5-HT1AThose in R-KO mice.Data representation be baseline percentage ratio and be shown as meansigma methods ±
SEM (n=4-6 mice/group).There were significant differences for * p < 0.01 and carrier and nsNLF-siRNA group, utilizes repeated measure
ANOVA, in the factor of tested internal variable and processes between the time, subsequently multiple comparisons Newman-Keuls inspection.
Figure 10. at 5-HT1AAutoreceptor is lowered anxiety in mice and is similar to behavior and does not change, but in pressure/depression phase
Close the response changed in test.Each group mice is: i) carrier, ii) 5-HT1ANLF-siRNA (the 5-HT of R-targeting1AR-NLF-
SiRNA) and iii) 5-HT1AR knocks out (5-HT1AR-KO).Mice carrier or siRNA, with 30 μ g/2.5 μ l/1 days, are injected into
D3V, intracerebral ventricle injection.A) anxiety is similar to behavior Elevated plus-maze and is administered the post-evaluation of 24 hours at carrier or siRNA.With
5-HT1AR knock-out mice (5-HT1AR-KO) different, 5-HT1AAutoreceptor lowers mice (5-HT1AR-NLF-siRNA) display exists
Enter number of times and Elevated plus-maze open arms spend time there is no difference.B) tail-suspention test is selected as example to comment
Valency response under Acute Stress/Condition of depression.This test is estimated after carrier or siRNA are administered 48 hours.Compare
In vehicle group, under stress situations, 5-HT1AMediation 5-HT under autoreceptor1AR-KO mice illustrates the motility of increase.Number
Value is meansigma methods ± SEM (n=12-18 mice/group).* p < 0.05, * * p < 0.01, * * * p < 0.001 and carrier have significantly
Difference, utilizes single factor test ANOVA followed by Newman-Keuls post hoc to check.
Figure 11. the 5-HT that intranasal administration is puted together1AThe selectivity 5-HT that R-NLF-siRNA causes1AAutoreceptor is reticent.Little
Mus accepts single intranasal administration: i) carrier, ii) nonsense NLF-siRNA (ns NLF-siRNA) and iii) 5-HT1AR-NLF-
SiRNA (15 μ g/5 μ l in each nostril).A) 5-HT of dorsal raphe nucleus (DRN)1AR is expressed and is assessed by situ hybridization.Post
Shape figure shows 5-HT in DRN1AThe 5-HT of R-NLF-siRNA induction1AThe reduction of R mRNA level in-site.The 5-measured on film
HT1AThe photodensitometric quantitation of RmRNA positive particle is shown as average optical (OD) percentages ± SEM, and (n=4 mice is every
Group and in 2 times of the 3AP level observations of DRN).B-D)5-HT1AR-NLF-siRNA induces presynaptic 5-HT1AUnder the specificity of R
Adjust, but be not postsynaptic sites.Dorsal raphe nucleus (B), prefrontal cortex (C) and the 5-HT of hippocampus (D)1AR protein level
Combined by autoradiography and use3[H]-8-OH-DPAT evaluates.Figure post represents 5-HT1AR fmol/mg histone average
Value ± SEM (n=4 mice often group and in 2 times of the 3AP level observations of DRN with in prefrontal cortex and the left and right of hippocampus
2 observations in site).* there were significant differences for p < 0.05, * * p < 0.01 and carrier and ns NLF-siRNA, utilizes single factor test
ANOVA followed by Newman-Keuls post hoc checks.
Figure 12 .8-OH-DPAT (selectivity 5-HT1AR agonist) to 5-HT1AAutoreceptor lower in mice physiology and
The impact of neuro chemistry parameter does not exist.Each group mice single intranasal administration of acceptance: i) carrier, ii) nonsense NLF-siRNA
(ns NLF-siRNA) and iii) 5-HT1AR-NLF-siRNA (each nostril 15 μ g/5 μ l).A) with carrier and ns NLF-siRNA
The mice processed is different, and the 8-OH-DPAT of 1mg/kg lumbar injection dosage is at 5-HT1AIn R-NLF-siRNA mice to body temperature not
Produce any change.Numerical value is shown as meansigma methods ± SEM (n=4-7 mice often group) that body temperature changes.B) carrier, nsNLF-
SiRNA and 5-HT1AThe mPFC of R-NLF-siRNA mice measures extracellular 5-HT level, then whole body by vivomicrodialysis
It is administered 8-OH-DPAT (0.5mg/kg lumbar injection).In the mPFC of carrier and nsNLF-siRNA, 5-HT level all drops
Low.But, 5-HT1AR-NLF-siRNA mice shows and there is not 8-OH-DPAT to the impact of 5-HT level in mPFC.Tables of data
Reach for the percentage ratio of baseline and be shown as meansigma methods ± SEM (n=4-9 mice/group).* p < 0.01, * * * p < 0.001 point
Not and carrier and ns NLF-siRNA there were significant differences, be utilized respectively single or double factor ANOVA followed by multiple comparisons Newman-
Keuls checks.
Figure 13. intranasal 5-HT1AR-NLF-siRNA silence 5-HT1A-autoreceptor also causes antidepressant similar response.Mice
Accept single intranasal administration: i) carrier, ii) 5-HT1AR-NLF-siRNA (each nostril 15 μ g/5 μ l) and iii) 5-HT1AR-
NLF-siRNA (each nostril 50 μ g/5 μ l).A) 5-HT in Elevated plus-maze1AAny dosage of R-NLF-siRNA is the most not
Affect anxiety and be similar to response (n=6).Numerical value is meansigma methods ± SEM.B) single intranasal administration 5-HT1AR-NLF-siRNA (30 or
100 μ g) cause fixed dose dependent in tail-suspention test to reduce (n=10-15).Numerical value is meansigma methods ± SEM.Single factor test
ANOVA shows the group of remarkable result, F2,34=8.70, p < 0.001.Relative to carrier * p < 0.05, * * * p < 0.001.C)
Single intranasal administration 5-HT1AR-NLF-siRNA (100 μ g) causes fixed reduction (n=13-16) in forced swimming test.
Numerical value is meansigma methods ± SEM.Single factor test ANOVA shows the group of remarkable result, opposite carrier * p < 0.05, * * p < 0.01.
Figure 14. specificity 5-HT transporter (5-HTT) that the 5-HTT-NLF-siRNA that intranasal administration is puted together causes is reticent.
A) 5-HTT of dorsal raphe nucleus (DR) is expressed and is evaluated by situ hybridization.The mice single administration of acceptance: i) carrier, ii) 5-
HTT-NLF-siRNA, in each nostril 5 μ g/5 μ l (5-HTT-NLF-siRNA 10) and, iii) 5-HTT-NLF-siRNA, often
15 μ g/5 μ l (5-HTT-NLF-siRNA 30) in individual nostril.A1-a333 shows on (AP) coordinate before and after three differences
With33The coronal section of the mice rapheal nuclei that the 5-HTT-specific oligonucleotide of P-labelling combines, in terms of mm: from anterior fontanelle (kiss tail
-4.24/-4.36 ,-4.36/-4.60 and-4.72/-4.84 from left to right).Scale, 500 μm.B) block diagram shows 5-
The reduction of 5-HTT mRNA level in-site in the dorsal raphe nucleus of HTT-NLF-siRNA induction.The 5-HTT mRNA measured on film is positive
The photodensitometric quantitation of granule is shown as average optical (OD) percentages ± SEM, and (n=4 mice often group, at dorsal suture nerve
2-4 observation of the 3AP level of core).* there were significant differences with carrier for p < 0.05, * * p < 0.01, utilize single factor test ANOVA with
After be Newman-Keuls post hoc inspection.
The 5-hydroxy tryptamine transporter specific downregulation of Figure 15 .5-HTT-NLF-siRNA induction, by situ hybridization and radiation
Autography combines and evaluates.The mice single administration of acceptance: i) carrier, ii) nonsense-NLF-siRNA, each nostril 15 μ g/5 μ l,
Iii) 5-HTT-NLF-siRNA, each nostril 5 μ g/5 μ l (5-HTT-NLF-siRN A 10) and, iv) 5-HTT-NLF-
SiRNA, each nostril 15 μ g/5 μ l (5-HTT-NLF-siRNA 30).A) block diagram shows that 5-HTT-NLF-siRNA induces
In dorsal part (DR) and the reduction of the 5-HTT mRNA level in-site of middle part (MnR) rapheal nuclei.The 5-HTT mRNA measured on film is positive
Granule photodensitometric quantitation is shown as average optical (OD) percentages ± SEM (n=7-10 mice often group).* p <
There were significant differences for the carrier of 0.05, * * * p < 0.001 and same area and nonsense-NLF-siRNA, utilize single factor test ANOVA with
Rear Newman-Keuls post hoc checks.B-C) photodensitometry that specificity 5-HTT combines is expressed as % and combines carrier note
Enter the corresponding region of mice, in order to the degree that in each region, the 5-HTT of NLF-siRNA-induction lowers is described.Figure post represents flat
The SEM of mean value ± 6-9 mice/group.* p < 0.05, * * p < 0.01 has with carrier and the nonsense-NLF-siRNA of same area
Significant difference, utilizes single factor test ANOVA Newman-Keuls post hoc subsequently to check.
Figure 16 .A) acute fluoxetine (selective depressant of 5-HT transporter, 20mg/kg lumbar injection) be administered to mice
The impact of dorsal part striatal dialysis solution 5-HT level.The mice single administration of acceptance: i) carrier, ii) 5-HTT-NLF-siRNA,
Each nostril 5 μ g/5 μ l (5-HTT-NLF-siRNA 10) and, iii) 5-HTT-NLF-siRNA, each nostril 15 μ g/5 μ l (5-
HTT-NLF-siRNA30).Microdialysis Experiments is carried out after applying 24-48 hour.Fluoxetine creates dorsal part stricture of vagina in vehicle group
The increase of 5-HT level in shape body, does not then have in 5-HTT-NLF-siRNA group.B) selectivity 5-HT transporter inhibitors, west
The phthalein Pulan (Cit) local influence to the 5-HT level in the dorsal part striatum of carrier and 5-HTT-NLF-sirRNA mice.West
The topical of phthalein Pulan adds the 5-HT level in the dorsal part striatum of vehicle group with concentration dependant manner.But, west
The only slight increase of 5-HT level in 50 μMs of striatums producing 5-HTT-NLF-siRNA group of phthalein Pulan.Data representation is base
The percentage ratio of line is also shown as meansigma methods ± SEM (n=7-8 mice/group).There were significant differences with carrier for * p < 0.01, utilizes
Repeated measure ANOVA, in the factor of tested internal variable and processes between the time, subsequently multiple comparisons Newman-Keuls inspection
Test.
Figure 17 .NLF-NS-siRNA-Cy3 selectivity targeting to the dopaminergic neuron of substantia nigra compacta.A and C shows
Show the NLF-NS-siRNA-Cy3 of red-label, be administered siRNA 1 and after 3 hours at mice Ventral Midbrain ICV respectively.B
The same tag merged that dyes with tyrosine hydroxylase (TH) is shown with D.NLF-NS-siRNA-Cy3ICV is administered 1 hour
Afterwards (A and B), red-label (Cy3) can detect (blue) in TH-positive substantia nigra neuron, but can not be at black substance
The aminobutyric acid serotonergic neuron of reticular part detects (*).Red-label follows point-like pattern (insertion).After injecting 3 hours,
Any red cell internal labeling (C and D) can not be detected.
Figure 18 .NLF-NS-siRNA-Cy3 selectivity targeting to the noradrenergic neuron of nucleus ceruleus.A and C
It is respectively displayed on ICV and is administered the red-label of NLF-NS-siRNA-Cy3 after siRNA 1 and 3 hours.B and D shows and cheese ammonia
The same tag that acid hydroxylase (TH) dyeing merges.NLF-NS-siRNA-Cy3ICV is administered (A and B) after 1 hour, red
Labelling (Cy3) mainly can be detected (blue) in TH-positive noradrenergic neuron.Red-label is followed a little
Shape pattern (is inserted).After injecting 3 hours, any red cell internal labeling all can't detect (C and D).
Figure 19. the nonsense (C-ns-TOM) of 2-O '-methyl (the TOM)-modification of Sertraline-put together is at ridge 5-
Selectivity accumulation in hydroxytryptamine neuron.Mice accepts single Intraventricular and injects the C-ns-TOM (30 μ g) of Cy3-labelling extremely
Dorsal part ventriculus tertius also puts to death (n=2 mice) after injecting 24 hours.The laser copolymerization of YOYO1-immunoreactive cell core
Burnt image (green) shows the C-ns-TOM (red) of the Cy3 labelling of local immunity.Scale is 40 μm.
Detailed Description Of The Invention
The author of the present invention it has been observed that unexpectedly, by described nucleic acid is covalently coupled to such molecule,
Can by the cell interested of nucleic acid specificity targeted expression neurotransmitter transporters, described molecule can specific binding extremely
Described neurotransmitter transporters and, more specifically, to the inhibitor of described transporter.
A.The conjugate of the present invention
At first aspect, the present invention relates to conjugate, it comprises:
I) at least one specific binding selective reagent to one or more neurotransmitter transporters,
Ii) at least one can the specific binding oligonucleotide to target molecules, described target molecules is identical thin
Born of the same parents are expressed as neurotransmitter transporters.
As the term is employed herein " conjugate ", refer to by two or more single compound covalent bond formed any
Compound.In the present invention, conjugate refers to comprise the molecule of the nucleic acid of covalent coupling and selective reagent, described coupling directly or
Pass through linker compounds.
Term " covalent coupling " or " covalent bond " meaning are nucleic acid and selective reagent or the most covalently bound,
Or by insertion portion each other indirectly by covalently bound, described insertion portion such as joint, or bridging, or isolated part.
A.1.Selective reagent
Express " selective reagent specific binding with one or more neurotransmitter transporters " as used herein, refer to
Any material being combined with neurotransmitter transporters.This binding specificity makes the molecule being connected with described selective reagent deliver
To cell, tissue or organ containing described neurotransmitter transporters.In this way, when being awarded animal or at body
Outer when contacting with different types of cell population, the conjugate containing described selective reagent specificity is directed to described carefully
Born of the same parents,
As used herein, the first molecular specificity is attached to the second molecule and refers to that the first molecule is attached to described second molecule
Ability be markedly different from non-specific interaction to a certain extent.It is right that selective reagent according to the present invention can show
It is at least about 10 in the Kd of target (neurotransmitter transporters)-4M, the most at least about 10-5M, the most at least about 10-6M, can
Selection of land at least about 10-7M, the most at least about 10-8M, the most at least about 10-9M, the most at least about 10-10M, the most extremely
Few about 10-11M, the most at least about 10-12M or higher.
As the term is employed herein " neurotransmitter transporters ", referring to that a class belongs to the albumen of protein called membrane transporters, it is crossed over
The cell membrane of neuron, and its major function is that delivery neurotransmitter is through these films guide it to be transported to cell further
Interior specific position.The selective reagent of the present invention can include, but not limited to nerve with the neurotransmitter transporters of targeting
Absorbing carrier present in the plasma membrane of unit and neurogliocyte, neurotransmitter is pumped into intracellular by it from extracellular space.Should
Process depends on the Na striding across plasma membrane+Gradient, specifically Na+Cotransport.Identify the albumen of Liang Ge family.One family
Including for GABA, monoamine such as norepinephrine, dopamine, 5-hydroxy tryptamine, and aminoacid such as glycine and proline
Transporter.Common structural component includes 12 transmembrane spanning α-helices domains estimated, cytoplasmic N-and C-end, and
Membrane spaning domain is divided into three or four parts by one big glycosylation extracellular loop.The homologous protein of this family by energy from Na+With
Cl-Ion and cotransporting of neurotransmitter are delivered to cell (Na+/Cl-Neurotransmitter transporters).Second family include for
The transporter of excitatory amino acid such as glutamic acid.Common structural component includes 6-10 membrane spaning domain of presumption, carefully
N-and the C-end of kytoplasm, and glycosylated cells outer shroud.Described excitatory amino acid transporter does not relies on Cl-, but can
Intracellular K can be needed+Ion (Na+/K+-neurotransmitter transporters) (Liu, Y.et al. (1999) Trends Cell
Biol.9:356-363).
Can be also included within intracellular cyst membrane with the neurotransmitter transporters that the selective reagent targeting of the present invention is combined
Exist neurotransmitter transporters, typically in synaptic vesicle, its major function be in synapse transmittance process in vesicle
Before tolerant exocytosis, will concentrate from cytoplasmic neurotransmitter and enter in vesicle.Vesicle transport utilizes and strides across vesicle film
H+The electrochemical gradient that-ATP enzyme produces.The albumen of Liang Ge family relates to neurotransmitter and is transported into vesicle.One family master
Proton exchange to be utilized is transported into Secretory vesicles to drive and includes the transporter of monoamine and acetylcholine.Such as, monoamine turns
Fortune body is by every kind of molecule that two kinds of intracavity proton exchange are Cytoplasm mediator.Second family includes gaba transporter, and it relies on
Positive charge in synaptic vesicle.This two classes Vesicle transport body demonstrates do not have sequence similarity each other and have and plasma membrane
Distinct structure Schloss of carrier, P.et al. (1994) Curr.Opin.Cell Biol.6:595-599;Liu,
Y.et al. (1999) Trends Cell Biol.9:356-363).
Can include with the particular type of the neurotransmitter transporters that the selective reagent targeting of the present invention is combined glutamic acid/
Aspartate Transporter, including, excitatory amino acid transporter 1 (EAAT1), excitatory amino acid transporter 2 (EAAT2), emerging
Put forth energy acidic amino acid transporter 3 (EAAT3), excitatory amino acid transporter 4 (EAAT4), excitatory amino acid transporter 5
(EAAT5), vesicle glutamate transporter 1 (VGLUT1), vesicle glutamate transporter 2 (VGLUT2) and vesicle glutamate transporter
3(VGLUT3);Gaba transporter, including, gaba transporter Class1 (GAT1), gaba transporter type 2 (GAT2), GABA turns
Fortune body type 3 (GAT3), glycine betaine transporter (BGT1) and vesicle gaba transporter (VGAT);Glycine transporter, including, sweet
Propylhomoserin transporter Class1 (GlyT1), glycine transporter type 2 (GlyT2);Monoamine transporter, including, DAT
(DAT), norepinephrine transporter (NET), 5-hydroxy tryptamine transporter (SERT), vesicular monoamine transporter 1 (VMAT1), capsule
Bubble monoamine transporter 2 (VMAT2);Adenosine transport body, including, equilibrated type nucleoside transporting body 1 (ENT1), equilibrated type nucleoside transporting body
2 (ENT2), equilibrated type nucleoside transporting body 3 (ENT3) and equilibrated type nucleoside transporting body 4 (ENT4) and the transhipment of vesicle acetylcholine
Body (VAChT).
In one preferred embodiment, selective reagent is not peptide.
In one preferred embodiment, selective reagent is selected from serotonin reuptake inhibitor (SRI), selectivity
Serotonin reuptake inhibitor (SSRI), 5-hydroxy tryptamine-NRI (SNRI), noradrenaline
Element can be with the antidepressant (NASSA) of specificity 5-hydroxy tryptamine energy, NRI (NRI), dopamine
Reuptake inhibitor (DRI), Endocannabinoids reuptake inhibitor (eCBRI), adenosine reuptake inhibitor (AdoRI), emerging
Put forth energy acidic amino acid reuptake inhibitor (EAARI), glutamic acid reuptake inhibitor (GluRI), GABA reuptake inhibitor
(GRI), glycine reuptake inhibitors (GlyRI) and norepinephrine-dopamine reuptake inhibitor (NDRI).
Term " serotonin reuptake inhibitor " or " SRI ", refer to hinder the molecule of 5-hydroxy tryptamine picked-up, including choosing
(its specificity hinders 5-hydroxy tryptamine picked-up to have no substantial effect on other nerves to selecting property serotonin reuptake inhibitor (SSRI)
Mediator) and also include non-selective serotonin reuptake inhibitor such as 5-hydroxy tryptamine-norepinephrine reuptake suppression
Agent (SNRI) and 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor (SNDRI).
Term " 5-hydroxy tryptamine selectivity reuptake inhibitor " or " SSRI ", refer to the Selective depression of serotonin reuptake transporter
Agent, it has no substantial effect on the picked-up of other neurotransmitter or delivery system.These compounds are mainly at presynaptic 5-hydroxy tryptamine energy
Cell work, cause the raising of the Intracellular levels of neurotransmitter serotonin, thus improve the level of 5-hydroxy tryptamine, make
It can be in conjunction with postsynaptic receptor the activity deficiency inverting brain this monoaminergic nerve neurotransmitter systems interior.The exemplary non-limit of SSRI
Property example processed includes Sertraline (CAS 79617-96-2), Sertraline-analog, fluoxetine (CAS 54910-89-3),
Fluvoxamine (CAS 54739-18-3), paroxetine (CAS 61869-08-7), indalpine (CAS63758-79-2), Qi Mei
Fixed (CAS 56775-88-3), citalopram (CAS 59729-33-8) and escitalopram (CAS 219861-08-2).Determine to
Determine compound whether taking on the assay method of SSRI is such as, to reduce external picked-up 5-hydroxy tryptamine and the p-chloroamphetamine of antagonism
The ability of 5-hydroxy tryptamine-consumption behavior, and do not affect rat heart picked-up intravenous [3H] norepinephrine, as at Koe
Et al. (J.Pharmacol.Exp.Ther., 1983,226:686-700) substantially describes.
At one preferred embodiment, described SSRI is Sertraline or its analog and has structure (I)
Wherein, independently, R1、R2、R3、R4、R5And R6It is hydrogen or any substituted C1-C6 alkyl;X and Y each be selected from hydrogen,
Fluorine, chlorine, bromine, trifluoromethyl, C1-C3 alkoxyl and cyano group;And W is selected from hydrogen, fluorine, chlorine, bromine, trifluoromethyl, nitro and C1-C3
Alkoxyl.In some embodiments, Sertraline analog is with the configuration of cis-isomery.Term " cis-isomery " refers to
NR in cyclohexene ring1R2Relative bearing (that is, they are all in the same side of ring) with phenyl moiety.Because 1-carbon and 4-
Carbon is all Asymmetrical substitute, and each cis-compound has 2 to represent (with reference to I-carbon) with cis-(1R) and cis-(1S) enantiomer
Enantiomeric form.
Some useful Sertraline analog is following compound, with (1S)-enantiomer or (1S) (1R) raceme shape
Formula, and their pharmaceutically acceptable salt:
-cis-N-methyl-4-(3,4-Dichlorobenzene base)-1,2,3,4-tetrahydrochysenes-naphthalidine;
-cis-N-methyl-4-(4-bromophenyl)-1,2,3,4-tetrahydrochysenes-naphthalidine;
-cis-N-methyl-4-(4-chlorphenyl)-1,2,3,4-tetrahydrochysenes-naphthalidine;
-cis-N-methyl-4-(3-trifluoromethyl)-1,2,3,4-tetrahydrochysenes-naphthalidine;
-cis-N-methyl-4-(3-trifluoromethyl-4-chlorophenyl)-1,2,3,4-tetrahydrochysenes-naphthalidine;
-cis-N, N-dimethyl-4-(4-chlorphenyl)-1,2,3,4-tetrahydrochysenes-naphthalidine;
-cis-N, N-dimethyl-4-(3-trifluoromethyl)-1,2,3,4-tetrahydrochysenes-naphthalidine;With
-cis-N-methyl-4-(4-chlorphenyl)-7-chloro-1,2,3,4-tetrahydrochysenes-naphthalidine.
Also of interest is cis-N-methyl-4-(3,4-Dichlorobenzene base)-1, (1R) of 2,3,4-tetrahydrochysenes-naphthalidine-right
Reflect body.
Sertraline analog is also described in U.S. Patent number 4,536,518.Other relevant compounds include (S, S)-
N-demethyl Sertraline, raceme-cis-N-demethyl Sertraline, (1S, 4S)-demethyl Sertraline, 1-remove (methylamine)-1-
Carbonyl-2-(R, S)-hydroxyl Sertraline, (1R, 4R)-demethyl Sertraline, Sertraline, sulfonamide, Sertraline (reversely) methylsulfonyl
Amine, 1R, 4R Sertraline, enantiomer, N, N-dimethyl Sertraline, nitro Sertraline, Sertraline aniline, Sertraline iodide, house
Bent woods sulfonamide NH2, Sertraline sulfonamide ethanol, Sertraline nitrile, Sertraline-CME, the reverse sulfonamide of dimethyl Sertraline, house
The bent reverse sulfonamide of woods (CH2 joint), Sertraline B-ring ortho position methoxyl group, Sertraline A cyclohexyl methyl ester, Sertraline A-ring ethanol,
Sertraline N, N-dimethyl sulfonamide, Sertraline A ring carboxylic acid, Sertraline B-ring para-position phenoxy group, Sertraline B-ring para-position-trifluoro
Methane, N, N-dimethyl Sertraline B-ring and para-position-fluoroform and UK-416244.The following institute of structure of these analog
Show.
Term " 5-hydroxy tryptamine-NRI " or " SNRI " refer to pass through blocking 5-hydroxytryptamine
Transporter and suppress 5-hydroxy tryptamine reuptake and by block norepinephrine transporter and suppress norepinephrine
The chemical families of reuptake.This family includes compound such as venlafaxine (CAS 93413-69-5), desmethylvenlafaxine
(CAS 93413-62-8), duloxetine (CAS116539-59-4), midalcipran (CAS 92623-85-3), sibutramine
(106650-56-0), tramadol (CAS 27203-92-5) and bicifadine (CAS 71195-57-8).Determine given compound
Assay method as SNRI is, such as, and the ability that brain synaptosome picked-up 5-hydroxy tryptamine and norepinephrine reduce, as
Substantially at Bolden-Watson C, Richelson E. (Life Sci.1993;52 (12): 1023-9) described in.SNRI
A particular type be tricyclic antidepressant, it is the SNRI with the usual molecular structure containing three rings.Tricyclic antidepressants resists
The representative of depressant drug is linear tricyclic antidepressants, such as, imipramine, desipramine, amitriptyline, nortriptyline, and protriptyline is filled in more
Flat, Imipramine N-oxide, mianserin, dosulepin, amoxapine, dibenzepin, melitracen, maprotiline, flupentixol, A Zha
Fen, the related compound of tianeptine activity similar with display.Angular tricyclic anti-depressants includes indriline, clodazone, promise
Meter Fen Xin, and related compound.The variant of the antidepressants that other structure is different, such as, iprindole, the general product of cloth, Nyala
Amine, midalcipran, phenelzine and tranylcypromine have shown that have shares activity.They merits with tricyclic antidepressant
Can be equal, and be therefore included within the scope of the invention.Thus, the present inventor is wanted by term tricyclic antidepressant,
Including the broad variety of antidepressants mentioned above with have the related compound of general characteristics, they are owned by antidepressant and live
Property and include, and being not limited to, compound such as amitriptyline, amitriptylinoxide, carbamazepine, butriptyline, clomipramine, ground is beautiful
For woods, desipramine, dibenzepin, dimetacrine, dosulepin/dosulepin, doxepin, imipramine, imipraminoxide, Yi Pu
Indole, lofepramine, melitracen, metapramine, nitre sand Xiping, nortriptyline, noxiptiline, Pregabalin, propizepine,
Protriptyline, quinupramine and trimeprimine.
Term " NRI ", " NRI ", " NERI ", " Adrenergic reuptake suppression
Agent " or " ARI " refer to the compound of such a family, its can by block norepinephrine transporter (NET) activity
And block norepinephrine and adrenergic reuptake.The compound of this family includes selective N RI, and it blocks exclusively
NET, and do not affect other monoamine transporter, and non-selective NRI such as SNRI, its block norepinephrine transporter and
5-hydroxy tryptamine transporter (sees above), norepinephrine-dopamine reuptake inhibitor (NDRI), and it blocks noradrenaline
Element and DAT (seeing below), tricyclic antidepressant and tetracyclic antidepressants (seeing above).It is applicable to the present invention
Suitable selective N RI include, but not limited to atomoxetine/tomoxetine (Strattera or CAS 83015-26-
3), Mazindol (Mazanor, Sanorex or CAS 22232-71-9), reboxetine (Edronax, Vestra or CAS
98819-76-2) with viloxazine (Vivalan or CAS 46817-91-8).
Term " dopamine reuptake inhibitor " or " DRI " become by blocking the activity of DAT (DAT)
The reuptake inhibitor of neurotransmitter dopamine.This thus cause intracellular dopamine concentration increase and thus increase dopamine
Can neurotransmission.The DRI being suitable for includes, but not limited to medical such as survector, benztropine/benzatropine, An Fei
His ketone, dexmethylphenidate, esketamine, etybenzatropine/Ethybe, ethybenzatropine, fencamfamin, fencamine, ketamine, profit is non-
He is bright, medifoxamine, mesocarb, methylphenidate, nefopam, nomifensine, pipradrol, prolintane, and pyrovalerone replaces
Carry out his bright and tripelennamine;Chemical drugs in research such as altropane (training south), amfonelic acid, phencyclidine, Bu Suo
Fragrant new, bromantan, DBL-583, dichloropropane=, diclofensin, phenylcyclohexyl diethylamide (Dieticyclidine),
Difluoro puts down (dfluoropine), gacyclidine, GBR-12, and 935, indatraline, ioflupane, iometopane, Ma Nifaxin, thunder
Da Faxin, tametraline, for Suo Fenxin, troparil and vanoxerine.Suitably DRI can be with known to those skilled in the art
Analysis method identify, such as measure the DRI of presumption by the synaptosome preparation prepared from rat striatum the high parent of suppression
With the ability of power picked-up dopamine, use method disclosed in documents below: Kula et al., (LifeSciences 34:
2567-2575,1984).
Term " Endocannabinoids reuptake inhibitor " or " eCBRI ", as used herein, refer to by block endogenous big
The activity of fiber crops element transporter and any compound of reuptake inhibitor as Endocannabinoids.There is the chemical combination of this activity
Thing can be identified by the method being described in documents below: and Beltramo, M.et al. (Science, 1997,277:1094-
1097), Endocannabinoids reuptake inhibitor based on presumption blocks cannabinoid by neurons of rats and spider cell
The ability of picked-up, and include, but not limited to AM404, N-arachidonic Rhizoma et radix valerianae amine (arvanil) and olvanil.
Term " adenosine reuptake inhibitor " or " AdoRI " refer to by blocking one or more equilibrated type nucleoside transporting body
(ENTs) behavior and as purine nucleosides and the compound of the reuptake inhibitor of neurotransmitter adenosine.This thus cause thin
Therefore the increase of intracellular adenosine concentration also increases adenosine energy neurotransmission.Have AdoRI activity compound can utilize below
Method is identified, i.e. based on presumption AdoRI at the analyzed in vitro suppressed by erythrocytic adenosine uptake with based on presumption AdoRI
The vasodilatory effects of suppression adenosine and the analyzed in vitro of promotion of the collateral vessel growth of prevention adenosine mediation, all these all
Can carry out essentially according to the description in US6984642.Suitably AdoRI includes, but not limited to acadesine, acetic acid
Leuprorelin, barbiturates, Benzodiazepines, calcium channel blocker, carbamazepine, carisoprodol, cilostazol, ring benzene is pricked
Woods, dilazep, dipyridamole, estradiol, ethanol (ethanol), flumazenil, hexabendine, hydroxyzine, indomethacin, inosine,
KF24345, meprobamate, Nitrobenzol methyl Thioguanosine, Nitrobenzol methyl NSC-40774, papaverine, pentoxifylline, phenol thiophene
Piperazine, phenytoin, Progesterone, propentofylline, propofol, puromycin, R75231, RE102BS, rope fluorine piperazine (Soluflazine),
Toyokamycin, tracazolate, tricyclic antidepressant.
Term " excitatory amino acid reuptake inhibitor " or " EAARI ", refer to by blocking excitatory amino acid transporter
Or EEATs and suppress the compound of excitatory amino acid reuptake.Already known multiple compounds combines EAAT and suppresses transhipment
The function of body.EAAT inhibitor is divided into two main classifications, and they differences are its binding mode: non-Transshipment Permitted blocker and
Competitive substrate.Suitably EAARI includes, but not limited to DL-Soviet Union-β-benzyloxy aspartic acid, kainite, dihydroxy
Kainate, 2S4R4MG, threo-beta-hydroxy aspartic acid, trans-pyrrolidine-2 of L-, 4-dicarboxylic acids (t-2,4-PDC).Close
Suitable EEARI can be identified by the analysis method that such as documents below describes: Shimamotot et al. (Molecular
Pharmacology, 1998,53:195-201), based on supposing that human excitability amino acid transporter-1 is expressed in EEARI suppression
Or the Cos-1 cell of human excitability amino acid transporter-2 (EEAT2) energy to radiolabeled glutamate uptake (EAAT1)
Power.
Term " glutamic acid reuptake inhibitor " or " GluRI ", refer to the row by blocking one or more glutamate transporter
For and as the compound of glutamic acid reuptake inhibitor.Suitably glutamic acid reuptake inhibitor includes known in the art
What such inhibitor, including, such as, threo-3 hydroxyl-DL-aspartic acid (THA), (2S)-trans-pyrrolidine-2,4-dicarboxyl
Acid (PDC), aminocaproic acid, and (2S, 3S)-3-{3-[4-(trifluoromethyl) Benzoylamide] benzyloxy } aspartic acid.Have
The compound of GluRI activity can utilize the analysis being such as described in documents below to identify: Shimamotot et al.
(MolecularPharmacology, 1998,53:195-201), based on supposing that GluRI suppression is expressed human excitability amino acid and turned
The Cos-1 cell of fortune body-1 (EAAT1) or human excitability amino acid transporter-2 (EEAT2) is to radiolabeled glutamic acid
The ability of picked-up.
Term " GABA reuptake inhibitor " or " GRI ", refer to the behavior by blocking γ-aminobutyric acid transporter (GAT)
And the compound of the reuptake inhibitor as neurotransmitter γ-aminobutyric acid (GABA).It thus cause intracellular GABA's
Concentration increases and thus adds the neurotransmission of GABA energy.Suitable GABA reuptake inhibitor includes, but not limited to add passes through
Leaf hypericin (is found in Herba Hyperici perforati (St.John ' s Wort)), CI-966, deramciclane (EGIS-3886), tetrahydrochysene cigarette
Acid (C10149), hyperforine (is found in Herba Hyperici perforati (St.John ' s Wort)), nipecotic acid, NNC 05-2090,
NNC-711, SKF-89976A, SNAP-5114, stiripentol and tiagabine (Gabitril), it is described in Borden LA et
Al. (Eur J Pharmacol.1994,269:219-224).Differentiate whether given compound is GABA reuptake inhibitor
Method is to it known in the art, such as at US6906177;US6225115;US4383999 and AIi, F.E., et al.
Description in (J.Med.Chem.1985,28,653-660).These methods generally comprise and make cells contacting radiolabeled
GABA also detects the picked-up of GABA in the case of candidate compound exists and do not exists.
Term " glycine reuptake inhibitors " or " GlyRI " refer to by block glycine transporter (GlyT) behavior and
As the compound of the reuptake inhibitor of neurotransmitter glycine, including following compound: block glycine transporter (1 type)
GlyTI, relates to removing glycine from synaptic cleft;And GlyT2, be glycine reuptake and refill entrance synaptic vesicle required for
(Gomeza et al., 2003;CurrOpin Drug Discov Devel 6 (5): 675-82).Conjunction for the present invention
Suitable glycine reuptake inhibitors include GlyT1 specific inhibitor such as N-methyl-N-[[(1R, 2S)-1,2,3,4-tetra-
Hydrogen-6-methoxyl group-1-phenyl-2-naphthyl] methylglycine (free alkali of MTHMPNM glycine), 4-[3-fluoro-4-the third oxygen benzene
Base] it is described in WO0007978 with-spiral shell [2H-1-.alpha.-5:6-benzopyran-2,4 '-piperidines]-1 '-acetic acid (free alkali of FPPSBPAA)
With in WO0136423, ALX 5407, sarcosine, 5,5-diaryl-2-amino-4-valeric acids or be described in the chemical combination of WO0208216
Thing, and GlyT2-specific inhibitor, such as, be described in the compound of WO05044810A, and its content is integrally incorporated this with it
Literary composition is as reference.The method of detection GlyT1-specificity or GlyT2-specificity reuptake inhibitor is to it known in the art, bag
Include such as, the method being described in WO05018676A or WO05044810, wherein express the thin of associated receptor (GlyT1 or GlyT2)
Born of the same parents contact radiolabeled glycine in the presence of tested reuptake inhibitory activity compound, after one period of preset time
The amount of the glycine of intracellular discovery is determined.
Term " norepinephrine-dopamine reuptake inhibitor " or " NDRI ", as used herein, refer to by hindering respectively
Disconnected norepinephrine transporter (NET) and the behavior of DAT (DAT) and as neurotransmitter norepinephrine
The compound of the reuptake inhibitor with dopamine.This thus cause the cell adding norepinephrine and dopamine
Extracellular concentration, and therefore increase adrenergic and dopaminergic neurotransmission.Suitable NDRI for conjugate of the present invention
Include, but not limited to amineptine (Survector, Maneon, Directin), BUP (Wellbutrin,
Zyban), dexmethylphenidate (Focalin), fencamfamin (Glucoenergan, Reactivan), fencamine (Altimina,
Sicoclor), Li Feitaming (Santenol), methylphenidate (Ritalin, Concerta), nomifensine (Merital), piperazine benzene
Methanol (Meretran), prolintane (Promotil, Katovit), pyrovalerone (Centroton, Thymergix), Nai Fu
Dissolving (Acupan), Adhyperforin. (is found in Herba Hyperici perforati (St.John ' s Wort)), and hyperforine (is found in
Herba Hyperici perforati (St.John ' s Wort)), cocaine, 2-benzhydryl piperidines (Desoxypipradrol) (2-DPMP), hexichol
Base dried meat ammonia alcohol (Diphenylprolinol) (D2PM), methylene dioxypyrrole pentanone (MDPV), cilobamine, Ma Nifaxin
(GW-320,659), radar method pungent (GW-353,162), tametraline (CP-24,441).
In one preferred embodiment, the conjugate of the present invention comprises selective reagent, in fact selectivity 5-hydroxyl color
Amine reuptake inhibitor (SSRI).In a preferred embodiment, SSRI is Sertraline or its knot as defined above
Structure analog.
A.2.The nucleic acid of conjugate of the present invention
Second component of the conjugate according to the present invention be can the specific binding nucleic acid to target molecules, described target
Mark molecule is at the cell inner expression identical with neurotransmitter transporters.Typically, the nucleic acid of the present invention can suppress target molecules
Function.Therefore, if target molecules is mRNA, then nucleic acid (typically siRNA, shRNA or antisensenucleic acids) is by suppression
The translation of mRNA and the protein level that causes this mRNA to encode reduces and works.If target molecules is albumen, then nucleic acid (allusion quotation
It is aptamers type) worked by the activity of suppression albumen.
Term " nucleic acid ", as used herein, refer to that there is two or more deoxyribonucleotide, ribonucleotide or nucleoside
The polymer of acid-like substance molecule, and similar in construction to self nucleic acid, but in one or more nucleic acid backbone (such as,
The phosphoric acid of self nucleic acid), nucleic acid glycosyl (such as, the ribose of the deoxyribose of self DNA and self RNA) and nucleic acid base (example
Such as, the adenosine in self nucleic acid, cytosine, guanine or thymus pyrimidine) on be different from self nucleic acid and (such as, repaiied by chemistry
Decorations) molecule.
Oligonucleotide can be double-strand or single stranded oligonucleotide, includes, but not limited to siRNA (siRNA), little
Folder RNA (shRNA), Microrna (miRNA), antisense oligonucleotide or ribozyme.If use double-strandednucleic acid, it comprises and target
First positive-sense strand of complementary nucleic acid and second antisense strand complementary with positive-sense strand, it allows by the alkali between the first and second chains
Basigamy to and form double-stranded DNA.
Term " antisense strand " refers to a chain of double-strandednucleic acid, and it includes substantially complementary with target sequence region.When mutually
Mending region not exclusively and the target sequence mutual added time, mispairing can allow outside 2-7 the nucleotide that the 5 ' of antisense strand is held.
Term " positive-sense strand ", as used herein, refer to a chain of dsRNA, it includes the most mutual with the region of antisense strand
The region mended.
Term siRNA (" siRNA ") refers to induce the little inhibition AMPLIGEN of rnai pathway.These molecules can
With change in length (usual 18-30 base pair) and comprise in antisense strand with its target mRNA complementation in various degree.One
A bit, but be not all, of siRNA and there is the unpaired overhanging base that positive-sense strand and/or the 5 ' of antisense strand or 3 ' is held.Term
" siRNA " includes the double-stranded chain (duplexes) of two chains separated.As used herein, siRNA molecule is not limited to RNA molecule,
But comprise the nucleic acid with the acid of one or more chemically modified nucleoside, such as morpholino thing further.
" shRNA " or " short hairpin RNA " refers to such dsRNA as the term is employed herein, and its two chains pass through a chain
3 ' end and another chain 5 ' hold between continuous nucleotide chain couple together to form bifilar structure.
Term " Microrna " or " miRNA " refer to short single strand RNA molecule, typically about 21-23 length of nucleotides, and
Can express by controlling gene.MiRNA can be artificial (that is, recombinant) or natural.Natural miRNA is transcribed by from DNA
Gene code, and be processed as short arm-ring structure (" precursor-miRNA ") from primary transcript (" primary-miRNA "), and
Eventually become ripe miRNA.Ripe miRNA molecule partial complementarity is in one or more mRNA molecules, and by disturbing class with RNA
As process or by suppression mRNA translate and down-regulation of gene expression.
" antisense sequences ", as used herein, including antisense or sense oligonucleotides, it comprises can be in conjunction with target mRNA
The single strand nucleotide sequence (RNA or DNA) of (just) or DNA (antisense) sequence.CDNA sequence based on the given albumen of coding and
Obtain the ability description of antisense or sense oligonucleotides in, such as, Si Tanyin and Koln, cancer research, volume 48: page 2659,
1988 (Steinand Cohen, Cancer Res.48:2659, (1988)) and model obtain Koror et al., biotechnology, and the 6th
Volume: page 958,1988 (van der Krol et al., BioTechniques 6:958, (1988)).
As used herein, term " ribozyme " or " RNase " or " catalytic RNA " refer to the RNA molecule that catalytic chemistry reacts.Very
Many natural nuclear enzymes are catalyzed the hydrolysis of one of himself phosphodiester bond, or the hydrolysis of key in other RNA, but have also been discovered that it
Be catalyzed ribosomal aminotransferase activity, the ligase of DNA ligase activity, and traditional protease realize multiple other
Chemical reaction.
" aptamers " finger as used herein combines the nucleic acid ligands in more than one site in target molecules, and combination therein is not
It is " complementary ", i.e. the base pair being not due between nucleic acid ligands and target nucleic acid sequence is formed.Aptamers can be designed as knot
Close the target of any anticipation, including polypeptide.Aptamers provides the purposes of biotechnology and treatment use, because of be provided for
The molecular recognition properties that conventional use of biomolecule antibody is competed mutually.In addition to its Selective recognition, aptamers also provides for
The advantage being better than antibody, because it can be processed completely in test tube, it is easy to produced by chemosynthesis, have desired
Shelf-stable characteristic, and cause little or no immunogenicity in therapeutic is applied.Aptamers can be by repetitive cycling
External differentiation, screen and amplify to synthesize, the method referred in the art as " SELEX " (index concentration Fas lignand system is evolved,
Systematic Evolution of Ligands by ExponentialENrichment) (husky agate et al., chemical research is commented
State .2008,41:130-8 page (Shamah etal, Acc.Chem.Res.2008,41 pp.130-8)).Alternatively, it can
With by the most progressively Solid phase synthesis.
The nucleic acid of the present invention can connect in core base, between glycosyl and/or nucleotide and comprise one or more modification.
The modification of one or more framework residues of nucleic acid can comprise modifies below one or more: 2 ' glycosyl modified examples
Such as 2 '-O-methyl (2 '-OMe), 2 '-O-methoxyethyls (2 '-MOE), 2 '-O-methoxyethoxies, 2 '-fluorine (2 '-F), 2 '-allyl
Base (2 '-AIIyI), 2 '-O-[2-(methylamino)-2-oxygen ethyl], 2 '-O-(N-methyl carbamate);4 ' glycosyl modified include
4 '-sulfur generation, 4 '-CH2-O-2 '-bridging, 4-(CH2)2-O-2 '-bridging;Lock nucleic acid (LNA);Peptide nucleic acid(PNA) (PNA);Insert nucleic acid
(INA);Nucleic acid (TINA) is inserted in distortion;Hexitol nucleic acid (HNA);Arabinose nucleic acid (ANA);Hexamethylene nucleic acid (CNA);Hexamethylene
Alkene nucleic acid (CeNA);Soviet Union's nucleic acid (TNA);Morpholine ring oligonucleotide;Clearance body (Gap-mer);Mixture (Mix-mer);Mix
Arginine is rich in peptide;Add the engineered rna of 5 '-phosphoric acid;RNA aptamers (fault-Ge Wosi NS, gene therapy, in February, 2007;The
Volume 14 the 4th phase: 283-91 page) (Que-Gewirth NS, Gene Ther.2007Feb;14 (4): 283-91.);Specific RNA fits
The RNA aptamers of antidote regulation in the object of part (with reference to Ou Nuo S, oligonucleotide .2007 autumn;The 3rd phase of volume 17:
265-74 page .) (ref.Oney S, Oligonucleotides.2007 Fall;17 (3): 265-74.) or its any combination.
The modification connected between one or more nucleoside of nucleic acid can comprise modifies below one or more: D2EHDTPA
Ester, phosphoramidate, di(2-ethylhexyl)phosphate carboxylic acid amide esters, phosphorodithioate, phosphoroselenoate, two phosphoroselenoate, thiophosphoramidate
Ester (phosphoroanilothioate) and phosphoramidate (phosphoranilidate), or its combination in any.
Lock nucleic acid (LNA), is often referred to inaccessible RNA, is the RNA nucleotide of a kind of modification.The ribose of LNA nucleotide
Extra bridge modified (O2 ', the C4 '-methylene bridge) of part connection 2 ' and 4 ' carbon.This bridge " is locked " and has been lived 3 '-internal structure structure
Ribose in as, is typically found in the A-type of DNA or RNA.If necessary, LNA nucleotide can in nucleic acid with DNA or
RNA base mixes.Such oligomer is commercially available.Lock ribose conformation enhances base stacking and pre-group of skeleton
Knit.This dramatically increases heat stability (melting temperature) and the hybridization affinity of the nucleic acid that LNA-modifies, additionally there is improvement
Mismatch binding ability.These characteristics make it highly useful to technology based on antisense.Further, LNA anti-miR oligonucleotide
It is tested in primates, and obtains incentive result and hypotoxicity.
Peptide nucleic acid(PNA) (PNA) is the polymer being similar to DNA or RNA of synthetic, and controls for biological study and medicine
Treat.PNA is known not to be naturally-occurring.DNA and RNA is respectively provided with ribodesose and ribose glycosyl skeleton, but the skeleton of PNA
Bonded and form by peptide by N-(2-the aminoethyl)-Glycine Unit repeated.Multiple purine and pyrimidine bases pass through methylene
Base carbonyl bond is connected to skeleton.PNA is similar to peptide and describes, and has N-end at initial (left) position and C-end on the right side.Due to PNA's
Skeleton does not comprise charged phosphate group, and the combination between PNA/DNA chain is stronger than between DNA/DNA chain, because not having
There is Coulomb repulsion.In terms of base pairing identification, mixing base pna molecule is real DNA molecular imitator.PNA/PNA ties
Composition and division in a proportion PNA/DNA combines more intensive.
Inserting nucleic acid (INA) is the nucleic acid analog modified, and comprises deoxyribonucleotide and is covalently attached to hydrophobic insertion.
INA has the high-affinity to complementary DNA, has the stability of up to 11 degree to every kind of modification.INA has than normal DNA entirely
Join target and compare the higher specificity of mismatched target.INA has the purposes to DNA higher affinity, and to make it to utilize shorter
Probe also thus further enhances specificity.Further, INA is DNA selective oligonucleotide analogs, have differentiation DNA and
The unique ability of RNA.Although INA has the high-affinity to complementary DNA, it has relatively low parent to the complementary series of complementary INA
And power.Distortion is inserted nucleic acid and is expressed as TINA.
Hexitol nucleic acid (HNA) is by natural nucleobases and phosphorylation 1, the oligonucleoside of 5-anhydrohexitol framework construction
Acid.Molecular link between HNA and RNA than between HNA and DNA and natural acid (dsDNA, dsRNA, DNA/RNA) between more
It is stable.Other manually modified oligonucleotide comprises ANA (arabinose nucleic acid), CAN (hexamethylene nucleic acid), CeNA (hexamethylene
Alkene nucleic acid) and TNA (Soviet Union's nucleic acid).
Morpholine ring is synthetic molecules, and it is the redesign product of natural acid structure.In structure, morpholine ring and DNA or
Difference between RNA is that morpholine has standard core base, and those bases are bound to hexa-atomic morpholine ring rather than deoxyribose/core
In sugar ring, and nonionic di(2-ethylhexyl)phosphate amide, the subunit connection ionic di-phosphate ester of replacement is bonded.Morpholine ring is sometimes referred to as PMO
(di(2-ethylhexyl)phosphate amide morpholino oligonucleotide).Hexa-atomic morpholine ring has chemical formula O-(CH2-CH2)2-NH。
Clearance body (Gapmer) or " gap oligomeric compounds " are RNA-DNA-RNA chimeric oligonucleotide probes, wherein DNA
Other RNA oligonucleotide that is normal or that modify is inserted in window or " gap ", and the latter becomes " wing " (wing).This kind is modified to be increased
The affinity of the internal stability of oligonucleotide and probe and the effect of target, such that it is able to effectively use shorter probe.
Preferably, the ribonucleotide that the wing is 2 '-O-methyl (OMe) or 2 '-O-methoxyethyl (MOE) is modified, it protects interior section
From nuclease degradation.Further, the nucleotide forming gap or the wing can pass through phosphodiester bond or pass through thiophosphate
Bonded, so that its tolerance RNase degraded.It addition, the nucleotide forming the wing can also be by merging 3 ' methyl acid phosphates
Ester connects the base combined and modifies.
The nucleic acid of the conjugate of the present invention can be expressed in the specific binding cell identical at neurotransmitter transporters
Target molecule.The combination of nucleic acid and target molecule can by Watson-gram in gram (Watspn-Crick) act on and occur, wherein target
Molecule is the nucleic acid containing the sequence complementary with nucleic acid sequences.Alternatively, when target molecules is polypeptide, the present invention sews
The nucleic acid of compound also can be with described molecular action, and nucleic acid is as aptamers in this case.
When forming the nucleic acid array complementation of nucleic acid and target mRNA of the part for conjugate of the present invention, to this area
Standards different for technical staff may be used for selecting most suitable nucleic acid.As example, when forming a conjugate part
When nucleic acid is siRNA, they can be by the AA dinucleotide of mRNA sequence of scanning target record that AA downstream follows closely 19
Nucleotide.Other method can be used for selecting nucleic acid target.In one embodiment, the selection of siRNA target sequence is complete
(see, e.g., Soviet Union G et al., PNAS, volume 99: 5515-20 page, 2002) (Sui G is determined by experience
Et al., Proc.Natl.Acad.Sci.USA 99:5515-20 (2002)), as long as target sequence originates in GG and uses
Blast search analysis does not has significant sequence homology with other gene.In another embodiment, a kind of more detailed side
Method is used for selecting siRNA target sequence.This process make use of such observation, and wherein any of endogenous mRNA can be close to site
Can be targeted by artificial oligodeoxyribonucleotide/RNase H method and (see, e.g., Lee NS et al., nature with degraded
Biology techniques, volume 20: 500-05 page, 2002) (Lee NS et al., NatureBiotechnol.20:500-05
(2002))。
Alternatively, hair clip siRNA expression cassette is configured to comprise the positive-sense strand of target, is followed by a shorter interval, target
Antisense strand, and 5-6 T is as transcription terminator.Positive-sense strand and the order of antisense strand in siRNA expression construct can change
Become, and do not affect the active for gene silencing of hair clip siRNA.In certain embodiments, the reversion of order may cause gene silencing
The part of activity reduces.
Length as the nucleotide sequence of the trunk of siRNA expression cassette can such as change in the range of 19-29.
The size of ring can change in the range of 3-23 nucleotide.Other length and/or ring size can also use.
In another one embodiment, it is possible to use 5 ' extensions of hair clip siRNA construct, condition is hair clip siRNA
Function in gene silencing.In a specific embodiment, 5 ' extensions include about 6 nucleotide residues.
In another one embodiment, the target sequence of RNAi is 21 sequence monomer fragments.5 ' ends of target sequence
Having a dinucleotide " NA ", wherein " N " can be any base and " A " represents adenine.Remain 19 sequence monomers there is GC to contain
Amount is between 35% and 55%.It addition, residue 19 sequence monomers do not include any four continuous print A or T (that is, AAAA or
TTTT), three continuous print G or C (that is, GGG or CCC), or seven " GC " in a line.
Other standard can be used for selecting RNAi target sequence.Such as, the G/C content remaining 19 sequence monomers can limit
System is between 45% and 55%.And, any have three identical bases of continuous print (that is, GGG, CCC, TTT, or AAA) or tool
19 sequence monomers having the palindrome of 5 or more base are all excluded.Further, remain 19 sequence monomers can be chosen as
There is the low sequence homology with other gene.In a specific embodiment, potential target sequence passes through BLASTN pin
Mankind UniGene (term single gene) bunch sequence library of NCBI is searched for.Mankind UniGene data base contains nonredundancy collection
Gene targeting bunch.Each UniGene bunch of sequence including representing a unique gene.Can select under BLASTN searches for
Do not produce 19 sequence monomers of the collision to other human gene.Under this search, e-value could be arranged to tight value (such as
“1”)。
SiRNA sequence, and the expression of other RNAi sequence pair silence target gene any derived according to the present invention
Effectiveness, can evaluate by multiple method known in the art.
Term " reticent " and " suppression is expressed ", " lower and express ", " gag expression " etc., when it points to target gene, this
At least part of suppression of the expression of literary composition middle finger target gene, shows as the minimizing of the amount of target mRNA, and it can be turned from target gene
First cell of record or groups of cells are separated, and the processed expression making target gene is suppressed, compared to the
Two cells or groups of cells, it is substantially identical with the first cell or groups of cells, but its not processed (compared with control cells).Suppression journey
Spend usual following term to express:
(compared with control cells mRNA)-(process cell mRNA) * 100%
(compared with control cells mRNA)
Alternatively, suppression degree can obtain according to the reduction of the parameter contacted with target gene expressive function, example
Such as the amount of albumen of, target gene coding or show the number of certain phenotypic cell.In principle, target gene group silence can
To determine in any cell of constitutive character or gene engineering expression target, by any suitable analysis.But, when needs are joined
Examine to determine given nucleic acid whether with to a certain degree suppress target gene expression and thus when comprising in the present invention, hereafter real
Execute in example provide and analysis known in the art will be as such reference.Such as, in some example, the table of target gene
Reach by the administration suppression at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% of double chain oligonucleotide, or
50%.In some embodiments, target gene is administered suppression at least 60%, 70%, or 80% by double chain oligonucleotide.One
In a little embodiments, target gene is administered suppression at least 85%, 90%, or 95% by double chain oligonucleotide.
Such as, the cell of expression target gene can be imported into according to the nucleotide sequence of the present invention.Intracellular target gene
MRNA level in-site can by use RT-PCR (reverse transcriptional PCR), RNA trace or other standard method any measure.Optional
Ground, the level of polypeptide of target mRNA coding can use Western blotting, ELISA (enzyme-linked immunosorbent assay) or any other
Immunology or nonimmune method are measured.Import mRNA or the protein expression of target gene coding after siRNA sequence
The material alterations of level imply that the siRNA sequence effectiveness in the expression of suppression target gene.A concrete enforcement
In example, before and after importing siRNA sequence, the expression of other gene is also monitored.Can select target gene is expressed
There is inhibition and the siRNA of the expression of other gene of not appreciable impact.In another specific embodiment, multiple
SiRNA or other RNAi sequence can be imported in identical target cell.These siRNA or RNAi sequence-specifics suppression target
Mark gene expression and do not affect the expression of other gene.In another one specific embodiment, it is possible to use suppression target base
The siRNA of the expression of cause and other gene or other RNAi sequence.
It would be recognized by those skilled in the art that the specificity of the nucleic acid molecules of conjugate incorporated herein selects to rely on
The type of selective reagent in conjugate.Thus, nucleic acid is to expressing the target being expressed in the cell of neurotransmitter transporters
Molecule is specific, and neurotransmitter transporters therein is specific binding with selective reagent.
In one preferred embodiment, nucleic acid is to 5-hydroxytryptamine receptor Class1 A (5-HT1A) it is specific.At core
Acid is antisense, and in the case of siRNA, shRNA or ribozyme, nucleic acid is by working, this with target molecules base pairing
In the case of target molecules be coding 5-hydroxytryptamine receptor Class1 A (5-HT1A) mRNA.If nucleic acid is aptamers, target molecules
It is 5-hydroxytryptamine receptor Class1 A (5-HT1A) polypeptide.
Term " Class1 A 5-hydroxytryptamine receptor " or " 5-HT1AR ", as used herein, refer to main at presynaptic 5-hydroxy tryptamine
The class 5-hydroxytryptamine receptor found in serotonergic neuron.These receptors are activated by extracellular 5-hydroxy tryptamine, cause cell discharge to be lived
Property reduction, and thus reduce in major forebrain areas 5-hydroxy tryptamine release.This negative feedback limits synapse 5-hydroxy tryptamine
Increasing, it can be by the acute induction of antidepressants.Over time, the autoreceptor of body dendron becomes insensitive, it is allowed to
The complete effect of SSRI is expressed at forebrain.This time period has been found to the incubation period of the outbreak corresponding to antidepressant activity
[Jefferson Pérez, V., et al., lancet, 1997, volume 349: 1594-1597 page] [Perez, V., et al., The
Lancet, 1997,349:1594-1597].Thus, it is the intracellular of inactivation at 5-hydroxy tryptamine Class1 A receptor, as blocking 5-
The increase of the extracellular 5-hydroxy tryptamine of the result of hydroxytryptamine transporter will not result in the reduction of cell firing activity, thus prevents
Relevant negative feedback is processed to serotonin reuptake inhibitor.
Can be able to be any Class1 A by the Class1 A 5-hydroxytryptamine receptor of the nucleic acid targeting of the conjugate of the present invention
5-hydroxytryptamine receptor, includes, but not limited to mankind 5-HT1AR, its sequence in SwissProt data base in accession number P08908
Under be given, mice 5-HT1AR, its sequence is given in SwissProt data base under accession number Q64264, rat 5-HT1AR,
Its sequence is given in SwissProt data base under accession number P19327, Canis familiaris L. 5-HT1AR, its sequence is in SwissProt data
Storehouse is given under accession number Q6XXX9.
It would be recognized by those skilled in the art that coding 5-HT1AThe mRNA of R is that the nucleic acid of the specific present invention can be used
Any method mentioned above selects, and tests the ability of the substantial reduction of the level of the corresponding mRNA of its induction.The present invention
Author identified 5-HT1AThe region of the sequence of R mRNA, it can be preferentially targeted by the nucleic acid of the present invention.These regions
Region corresponding to high conservative between different plant species or the non-coding region corresponding to major transcription product, to avoid coding
Region is translated the potential interference of complex.
Therefore, in one preferred embodiment, nucleic acid array complementation is in corresponding to mice 5-HT1ARmRNA is (at NCBI
The sequence of accession number NM_008308 of data base) nucleotide 621-1640 or the region of nucleotide 1880-2400, or other
The 5-HT of species1AThe corresponding region of R cDNA.Described corresponding region can be by contrast to described cDNA and mice 5-HT1AR
CDNA or by multiple ratio to different 5-HT1AWith mice 5-HT in R cDNA discriminating other cDNA described1AIn R cDNA
The region selecting region overlapping determines.
Method to two given nucleotide sequences is to well known to a person skilled in the art in contrast, can pass through BLASTN
[BLAST handbook, Altschul, S., et al., the US National Biotechnology Information center state-run health of state-run medical library is ground
Study carefully institute, Bei Saisida, Malaysia and China Lanzhou 20894 (BLASTManual, Altschul, S., et al., NCBI NLM NIH
Bethesda, Md.20894), Altschul, S., et al., J. Mol. BioL, volume 215: 403-410 page, nineteen ninety
(Altschul, S., et al., J.Mol.Biol.215:403-410 (1990))] canonical algorithm realize, use acquiescence ginseng
Number.The comparison method of multiple nucleotide sequences can use CLUSTALW (Thompson JD et al., nucleic acids research, 1994, the 22nd
Volume: 4673-4680 page (Thompson JD et al, Nucleic Acids Res, 1994,22:4673-4680)) standard
Algorithm realizes, and uses default parameters.Once 5-HT in different plant species1AThe region of R cDNA is authenticated, it is possible to differentiate permissible
The Suitable nucleic acids sequence of the nucleic acid of conjugate incorporated herein.In one preferred embodiment, the conjugate of the present invention
Comprising such nucleotide sequence, it comprises targeting 5-HT1ASelected from SEQ IDNO:1 (mice 5-HT in R mRNA1AThe core of R mRNA
Thuja acid 1841-1910), SEQ ID NO:2 (mice 5-HT1AThe nucleotide 591-700 of R mRNA), SEQ ID NOSEQ ID
NO:3 (mice 5-HT1AThe nucleotide 831-940 of RmRNA), SEQ ID NO:4 (mice 5-HT1AThe nucleotide 2120-of R mRNA
4441) nucleotide sequence in region.
In a preferred embodiment, the nucleic acid of the conjugate of the present invention comprises selected from SEQ IDNO 5, SEQ
ID NO7, SEQ ID NO:9, and SEQ ID NO:11 sequence (seeing table 2) provided that nucleic acid be double-strandednucleic acid (example
As, siRNA), oligonucleotide matches by SEQ IDNO6, SEQ ID NO8, SEQ ID NO:10, and SEQ ID NO:12 provides
Corresponding antisense sequences (seeing table 2).In another embodiment, the nucleic acid of the present invention is for coding 5-hydroxy tryptamine transporter
MRNA (its amplifying nucleic acid by with target base pairing and work) or as this type of 5-hydroxy tryptamine transporter (its amplifying nucleic acid make
For aptamers by directly in conjunction with suppression polypeptide active and work).Term " 5-hydroxy tryptamine transporter " or " SERT ", such as this
Literary composition is used, refers to such polypeptide, and it is a kind of integral membrane protein, and transports neurotransmitter serotonin from synaptic space to synapse
Front neuron.The sequence of the mankind, rat, mice and cattle SERT is provided in SwissProt data base, and accession number is respectively
P31645, P31652, Q60857 and Q9XT49.With targeting 5-HT1AThe nucleic acid of R cDNA is similar to, any district in SERT cDNA
Territory can be targeted, as long as it causes the substantive suppression of level of albumen of mRNA or described mRNA coding of correspondence.Therefore,
Suitably SERT-specific nucleic acid can differentiate according to described above, after having contacted tested nucleic acid by described cell
Measure SERT mRNA or the level of SERT albumen in the cell expressing SERT.
By the way of embodiment, it is possible to use be described in molecule psychiatry, in August, 2005;The 8th phase of volume 10:
782-9, page 714 (Mol.Psychiatry.2005 Aug;10 (8): 782-9,714) and receptor. signal transmits. research magazine
2006;Volume 26: 527-47 page (J.Recept.Signal Transduct.Res.2006;SERT-26:527-47) is special
Opposite sex siRNA.In an embodiment more preferably, SERT-specific siRNA contains sequence
5 ' CUCCUGGAACACUGGCAACdTdT 3 ' (SEQ ID NO:13)
In another one embodiment, SERT-specific siRNA comprises the sequence described in Table X.
Except presynaptic 5-HT1A, it is also possible to by regulation 5-HT1ASome ion channels in behavior downstream and regulate 5-
HT1ABehavior, such as TREK-1 or GIRK.These passages make film hyperpolarization by producing the inflow of a large amount of potassium ions thus regulate
Neuronal activity.The change of these transmembrane potentials, it is suppressed that Neural spike train.It has been proposed that TREK-1 or GirK agonist will improve
Neuronal activity.This by finally upset high level 5-hydroxy tryptamine in the presence of presynaptic 5-HT1AInhibition.
In another embodiment, the nucleic acid of the present invention is for coding 5-HT1AThe ion channel worked in behavior downstream
MRNA (its amplifying nucleic acid is by working with target base pairing) or for 5-HT1AThe ion channel worked in behavior downstream
(its amplifying nucleic acid as aptamers by directly in conjunction with or suppression polypeptide active and work).Those passages are by producing a large amount of potassium
Ion flows into and makes film hyperpolarization thus regulate neuronal activity.Inhibitory neuron is discharged by the change of transmembrane potential.This will be final
Upset the presynaptic 5-HT in the presence of high level 5-hydroxy tryptamine1AInhibition.5-HT in a preferred embodiment1ADownstream
The ion channel worked is TREK-1 or GIRK.
Term " TREK-1 ", as used herein, refer to also referred to as KCNK2, TREK, TPKC1, K2p2.1, TREK1, hTREK-
The polypeptide of 1c, hTREK-1e, MGC126742, MGC126744 and KCNK2, it is diplopore territory type background potassium-channel, by two
Individual homodimer is formed, and it sets up a passage making potassium ion discharge from cell to control resting membrane potential.But, this passage
Can be opened by some anesthetis, film stretching, intracellular acidosis and heat.In the mankind, there are three kinds by TREK base
Because of alternative splicing and the hypotype that causes, provide under following accession number at ncbi database: NP_001017424.1, NP_
001017425.2 and NP_055032.1.Canis familiaris L. (domesticated dog), chimpanzee (chimpanzee), cattle (cattle), rat (Rattus norvegicus) and mice
The TREK-1 xenogenesis isotype of (house mouse) provides in NCBI Protein Data Bank respectively under following accession number: XP_
849278, XP_001171677, NP_777111, NP_742038 and NP_034737.With targeting 5-HT1AThe nucleic acid of R cDNA
Seemingly, any region in TREK-1 cDNA all can be targeted, as long as it causes the albumen of corresponding mRNA or described mRNA coding
Level significantly suppressed.Thus, suitable TREK-1-specific nucleic acid can differentiate according to mentioned above, by described
Cell measures intracellular TREK-1 mRNA or the level of TREK-1 albumen expressing TREK-1 with tested nucleic acid after contacting.
The TREK-1 specific siRNA of the conjugate that may be used for the present invention includes, but not limited to by Santa Cruz biological
The sc-37180 siRNA that technology company (Santa Cruz Biotechnology) provides, and described in the US2009317811
Antisense molecule.
The inward rectifier potassium channels of term G-protein coupling, GIRK or Kir3.x, as used herein, refer to inward rectification
Any member of potassium-channel family, it conducts by originating in the signal of the g protein coupled receptor (GPCR) of ligand activation
Cascade is activated (opening).GPCR is successively from the G-protein β γ of disactivation Heterotrimeric G-Protein complex (G α β γ) release activation
Subunit (G β γ).Final G β γ protein dimerization with GIRK channeling so that its opening thus it becomes permeable to potassium ion,
Cause the hyperpolarization of cell.The inward rectifier potassium channels of G-protein coupling is the ion channel of a kind of G-protein gate, due to
GIRK passage is by G-protein subunit direct activation.
Suitably GIRK includes, but not limited to all members of J subfamily, including member 3 (also referred to as GIRK1 or
Kir3.1) such as mankind GIRK1, corresponding to the nucleic acid differentiated under accession number U39196 of NCBI gene database, or it is referred to as
The brain variant of GIRKd, member 6 (also referred to as GIRK2 or Kir3.2) such as mankind GIRK2, corresponding to NCBI gene database
The nucleic acid differentiated under accession number U24660, member 9 (also referred to as GIRK3 or Kir3.3) such as mankind GIRK3, corresponding to NCBI base
The nucleic acid differentiated under accession number U52152 of factor data bank, member 5 (also referred to as GIRK4 or Kir3.4) such as mankind GIRK4 is right
The nucleic acid that should differentiate under accession number U39195 of NCBI gene database, member 2 (also referred to as IRK1 or Kir2.1) such as people
Class IRK1, corresponding to the nucleic acid differentiated under accession number U24055 of NCBI gene database, and member 4 (also referred to as IRK3 or
Kir2.3) such as mankind IRK3, corresponding to the nucleic acid differentiated under accession number U07364 of NCBI gene database.
Can the suitable nucleic acid of targeting GIRK include, such as, the ribozyme described in WO2005054848, antisense molecule.
Targeting 5-HT1AR mRNA or 5-HT1AR albumen, SERT mRNA or albumen, TREK-1mRNA or albumen or GIRK
Those nucleic acid of mRNA or albumen are preferably coupled to can be in conjunction with the selective reagent of neurotransmitter transporters, described neurotransmitter
Transporter is present in 5-HT1AIn the cell that R, SERT, TREK-1 or GIRK are expressed, i.e. dopaminergic neuron.Thus, this
The conjugate of invention comprises 5-HT1AR-specific nucleic acid, SERT-specific nucleic acid, TREK-1 specific nucleic acid or GIRK-are special
Property nucleic acid, it is coupled to can be in conjunction with the selective reagent of 5-hydroxy tryptamine transporter, and it can be that non-selective 5-hydroxy tryptamine turns
Fortune body (such as SRI or SNRI) or, it is further preferred that selective serotonin reuptake inhibitor (SSRI).
In another embodiment, the nucleic acid of a part of the conjugate of the present invention is formed for synapse nucleoprotein.
Term " synapse nucleoprotein ", as used herein, refer to the polypeptide of synapse nucleoprotein member family, it comprises high conservative
Alpha-helix fat binding motif, similar to the A2 lipoid binding structural domain of commutative apolipoproteins, and can be formed referred to as
The intracellular aggregates of Louis body, it occurs in some sacred disease, such as parkinson disease, Alzheimer and Louis body
Sick.Term " synapse nucleoprotein " refers to alpha-synapse nucleoprotein, β-synapse nucleoprotein or γ-synapse nucleoprotein.A preferred reality
Executing in mode, the nucleic acid of the part forming the conjugate of the present invention is special to alpha-synapse nucleoprotein.
The sequence of the mankind, rat, mice and cattle alpha-synapse nucleoprotein is respectively by the following accession number of SwissProt data base
There is provided: P37840, P37377, O55042 and Q3T0G8.With targeting 5-HT1AThe nucleic acid of RcDNA is similar to, and alpha-synapse nucleoprotein is special
Property nucleic acid can differentiate by any method described above or select, and test its induction corresponding mRNA or described mRNA coding
The ability significantly suppressed of level of albumen.Thus, suitable alpha-synapse nucleoprotein specific nucleic acid can be as described above
Differentiate, measure alpha-synapse nucleoprotein mRNA or alpha-synapse nucleoprotein after being contacted with tested nucleic acid by described cell and expressing
The intracellular level of alpha-synapse nucleoprotein.
In one preferred embodiment, alpha-synapse nucleoprotein specific nucleic acid for mankind's alpha-synapse nucleoprotein-
The region of cDNA.In another embodiment, the nucleic acid of the present invention is for coding 5-HT1AThe ion worked in behavior downstream leads to
The mRNA (its amplifying nucleic acid is by working with target base pairing) in road or for 5-HT1AThe ion worked in behavior downstream leads to
Road (its amplifying nucleic acid as aptamers by directly in conjunction with or suppression polypeptide active and work).Those passages are a large amount of by producing
Potassium ion flows into and makes film hyperpolarization thus regulate neuronal activity.Inhibitory neuron is discharged by this change of transmembrane potential.This
By finally upset high level 5-hydroxy tryptamine in the presence of presynaptic 5-HT1AInhibition.5-in a preferred embodiment
HT1AThe ion channel worked in downstream is TREK-1.
Suitable targets region in alpha-synapse nucleoprotein-mRNA includes, but not limited to those described in WO07135426
(such as nucleic acid), and specifically siRNA, comprise the sequence of group selected from the siRNA described in the WO2006039253, such as
5 '-GGAAAGACAAAAGAGGUGdTdT-3 ' SEQ ID NO:16
5 '-GGAAAGACAAAAGAGGUGdTdT-3 ' SEQ ID NO:17
5 '-GGAGGAAUUUUAGAAGAGGdTdT-3 ' SEQ ID NO:18
5 '-UGUUGGAGGAGCAGUGGUGdTdT-3 ' SEQ ID NO:19
5 '-GGACCAGUUGGGCAAGAAUdTdT-3 ' SEQ ID NO:20
Or hairpin oligonucleotide, has sequence
5’-GATCCCCGGACCAGTTGGGCAAGAATTTCAAGAGAATTCTTGCCAACTGGTCCTTTTTGGAAA-3’
With
5’-CTAGTTTCCAAAAAGGACCAGTTGGGCAAGAATTCTCTTGAAATTCTTGCCCAACTGGTCCGGG-
3’
Correspond respectively to SEQ ID NO:21 and 22.
Other synapse nucleoprotein specific siRNA sequence is those (embodiments XVII being described in US2008139799
Described in sequence, its content is included from there through quoting) and WO2009079399 described in siRNA sequence, choosing
Group from following:
5 '-GGUGUGGCAACAGUGGCUGAG-3 ' SEQ ID NO:23
5 '-AACAGUGGCUGAGAAGACCAA-3 ' SEQ ID NO:24
5 '-AUUGCAGCAGCCACUGGCUUU-3 ' SEQ ID NO:25
5 '-AAGUGACAAAUGUUGGAGGAG-3 ' SEQ ID NO:26
5 '-GAAGAAGGAGCCCCACAGGAA-3 ' SEQ ID NO:27
5 '-CGGGUGUGACAGCAGUAGCdTdT-3 ' SEQ ID NO:28
5 '-UCCUGACAAUGAGGCUUAUdTdT-3 ' SEQ ID NO:29
5′-U*CCUGACAAUGAGGCUUAUdT*dT-3 ' SEQ ID NO:30
5 '-CUACGAACCUGAAGCCUAAdTdT-3 ' SEQ ID NO:31
5′-C*UACGAACCUGAAGCCUAAdT*dT-3 ' SEQ ID NO:32
5 '-C*UACGAACCUGAAGCCUAAdT*dT-3 ' SEQ ID NO:33
5 '-CUAUUGUAGAGUGGUCUAUdTdT-3 ' SEQ ID NO:34
5′-C*UAUGAGCCUGAAGC*UAAT*T-3 ' SEQ ID NO:35
5′-C*UAUGAGCCUGAAGCCUAAT*T-3 ' SEQ ID NO:36
Wherein * represents phosphorothioate bond, and the nucleotide of underscore represents 2 '-O-Me and modifies.
They are preferably coupled to can be in conjunction with the choosing of neurotransmitter transporters present in the cell of expression synapse nucleoprotein
Selecting property reagent.Thus, the conjugate of the present invention comprises synapse nucleoprotein specific nucleic acid, and it is coupled to mediate internalization and enters
The selective reagent of monoaminergic nerve unit.Thus, the nucleic acid of targeting synapse nucleoprotein mRNA or albumen is coupled to promote institute
State nucleic acid internalization and enter 5-hydroxy tryptamine energy, norepinephrine energy and/or the reagent of dopaminergic neuron.Therefore, at one
In preferred embodiment, synapse nucleoprotein specific nucleic acid is coupled to 5-hydroxy tryptamine energy, norepinephrine energy and DOPA
The selective reagent of aminergic neuron, it is selected from dopamine reuptake inhibitor (DRI), and norepinephrine-dopamine is taken the photograph again
Take the group of inhibitor (NDRI) (SNDRI or three times-blocker).
In another embodiment, the nucleic acid of part of the conjugate of the present invention is formed for nitric oxide synthetase
(NOS)。
As used herein, " nitric oxide synthetase " or " NOS " meaning is natural the depositing of internal catalysis nitric oxide synthesis
Enzyme.Nitric oxide (NO) by the guanidino group of L-arginine by the enzyme family of referred to as nitric oxide synthetase (NOS)
Synthesis.This term application is in all hypotypes of nitric oxide synthetase (NOS) found in biosystem and includes, but does not limits
In, the constitutive character form of NOS, NOS3 (eNOS), neuronal nitric oxide synzyme (nNOS) and can luring
Lead nitric oxide synthetase (iNOS).
The sequence of the iNOS of the mankind, rat, mice, Canis familiaris L. and cattle is respectively provided for the accession number of SwissProt data base
Under P35228, Q06518, P29477, O62699 and Q27995.The sequence of the eNOS of the mankind, rat, mice and cattle provides respectively
Under accession number P29474 of SwissProt data base, Q62600, P70313 and P29473.The mankind, rat, mice and cattle
The sequence of nNOS is respectively provided under accession number P29475 of SwissProt data base, P29476, Q9Z0J4 and P29473.
Any region in NOS cDNA all can be targeted, as long as it causes the albumen of corresponding mRNA or described mRNA coding
Level significantly suppressed.Thus, suitable NOS-specific nucleic acid can differentiate as mentioned before, by described cell
Measure intracellular NOS mRNA or the level of albumen of NOS expression after contacting tested nucleic acid, or be determined by the thin of process
The NOS activity of intracellular.NOS activity can be measured by any method known in the art, to determine iNOS, eNOS and nNOS
Activity, depends on the circumstances.Such as, NOS activity can by radiometry method measure [3H]-arginine to [3H]-L-melon ammonia
The conversion of acid and determine, or utilize in lattice this (Griess) to analyze in nitric oxide is formed.
Suitable NOS-specificity silencing agent includes, but not limited to the nNOS-specificity described in WO08100591
SiRNA, by following polynucleotide to obtaining:
-CAAAGAGATCGACACCATC (SEQ ID NO:58) (just),
GATGGTGTCGATCTCTTTGTT (SEQ ID NO:59) (antisense);
-CACGCATGTCTGGAAAGGC (SEQ ID NO:60) (just) and
GCCTTTCCAGACATGCGTGTT (SEQ ID NO:61) (antisense);
-GGTCTATCCAATGTCCACA (SEQ ID NO:62) (just) and
TGTGGACATTGGATAGACCTT (SEQ ID NO:63) (antisense)
-there is the iNOS-specific siRNA of following sequence: 5 '-
CCACCAGTATGCAATGAAT-3 ' (SEQ ID NO:64)
-the eNOS-that can obtain from hero company (Invitrogen) (Carlsbad, California) (Carlsbad, CA)
Specific siRNA, has oligomer discriminating HSS 107326, HSS 107327 and HSS 107328
INOS-described in the table 2 of-virtue et al. (Fang et al.) (RNA, 2010, volume 16: 1429-1435 page)
Specific siRNA
-there is the iNOS-specific siRNA of following sequence: 5 '-
ACAACAGGAACCUACCAGCTT-3 ' (SEQ ID NO:65) (just) and 5 '-
GCUGGUAGGUUCCUGUUGUTT-3 ' (SEQ ID NO:66) (antisense).
Exemplary and the non-limiting NOS specific antisense thing being suitable for the present invention includes:
-there are the iNOS-specific antisense oligo of following sequence: 5 '-ACAGCTCAGTCCCTTCACCAA-3 '
(SEQ ID NO:67), be described in Richard Grasso et al. (Grasso et al.) (experimental biology and medical science, 2003, the 228th
Volume: 491-8 page).(Exp.Biol.Med., 2003,228:491-8)
-there is the iNOS-specific antisense oligo of following sequence: 5 '-TTTGCCTTATACTGTTCC-3 ' (SEQ
ID NO:68) be described in black nurse uncommon et al. (Hemmrich et al.) (American Physiological Association's magazine, cytophysiology, 2003
Year, volume 285: C489-C498) (Am.J.Physiol.Cell Physiol., 2003,285:C489-C498).
The iNOS-specific antisense oligo that in-WO0152902, Tables 1 and 2 describes.
INOS-described in the table 1 of-virtue et al. (Fang et al.) (RNA, 2010, volume 16: 1429-1435 page)
Specific antisense molecule.
NOS specificity silencing agent is preferably coupled to can neurotransmitter transhipment present in the cell in conjunction with NOS expression
The selective reagent of body.Thus, the conjugate of the present invention comprises NOS specific nucleic acid, and it is coupled to mediate internalization and enters
The selective reagent of monoaminergic nerve unit.Thus, the nucleic acid of targeting synapse nucleoprotein mRNA or albumen is coupled to promote institute
State nucleic acid internalization and enter 5-hydroxy tryptamine energy, norepinephrine energy and/or the reagent of dopaminergic neuron.Therefore, at one
In preferred embodiment, synapse nucleoprotein specific nucleic acid is coupled to 5-hydroxy tryptamine energy, norepinephrine energy and DOPA
The selective reagent of aminergic neuron, it is selected from dopamine reuptake inhibitor (DRI), and norepinephrine-dopamine is taken the photograph again
Take the group of inhibitor (NDRI) (SNDRI or three times-blocker).
In another embodiment, the nucleic acid of part of the conjugate of the present invention is formed for noradrenaline transporter
Body.
Term " norepinephrine transporter ", " NAT ", " noradrenaline transporter " or " NET " are used in this article
Regardless of referring to monoamine transporter distinctively, neurotransmitter norepinephrine (noradrenaline) and dopamine are transported by it from synapse
Return in vesicle to store until using.NET is 617 amino acid longs, comprises 12 membrane spaning domains, by SLC6A2 base
Because of coding.
The mankind, Canis familiaris L. (Canis familiaris), chimpanzee, (Pan troglodytes), and cattle (Bostaurus), rat
The sequence of the norepinephrine transporter of (Rattus norvegicus) and mice (Mus musculus) is respectively at NCBI number
According to accession number P23975 in storehouse, XM_544398.2, XM_001167680.1, NM_174608.2, NM_031343.1 and NM_
There is provided for 009209.2 time.Any region in NET cDNA all can be targeted, as long as it causes corresponding mRNA or described mRNA
The significantly suppression of the level of the protein of coding.Thus, suitable NET-specific nucleic acid can differentiate as mentioned before, logical
Cross after the tested nucleic acid of described cells contacting, measure intracellular NET mRNA or the level of albumen expressing NET.
Suitable NET-specific nucleic acid includes, but not limited to any SLC6A2-specific RNA i such as can be from hero
Accession number HSS109852 that company (Invitrogen) obtains, the RNAi under HSS109853 and HSS185858.
In another embodiment, the nucleic acid of part of the conjugate of the present invention is formed for dopamine-β-hydroxylation
Enzyme.
Term " dopamine-β-hydroxylation enzyme ", as used herein, referring to Dopamine Turnover is norepinephrine
Polypeptide.
The sequence of the dopamine of the mankind, rat, mice and cattle-β-hydroxylation enzyme stepping at NCBI Protein Data Bank respectively
There is provided under record NP_000778, NP_037290, NP_620392 and NP_851338.With other nucleic acid of the targeting according to the present invention
Nucleic acid be similar to, any region in dopamine-β-hydroxylation enzyme cDNA all can be targeted, as long as its cause corresponding mRNA or
The significantly suppression of the level of the protein of described mRNA coding.Thus, suitable dopamine-β-hydroxylation enzyme-specific nucleic acid
Can differentiate as mentioned before, express dopamine-β-hydroxylation enzyme by measuring after the tested nucleic acid of described cells contacting
Intracellular dopamine-β-hydroxylation enzyme mRNA or the level of albumen.
Suitably dopamine-β-hydroxylation enzyme-specific nucleic acid includes, but not limited to described in WO2008019159
There is the nucleic acid of following sequence:
5 '-GACCACGUACUGGUGCUACAUTA-3 ' (SEQ ID NO:37)
And commercially available dopamine-β-hydroxylation enzyme-specific nucleic acid, such as can be biological from Santa Cruz
Technology company (Santa Cruz Biotechnology) (catalogue #sc-35180), from hero company (Invitrogen)
(catalogue #HSS175953, HSS175954 and HSS175955), from Ya Nuofa company (Abnova) (catalogue #
H00001621-R01), Applied biosystems (Applied Biosystems) (siRNA ids s3946, s3947
And s3945) dopamine-β-hydroxylation enzyme spcificity siRNA of obtaining.
The nucleic acid of those targeting dopamine-β-hydroxylation enzyme mRNA or albumen is preferably coupled to can be in conjunction with such cell
Present in neurotransmitter transporters, wherein said cell is expressed in dopamine-β-hydroxylation enzyme and wherein said cell
Need the shortage reducing the neurotransmitter causing case-specific situation with compensation of dopamine-β-hydroxylation enzyme.Thus, the present invention
Conjugate comprise dopamine-β-hydroxylation enzyme spcificity nucleic acid, it is coupled to suppress in conjunction with norepinephrine reuptake
The selective reagent of agent (NRI).
In another embodiment, the nucleic acid specificity of the part of the conjugate of the composition present invention is for BAX.Term
" BAX " or " BCL2 be correlated with X protein " is as used herein, refers to promote apoptosis BCL-2 family member, its activation relate to subcellular fraction transfer and
Dimerization.In living cells, the be correlated with major part of X protein of BCL-2 is single aggressiveness and finds in Cell sap or relax with film
Connect.Under death stimulates, the poly-BCL2-of Cell sap list X protein of being correlated with is transferred to mitochondrion, and in this, it becomes crosslinkable film
Integral protein.BCL-2 is correlated with, and to form the ability of the conductance fenestra of ion of uniqueness may be partly to cause cell death to X protein
The reason of mitochondria dysfunction (Coase prunus mume (sieb.) sieb.et zucc. is refined et al., Cold SpringHarbor quantitative biology, 1999, volume 64,343-350 page;
Coase prunus mume (sieb.) sieb.et zucc. is refined et al., cell death and variation, 2000, volume 7,1166-1173 page) (Korsmeyer et al., Cold
Spring Harb.Symp.Quant.Biol., 1999,64,343-350;Korsmeyer et al., Cell Death
Differ., 2000,7,1166-1173).Term " BAX " refers to its any shearing variant, including BAX-α (GenBank accession number
L22473), BAX-β (GenBank accession number NM004324)), BAX-γ (oere Te Woyi et al., cell, 1993, the 74th
Volume, 609-619 page) (Oltvai et al., Cell, 1993,74,609-619), BAX-δ (GenBank accession number
AI382305) (A Pute et al., genomics, nineteen ninety-five, volume 26,592-594) page (Apte et al., Genomics,
1995,26,592-594), BAX-ω (GenBank accession number AF008196) (week et al., journal of biological chemistry, 1998 years, the
Volume 273,11930-11936 page) (Zhou et al., J.Biol.Chem., 1998,273,11930-11936) and BAX-ε
(GenBank accession number AF007826) (suitable et al., biochemistry and biophysical research communication, 1999, volume 254,779-
Page 785) (Shiet al., Biochem.Biophys.Res.Commun., 1999,254,779-785).Coding BAX-α, BAX-
The nucleotides sequence of β and BAX-γ is listed in disclosed in U.S. Patent number 5,691,179 and 5,955,595 and prescription.Coding
The nucleotides sequence of BAX-ω is listed in disclosed in U.S. Patent number 6,140,484 and corresponding PCT Publication WO 97/01635 and requirement
Right.U.S. Patent number 6,140,484 also disclosing that, 22 of exon 5/ intron 5 junction for mankind BAX-ω is gathered
Body antisense oligonucleotide.
Suitable BAX-specific nucleic acid for the conjugate according to the present invention includes:
-sequence 5 '-UCGAUCCUGGAUGAAACCCtg-3 ' (SEQ ID NO:38) (described in CN101255422),
83-102 and the 103-122 bit base of-targeting mankind BAX (Manfredi Buddhist nun et al., open by antisense nucleic acid medicament
Send out, 1998, volume 8, (Manfredini etal., Antisense Nucleic Acid Drug described in 341-350 page
Dev., 1998,8,341-350)) and neutrophil (Di Bo top grade people, PNAS, 1999, volume 96,
13330-13335 page (Dibbert et al., Proc.Natl.Acad.Sci.U.S.A., 1999,96,13330-13335))
Antisense oligonucleotide.
Arbitrary sequence disclosed in-US20040077583 (table 1 and 3), its content is incorporated herein by.
The nucleic acid of targeting BAX mRNA or albumen is preferably coupled to pass in conjunction with nerve present in the cell of expression BAX
The selective reagent of matter transporter.Thus, the conjugate of the present invention comprises BAX specific nucleic acid, in it is coupled to mediate
Change and enter 5-hydroxy tryptamine energy, norepinephrine energy and the selective reagent of dopaminergic neuron.Therefore, at one preferably
In embodiment, selective reagent presses down selected from dopamine reuptake inhibitor (DRI) or norepinephrine-dopamine reuptake
Preparation (NDRI) or 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor (SNDRI or three times-blocker).
In another embodiment, nucleic acid targeting microtubule-associated protein taumRNA of the conjugate of the present invention or albumen.
Term " tau " refers to any albumen of Protein tau family, includes but not limited to, any source includes the mankind (P10636), Canis familiaris L. (XM_
844939), chimpanzee (NM_001009068.1), mice (Z12133), Brachydanio rerio (BI981282.1) and nematicide (NM_
001027407.2) natural Protein tau monomer, precursor Protein tau, tau peptide, tau intermediate, metabolite and tau are derivative
Thing, it can be stood and cause conjugate spirals fiber filaments and the super phosphorylation of fibers straight filament self assembly confusion, relate to A Erci
The silent disease in sea and the pathological pathogeny of other tau.
Suitably tau-specific nucleic acid includes, but are not limited to:
The siRNA with following sequence described in-WO2005118858:
5 '-AATCACACCCAACGTGCAGAA-3 ' (SEQ ID NO:39)
With
5 '-AACTGGCAGTTCTGGAGCAAA-3 ' (SEQ ID NO:40)
The siRNA with following sequence described in-US2004241854:
-Caceres et al., neurobiology magazine, 1991, volume 11: 1515-1523 page (Caceres et
Al.J.Neuroscience, 1991,11:1515-1523) the tau-specific antisense nucleic acids with following sequence described in:
GGTTCAGCCATGCTGCTTCAAAGCC SEQ ID NO:53
With
TGATAATCGACAGGAGGCGAGGACA SEQ ID NO:54
The nucleic acid of targeting tau mRNA or albumen is preferably coupled to pass in conjunction with nerve present in the cell of expression Tau
The selective reagent of matter transporter.Thus, the conjugate of the present invention comprises Tau-specific nucleic acid, in it is coupled to mediate
Change the selectivity examination entering monoaminergic nerve unit especially 5-hydroxy tryptamine energy, norepinephrine energy and dopaminergic neuron
Agent.Therefore, in one preferred embodiment, selective reagent is selected from dopamine reuptake inhibitor (DRI) or nor-kidney
Upper parathyrine-dopamine reuptake inhibitor (NDRI) or 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor
(SNDRI or three times-blocker).
In another embodiment, the nucleic acid targeting Huntingdon mRNA of the conjugate of the present invention or protein.Term is " prosperous
Pause albumen in the court of a feudal ruler " refer to the albumen of the 350kDa of the unknown function of UniPortKB database login P42858, and leave login in
The albumen of the nucleic acid sequence encoding under number L12392, and in Canis familiaris L. (NCBI accession number XP_536221.2), (NCBI logs in chimpanzee
Number XP_517080.2), cattle (NCBI accession number XP_871851.2), rat (NCBI accession number XP_573634.1) or mice
Its ortholog thing found in (NCBI accession number NP_034544.11), and its variant that the extension of CAG repetition causes is (wild
CAG6-37 in raw type albumen repeats to the CAG35-121 in mutain).CAG extension has resulted at Huntington protein
In the mutain of extension containing many glutamic acid bundle.
During suitably Huntingdon-specific nucleic acid includes, but not limited to the table 4 of US2008039418A and table 5 and
Antisense oligonucleotide described in the table 1,2,7,8,9 and 10 of US7320965, having described in US2005042646A is as follows
The siRNA of sequence:
5 '-AAGAGGAGGAGGCCGACGCCC-3 ' (SEQ ID NO:55)
The nucleic acid of targeting Huntingdon mRNA or albumen is preferably coupled to deposit in conjunction with in the cell of expression Huntington protein
The selective reagent of neurotransmitter transporters.Thus, the conjugate of the present invention comprises Huntingdon-specific nucleic acid, and it is even
It is coupled to mediate internalization and enters monoaminergic nerve unit especially 5-hydroxy tryptamine energy, norepinephrine energy and dopaminergic nerve
The selective reagent of unit.Therefore, in one preferred embodiment, selective reagent is selected from dopamine reuptake inhibitor
(DRI) or norepinephrine-dopamine reuptake inhibitor (NDRI) or 5-hydroxy tryptamine-norepinephrine-dopamine again
The group of uptake inhibitor (SNDRI or three times-blocker).
Selective reagent and the suitably combination of nucleic acid according to the present invention are summed up in Table 1.
A.3.The joint area of the conjugate of the present invention
Nucleic acid and selective reagent can be direct couplings.However, preferably two parts are all connected by linking group.
The equal expression of term used herein " linking group " and " joint " and grammatical thereof refers to connect compound
The organic moiety of 2 parts.Arbitrarily justice or the antisense nucleotide that selective reagent can be connected in nucleic acid, but
It can preferably pass through 3 ' terminal nucleotides and/or 5 ' terminal nucleotide couplings.Internal conjugate may be directly or through joint
Be coupled indirectly to nucleotide on 2 ' positions of ribose groups, or the correct position to other.
In the case of nucleic acid is double-strandednucleic acid, conjugate can be connected to justice 3 ' terminal nucleotides, justice 5 ' end nucleoside
Acid, antisense 3 ' terminal nucleotide, and/or antisense 5 ' terminal nucleotide.
Although being not intended to by defining or arranging to be limited, in this application, the length of joint is by calculating atomic number
Being described, described atomic number is to represent to connect conjugation moiety to the atom of joint and the terminal phosphate relevant to oligonucleotide
The atomic number of the beeline between the oxygen atom of part, its center tap is connected to oligonucleotide by oxygen atom.At joint bag
In the case of one or more ring structures, preferably counting represents the atom around ring of shortest path.
For the present invention be suitable for linking group include, but not limited to modify or the ucleotides of unmodified, core
Glycoside, polymer, sugar, carbohydrate, polyolefin such as polyethylene glycols and polypropylene glycols, polyhydric alcohol, polypropylene type, second
Alkene and the mixture of propylene glycols, poly-alkyl amine, the most lysins of polyamine class and spermidine, the most poly-(acrylic acid of polyesters
Ethyl ester), polyphosphoric acid two esters, aliphatic compound and alkene.Additionally, based on Ω-amino-1,3-glycol, Ω-amino-1,2-
Glycol, hydroxyl dried meat ammonia alcohol, Ω-amino-alkanol, diethanolamine, Ω-hydroxyl-1,3-glycol, Ω-hydroxyl-1,2-glycol, Ω-sulfur
Generation-1,3-glycol, Ω-sulfur generation-1,2-glycol, Ω-carboxyl-1,3-glycol, Ω-carboxyl-1,2-glycol, co-hydroxyl-alkanol
(co-hydroxy-alkanols), Ω-sulfur generation-alkanol, Ω-carboxyl-alkanol, functionalization widow ethylene glycol (functionalized
Oligoethylene glycols), allylamine, acrylic acid, 1-propenol-3, propargylamine, the connecing of propilolic alcohol and more chemical constitution
Head/joint (linkers/linker) can apply to herein to produce the joint of suitable length.
Joint is also possible to make oligonucleotide conjugates have other desired character and improves water solublity, conjugation moiety and few core
Optimal spacing between thuja acid, elasticity (or lacking it), specificity orientation, branch, and other.
Preferably, described linking group has following structure
Wherein
M, n and p are selected from 0,1,2,3,4,5,6,7,8,9,10,11,12 and 13,
Wherein the summation of m+n+p is selected from the integer of 7,8,9,10,11,12,13,14,15,16,17 and 18, and
Wherein k is 0 or 1.
In one preferred embodiment, p is 5, and n is 2, and k is 1 and m to be 6, obtains the joint of following structure:
Another preferred embodiment in, p is 5, n and k is 0 and m to be 6, obtains the joint of following structure:
In a specific embodiment, joint comprises the coupling of more than one selective reagent.At one preferably
In embodiment, joint is the joint of bivalence or trivalent, i.e. the selective reagent of 2 or 3 molecules can coupling respectively.
In the case of the selective reagent of more than one molecule is coupled on nucleic acid by joint, described molecule energy can
Represent same or different selective reagent.
In a specific embodiment, the joint of bivalence or trivalent has a following structural formula:
Wherein
M, m ', m ", n, n ', n ", p, p ', p ", r, r ', r ", s, s ', s ", t and u independently selected from 0,1,2,3,4,5,6,
7,8,9,10,11,12 and 13;
K, k ', k " and v independently selected from 0 and 1;And
X1、X2And X3Independently selected from CH2, O, S, NH, CO, C (O) O and C (O) NH.
According to the price of above-mentioned group, branch joint can be symmetrical or asymmetric.
In a specific embodiment, joint is bivalent linker as implied above, and wherein p and p ' is 5, n and n ' is
2, k and k ' is 1 and m and m ' to be 6.In a specific embodiment, joint is bivalent linker, and wherein p and p ' is 5, n,
N ', k and k ' are 0 and m and m ' to be 6.
In a specific embodiment, joint is bivalent linker as implied above, and wherein r and r ' is 4, s and s ' is
1, t and v is 0 and X1And X2Represent C (O) NH.In another embodiment, joint is bivalent linker, and wherein r is 2, r ' be
0, s is 1, s ' it is 0, t and v is 0 and X1And X2Represent CH2。
In a specific embodiment, joint is bivalent linker, and wherein p and p ' is 5, n and n ' is 2, k and k ' is 1,
M and m ' is 6, r and r ' is 4, s and s ' is 1, t and v is 0 and X1And X2Represent C (O) NH.
In another embodiment, joint is bivalent linker, and wherein p and p ' is 5, n and n ' is 2, k and k ' is 1, m and
M ' is 6, and r is 2, r ' it is 0, s is 1, s ' and it is 0, t and v is 0 and X1And X2Represent CH2。
In another embodiment, joint is bivalent linker, and wherein p and p ' is 5, n, n ', k and k ' be 0 and m and m '
Being 6, r and r ' is 4, s and s ' is 1, t and v is 0 and X1And X2Represent C (O) NH.
In another embodiment, joint is bivalent linker, and wherein p and p ' is 5, n, n ', k and k ' be 0 and m and m '
Being 6, r is 2, r ' it is 0, s is 1, s ' and it is 0, t and v is 0 and X1And X2Represent CH2。
In a specific embodiment, joint is trivalent joint as implied above, wherein p, p ' and p " it is 5, n, n '
And n " be 2, k, k ' and k " be 1 and m, m ' and m " be 6.In a specific embodiment, joint is trivalent joint, wherein
P, p ' and p " it is 5, n, n ', n ", k, k ' and k " it is 0 and m, m ' and m " it is 6.
In a specific embodiment, joint is trivalent joint as implied above, wherein r, r ' and r " it is 3, s, s '
And s " it is 1, t is 1, and v is 0 and X1、X2And X3Represent O.In another embodiment, joint is trivalent joint, wherein r, r '
And r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1 and X1、X2And X3Represent O.
In a specific embodiment, joint is trivalent joint, wherein p, p ' and p " it is 5, n, n ' and n " it is 2, k,
K ' and k " it is 1, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and v is 0 and X1、X2And X3Represent O.
In another embodiment, joint is trivalent joint, wherein p, p ' and p " it is 5, n, n ' and n " it is 2, k, k ' and
K " it is 1, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1 and X1、X2And X3Represent O.
In another embodiment, joint is trivalent joint, wherein p, p ' and p " it is 5, n, n ', n ", k, k ' and k " be
0, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and v is 0 and X1、X2And X3Represent O.
In another embodiment, joint is trivalent joint, wherein p, p ' and p " it is 5, n, n ', n ", k, k ' and k " be
0, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1 and X1、X2And X3Represent O.
A.4.The targeting moiety (moiety) of conjugate of the present invention
Another modification of conjugate of the present invention relates to being coupled chemically to nucleic acid or to the one or more portion of blocking group
Dividing or conjugate, it strengthens activity of nucleic acid, cell distribution or cellular uptake.Such part includes but not limited to lipid part
Such as cholesterol moiety (Letsinger et al, Proc.Natl.Acid.Sci.USA, 199,86,6553-6556), cholic acid
(Manoharan et al, Biorg.Med.Chem.Let., 1,994 4 1053-1060), thioether, such as, beryl-S-triphen
Methyl mercaptan (Manoharan et al, Ann.N.Y.Acad.Sci., 1992,660,306-309;Manoharan et al,
Biorg.Med.Chem.Let., 1993,3,2765-2770), sulfydryl cholesterol (Oberhauser et al, Nucl.Acids
Res., 1992,20,533-538), aliphatic chain such as dodecanediol or undecyl residues (Saison-Behmoaras et
Al, EMBO J, 1991,10,1111-1118;Kabanov et al, FEBS Lett., 1990,259,327-330;
Svinarchuk et a/., Biochimie, 1993,75,49-54), phospholipid such as two-hexadecyl-rac-glycerol or
Triethyl group-amine 1,2-bis--O-hexadecyl-rac-glycerol-3-hydrogen phosphonate ester (Manoharan et al, Tetrahedron
Lett., 1995,36,3651-3654;Shea et al, Nucl.Acids Res., 1990,18,3777-3783), polyamine or
Polyglycol chain (Manoharan et al., Nucleosides and Nucleotides, 1995,14,969-973), or
Adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995,36,3651-3654), palmityl part
(Mishra et ai, Biochim.Biophys.Acta, 1995,1264,229-237), or 18-amine. or hexylamino-carbonyl
Base oxycholesterol part (Crooke et al., J.Pharmacol.Exp.Ther., 1996,277,923-937).
Alternatively, it is possible to the part strengthening cell distribution is probably low molecular weight compound or polypeptide, and it can pass through
The unitransport body being present in described biological containment is used to apply receptor-mediated endocytosis specifically to pass
Biological containment shifts.A series of receptors absorbed widely and carrier, have the most greater number of receptor-specificity
Part, is known in the art.For according to the mediation endocytosis used by the present invention and/or receptor preferred of transcytosis
Part includes, such as part for or its be specifically bound to thiamine transporter, folate receptor, vitamin B12 are subject to
Body, asialoglycoprotein receptor, α (2,3)-asialoglycoprotein receptor (contain, such as, by yamma single domain antibodies
(sdAbs) FC5 and the FC44 nano antibody (nanobodies) formed is as receptor-ligands specific), transferrins-1 and-2
Receptor, scavenger receptor (type A or B, I, II or type III, or CD36 or CD163), low density lipoprotein, LDL (LDL) receptor,
LDL-associated protein 1 receptor (LRP1, Type B), LRP2 receptor (the hugest albumen or glycoprotein 330), diptheria toxin receptor
(DTR, it is that the film of heparin binding epidermal growth factor like growth factor (HB-EGF) combines precursor), Insulin receptor INSR, islets of langerhans
Element like growth factor (IGF) receptor, leptin receptor, Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2 receptor, glutathion receptor, glutamate receptor and mannose 6-phosphorus
Hydrochlorate receptor.
Meeting what the present invention used, the preferred part being combined with these receptors includes, such as part is selected from: lipoproteinesterase
(LPL), alpha2-macroglobulin (α 2M), receptor associated protein(RAP) (RAP), lactoferrin, desmoteplase, tissue and urokinase type fiber
Pepsinogen activator (tPA/uPA), plasminogen activator inhibitor (PAI-I), tPA/uPA:PAI-1 are compound
Thing, protein melanotransferrin (or P97), thrombospondin 1 and 2, hepatic lipase, factor VIIa/tissue factor approach restrainer
(TFPI), the VIIIA factor, the IXa factor, Abetal-40, amyloid-beta precursor (APP), C1 inhibitor, Complement C_3, load fat
Albumen E (apoE), Pseudomonas exotoxin A, CRM66, HIV-I Tat albumen, rhinovirus, GELB (MMP-
9), MMP-13 (collagenase-3), Saposin (SAP), pregnoglobulin, Antithrombin III, heparin co factor II,
Alpha antitrypsin, heat shock protein 96 (HSP-96), platelet derived growth factor (PDGF), SP-40 (apoJ or
TRPM-2), ABETA to apoJ and apoE, aprotinin, angiopeptin (angio-pepl), very low density lipoprotein (VLDL) (VLDL),
Transferrins, insulin, leptin, insulin like growth factor, epidermal growth factor, agglutinin, peptide mimetic and/or humanization
Monoclonal antibody or specific effect in described receptor peptide (such as, be bound to human TfR sequence HAIYPRH and
THRPPMWSPVWP, or monoclonal antibody A24 of anti-human transferrin receptor (TfR)), hemoglobin, diphtheria toxin, diphtherotoxin polypeptide chain
Non-toxic component, diphtheria toxin, diphtherotoxin B chain all or part of (include DTB-His (such as Spilsberg et al., 2005,
Toxicon., described by 46 (8): 900-6)), the non-toxic mutant of diphtheria toxin, diphtherotoxin CRM197 all or part of, carry fat
Protein B, apo E (after such as, being bound to tween 80 coating nanoparticle), vitamin D binding protein, vitamin A/
Retinol-binding protein, vitamin B12/cobalamine plasma carrier albumen, glutathion and cobalamin transfering protein-B12.
A.5.Blocking group
Form the nucleic acid of a part of conjugate of the present invention at them through organic different liquids and the transhipment of component
Period, they must be protected from degradation factor degraded, (inside/outside cuts nucleic acid to described degradation factor such as nuclease
Enzyme).For this purpose, oligonucleotide is designed to resist enzymic digestion, and improves internal stability and the biology of oligonucleotide
Availability.Preferably, nucleic acid is by by stoping the chemistry carried out in the presence of the group of nuclease-mediated degraded to be repaiied
Decorations.
For the purposes of the present invention, " cap " or " blocking group " is understood to refer to chemical modification, and it closes
And to the either end of oligonucleotide.The non-limitative example of 5 '-cap includes inverting basic moiety (inverted abasic
Residue) (part), the acid of 4 ', 5 '-methylene nucleoside;1-(β-D-furan erythrose) nucleotide, 4 '-thio nucleotides, carbocyclic ring
Nucleotide;1,5-dewatering hexitol nucleotide;L-nucleotide;α-nucleotide;Modified base nucleotide;Phosphorodithioate is even
Connect;The acid of Soviet Union-pentofuranonucleoside;The acid of acyclic 3 ', 4 '-open nucleoside;Acyclic 3,4-dihydroxy butyl nucleotide;Acyclic 3,5-bis-
Hydroxy pentyl nucleotide, 3 '-3 '-reversion nucleotide segment;3 '-3 '-reversion basic moiety (inverted abasic
moiety);3 '-2 '-reversion nucleotide segment;3 '-2 '-reversion basic moiety;BDO phosphate ester;3 '-phosphoramidic acid
Ester;Hexyl phosphate ester;Aminohexyl phosphate ester;3 '-phosphate;3 '-phosphorothioate;Phosphorodithioate;Or bridging or non-bridge
Methylphosphonic acid ester moiety even.Details is described in detail in WO97/26270, herein incorporated by reference.3 '-cap includes,
Such as, 4 ', 5 '-methylene nucleoside acid;1-(β-D-furan erythrose) nucleotide;4 '-thio nucleotides, homocyclic nucleus thuja acid;5′-
Amino alkyl phosphate ester;1,3-diaminourea-2-propyl phosphate, 3-Aminopropyphosphinic acid ester;6-Aminohexyl phosphate ester;1,
2-aminododecane base phosphate ester;Hydroxypropyl phosphate ester;1,5-dewatering hexitol nucleotide;L-nucleotide;α-nucleotide;Modify
Nucleotide base;Phosphorodithioate;The acid of Soviet Union-pentofuranonucleoside;The acid of acyclic 3 ', 4 '-open nucleoside;3,4-dihydroxy butyl
Nucleotide;3,5-dihydroxy amyl group nucleotide, 5 '-5 '-reversion nucleotide segment;5 '-5 '-reversion basic moiety;5 '-amino phosphorus
Acid esters;5 '-phosphorothioate;BDO phosphate ester;5 '-amino;Bridging and/or non-bridged 5 '-phosphoramidate, phosphorothioate
And/or phosphorodithioate, bridging or non-bridged methyl phosphonate and 5 '-thiol portion.Referring still to Beaucage and Iyer,
1993, Tetrahedron 49,1925;Its content is incorporated herein by reference herein.
In one preferred embodiment, the cap of the nucleotide sequence connecting conjugate of the present invention has below general formula
Structure:
M-L1d-[(A-L2)a-(B-L3)b]c-
Wherein:
M is H, lipid part or targeting group as defined above;
A and B represents monomeric unit, independently selected from monosaccharide and (C2-C20) alkylene glycol;
L1, L2 and L3 are to connect compound, independently selected from di-phosphate ester, phosphorothioate, carbamate, methylphosphonic acid
Ester, guanidine, sulfamate, sulfonamide, dimethoxym ethane (formacetal), sulfur acute pyogenic infection of nails acetal (thioformacetal), sulfone, acyl
Amine and mixture thereof;
A and b is the integer of 0-50;
C is the integer of 0-30;
D is the integer of at least 1.
Lipid part used herein refers to the group of organic compound, it has a lipophilic or amphipathic nature, including,
But it is not limited to, fat, fatty oil, volatile oil, wax, steroid, sterol, phospholipid, glycolipid, thioester, aminolipid, chromolipid
(chromolipid) and fatty acid.Term " lipid " comprises the lipid of both naturally occurring and synthetic production.Lipid part generally increases widow
The lipotropy of nucleotide the cellular uptake in promoting oligonucleotide construct body.The lipid being suitable for that can use includes fat
Fat acid;Fat;Oil;Wax;Cholesterol;Sterol;Fatsoluble vitamin, such as vitamin A. D. E and K;Monoglyceride;Two glycosyl
Diglyceride, and phospholipid.Preferably fatty acid is selected from lauric acid (C12), myristic acid (C14), Palmic acid (C16), tristearin
Acid (C18), behenic acid (C22) and the mixture (lithocholic acid-oleyl amine, C43) of lithocholic acid and oleyl amine.Lipid may be by ability
The situations such as the path that field technique personnel advance according to consideration target tissue, target cell, route of administration, expection oligonucleotide are selected
Select.
Term " monosaccharide " used herein and well known in the art refers to the simple form of sugar, by single sugar unit group
Becoming, it can not further decompose into less sugared construction unit or part.The sugar moieties puting together group for this present invention
It is preferably selected from furanose, fructose, glucose, galactose, mannose, modified monosaccharide, sialic acid and erythrose and mixture thereof.Single
Sugar can be the linear of it or annular form (hemiacetal ring isomerism body).Furanose is any simple sugars comprising 5 yuan of furan nucleuss
Class, such as D-ribose or residue of fructose (D-(-)-fructose furanose).The combination of monosaccharide is obtained in that polysaccharide structures.Fructose is few
Aggressiveness (FOS) and GOS (GOS) are particularly advantageous combinations, and disaccharide sucrose or lactose;Or polysaccharide inulin,
Dextrin, starch or glycogen.
Term used herein " alkylene glycol ", " poly-(alkylene glycol) " and " alkylene oxide " comprise polyether polymer man
Race, its total formula-O-[(CH2)m-O-]n-, wherein m represents the number of methylene group present in each alkylene glycol unit
Mesh, and the number of n repeateding unit, and the therefore size of representation polymer or length.Term includes, is not limited to, ethylene glycol,
Propylene glycol, two alkylene glycols (such as, diethylene glycol), three alkylene glycols (such as, triethylene glycol), and glycol such as foregoing glycols
Corresponding single-or di-alkyl ether, wherein alkyl ether be have 1-6 carbon atom lower alkyl ether (such as, methyl, ethyl,
Propyl ether and analog).
In another embodiment, the group of formula (I) has (C2-C20) alkylene glycol monomeric unit, it can be 2-
The molecule of the linear or side chain of 20 carbon atoms, or, according toaWithbPrice, have some (C2-C20) alkylene glycol monomer
The ployalkylene glycol polymer of unit.Preferably, alkylene glycol group is selected from C16-C20Alkylene glycol.It is highly preferred that alkylene two
Alcohol groups is C18Alkylene glycol.
The blocking group being suitable for conjugate of the present invention includes, is not limited to:
M-L1d-[(A-L2)a-(B-L3)b]c-
-PEG+ sugar, corresponding to above formula, wherein M is H, and d is 0, and A is PEG, B be sugar, a and b is each 1, and L1 and
L2 is phosphodiester bond;
-PEG+ (sugared) 2, corresponding to above formula, wherein A is PEG, and B is sugar, and a is 1, and b is 2, and M is H, and d is 0, and L1 and L2
It it is phosphodiester bond;
-(PEG) 2+ sugar, corresponding to above formula, wherein A is PEG, and B is sugar, and a is 2, and b is 1, and M is H, and d is 0, and L1 and L2
It it is phosphodiester bond;
-(PEG) 3+ sugar, corresponding to above formula, wherein A is PEG, and B is sugar, and a is 3, and b is 1, and M is H, and d is 0, and L1 and L2
It it is phosphodiester bond;
-(PEG) 5+ sugar, corresponding to above formula, wherein A is PEG, and B is sugar, and a is 5, and b is 1, and M is H, and d is 0, and L1 and L2
It it is phosphodiester bond.
Term " PEG " used and " sugared " basically described above, and include that furanose is selected from as sugar and PEG
C3, C9 and C18 spacer.
B.The structure of conjugate of the present invention
The different units of conjugate of the present invention may arrange by different way.Thus, selective reagent can be coupled to
5 ' ends of nucleic acid and/or 3 ' ends.Additionally, nucleic acid and selective reagent may be directly connected or may be connected by joint.
Similarly, joint may be coupled to 5 ' ends and/or the 3 ' ends of nucleic acid.Thus, wherein the nucleic acid of the present invention comprises single nucleic acid chains,
Possible arrangement is:
-comprise the nucleic acid being connected to the 5 ' selective reagents held,
-comprise the nucleic acid being connected to the 3 ' selective reagents held,
-comprise the nucleic acid being connected to the 5 ' selective reagents held He being connected to the 3 ' blocking groups held, and
-comprise and be connected to 5 ' end blocking groups and be connected to the nucleic acid of the 3 ' selective reagents held.
-the nucleic acid modified, it comprises the first and second selective reagents, and described first and second selective reagents are identical
Or different, the two ends of the bifunctional linker that two selective reagents are all held be connected to nucleic acid 5 ' are connected,
-the nucleic acid modified, it comprises the first and second selective reagents, and described first and second selective reagents are identical
Or different, the two ends of the bifunctional linker that two selective reagents are all held be connected to nucleic acid 3 ' are connected,
-the nucleic acid modified, it comprises 4 selective reagents, and described selective reagent is identical or different, two of which
Selective reagent is connected to the two ends of the first bifunctional linker that the 5 ' ends with nucleic acid are connected, and the examination of two of which selectivity
Agent is connected to the two ends of the second bifunctional linker that the 3 ' ends with nucleic acid are connected.
Furthermore, the conjugate of the present invention potentially includes more than one nucleic acid chains, the expression of this nucleic acid regulation target molecule.Example
As, the construct of the present invention can include at most 5 different nucleic acid, and these nucleic acid are linked together by di-phosphate ester, location
Zones of different to given target molecule.
Additionally, in the case of nucleic acid is double-strandednucleic acid, selective reagent can be coupled to justice and/or antisense strand, and
And may directly coupling or connected by linking group.
Form the nucleic acid of a part of conjugate of the present invention during the transhipment through organic different liquids and component,
They must be protected from the degraded of degradation factor, described degradation factor such as nuclease (inside/outside cuts nuclease).For
This target, oligonucleotide is designed to resist enzymic digestion, and improves internal stability and the bioavailability of oligonucleotide
's.Cell exonuclease uses free 5 ' ends as target.Therefore, in the case of single-chain nucleic acid, when the 5 ' ends with nucleic acid
During coupling, selective reagent may serve as steady component.But, comprise double-strandednucleic acid or selective reagent connection at conjugate
To the 3 ' single-chain nucleic acids held, conjugate may comprise steady component, or cap further, its typically by
The activity of exonuclease stops the group of nucleolysis.In the case of double-strandednucleic acid, may arranging of existing is as follows:
[1] selective reagent is attached to 5 ' ends of a chain, and 5 ' at opposite strand hold the additional cap to be in this case
Useful.It addition, cap can also be present in 3 ' ends one or two.
[2] selective reagent is attached to 3 ' ends of a chain, and additional cap is held in 5 ' at justice and antisense strand in this case
Structure is useful.It addition, cap may reside in 3 ' free ends.
[3] in the case of the conjugate comprising more than one identical or different selective reagent, selective reagent is even
It is coupled to 5 ' ends of justice and antisense strand.Can selectively, cap is likely to be present in one or two in 3 ' ends.
In one preferred embodiment, nucleic acid is double-stranded RNA, and wherein selective reagent is connected to the 5 ' of antisense strand
Hold, and blocking group is connected to 5 ' ends of positive-sense strand.Also having in a preferred embodiment, blocking group has structure
M-L1d-[(A-L2)a-(B-L3)b]c-
Wherein, M is H, and d is 0, and A is the polyethylene glycol of C18 spacer, and B is furanose, and a is 2, b and c be 1 and
L2 and L3 is phosphodiester bond.
In one preferred embodiment, the conjugate of the present invention comprises
I () at least one selective reagent, it is specifically bound to one or more neurotransmitter transporters, Qi Zhongxuan
Selecting property reagent is selected from comprising serotonin reuptake inhibitor (SRI), selective serotonin reuptake inhibitor (SSRI), 5-
The reagent set of hydroxytryptamine-NRI (SNRI), and
(ii) nucleic acid, it can specifically be bound to target molecule, and its target is selected from comprising 5-hydroxytryptamine receptor 1A
Type (5-HT1A), coding 5-hydroxytryptamine receptor 1A type (5-HT1A) mRNA, serotonin transporter and coding 5-hydroxy tryptamine turn
The mRNA of fortune body.
In a preferred embodiment, it is possible to be specifically bound to encode 5-hydroxytryptamine receptor 1A type (5-
HT1A) the nucleic acid of mRNA comprise selected from SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3 and the sequence of SEQ ID NO:4
One sequence of group.
Also having in a preferred embodiment, the conjugate of the present invention has structure (I)
Wherein
R1、R2、R3、R4And R5Independently selected from hydrogen and C1-C6Alkyl;
X and Y is independently selected from hydrogen, halogen, C1-C3Alkyl, C1-C3Haloalkyl, ORaAnd SRb, wherein RaAnd RbIt is only
On the spot selected from C1-C3Alkyl and C6-C10Aryl;
W is selected from hydrogen, halogen, CN, NO2、C1-C3Alkyl, C1-C3Alkylhalide group, NRcRd、SO2NReRf、NRgSO2Rh、CO2Ri,
Wherein Rc、Rd、Re、Rf、Rg、RhAnd RiIt is independently selected from hydrogen and C1-C3Alkyl;
M, n and p are selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13, wherein m+n+p's and be selected from 7,8,9,10,
11,12,13,14,15,16,17 and 18 integer and
Wherein oligonucleotide comprises selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4
Sequence set in sequence.
In another embodiment, the conjugate of the present invention has a structure:
Wherein oligonucleotide comprises selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4
Sequence set in sequence.
Also having in preferred embodiment, the conjugate of the present invention has structure (XIV)
Wherein,
R1、R2、R3、R4And R5It is independently selected from hydrogen and C1-C6Alkyl;
X and Y is independently selected from hydrogen, halogen, C1-C3Alkyl, C1-C3Haloalkyl, ORaAnd SRb, wherein RaAnd RbIt is only
On the spot selected from C1-C3Alkyl and C6-C10Aryl;
W is selected from hydrogen, halogen, CN, NO2、C1-C3Alkyl, C1-C3Haloalkyl, NRcRd、SO2NReRf、NRgSO2Rh、CO2Ri,
Wherein Rc、Rd、Re、Rf、Rg、RhAnd RiIt is independently selected from hydrogen and C1-C3Alkyl;
M and p is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13, wherein m+p's and be selected from 7,8,9,10,
11, the integer of 12,13,14,15,16,17 and 18, and
Wherein oligonucleotide comprises selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4
The sequence of sequence set.
In a particular embodiment, conjugate has structure
Wherein oligonucleotide comprises selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4
Sequence set in sequence.
Also another preferred embodiment in, the conjugate of the present invention comprises double-strandednucleic acid, wherein the 5 ' of positive-sense strand
End and blocking group coupling, and 5 ' end and selective reagent couplings of antisense strand.Wherein, blocking group has a structure:
M-L1d-[(A-L2)a-(B-L3)b]c-
Wherein M is H, and d is 0, and A is the macrogol of C18 spacer, and B is furanose, and a is 2, b and c be 1 and L2 and
L3 is phosphodiester bond, and wherein blocking group is Sertraline, and the compound of the present invention has a structure:
C18-di-phosphate ester-C18-di-phosphate ester-furanose-di-phosphate ester-aRNA chain
SRNA chain-peptide connection-Sertraline
Also having in a preferred embodiment, the compound of the present invention has a structure:
Also having in preferred embodiment, the compound of the present invention has a structure:
In another embodiment, conjugate has a following structure:
Wherein,
R1Represent hydrogen, low alkyl group or benzyl
R2Represent hydrogen, methyl, the chlorine of fluorine race
R2' represent hydrogen, methyl, methoxyl group, hydroxyl or halogen atom
R3And R4Represent hydrogen, low alkyl group
R5Represent hydrogen, chlorine or the methoxyl group on 5-or 6-position and
P is 2-6.
Also having in a preferred embodiment, conjugate has following structure
Also having in a preferred embodiment, the oligonucleotide forming a conjugate as defined above part can be special
Being bound to target molecule, wherein said target molecule is selected from different in naturely:
-dopamine-β-hydroxylase,
The mRNA of-coding dopamine-β-hydroxylase,
-BAX,
The mRNA of-coding BAX,
-Tau,
The mRNA of-coding Tau,
-Huntington protein and
The mRNA of-encoding huntingtin.
Saying from meaning of the present invention, the blocking group of formula can be by (referring in formula (I) group with connection compound
" L ") mode be connected to 5 '-OH or the 3 '-OH group of oligonucleotide, thus obtain conjugate-oligonucleotide.Oligonucleoside
The chemical property of acid and formula (I) group can have some embodiments.
For example, it is possible to single oligonucleotide molecules connects in formula (I) on the group of variable number, typically from 2 to
4, under the conditions of formed this of connection by 5 '-OH and/or 3 '-OH, depend on that oligonucleotide is double-strand or strand.Also have
Likely the chain of the some groups in formula (I) is connected to oligonucleotide, and the group of described formula (I) is phase by connection compound
Connecting, such as, phosphoramidite, it is to produce between molecule and/or oligonucleotide that the molecule of phosphodiester bond is derivative to be obtained.
Further, oligonucleotide construct can comprise the chain of some groups of formula (I) and the connection of the one end being connected to oligonucleotide
Other groups to the formula (I) of this oligonucleotide other end.
Further, the constructs of the present invention can comprise more than one targeting agent, is distributed in oligonucleotide
Two chains 5 '-OH and 3 '-OH end in likely combine or be bound on the group of formula (I).If additionally, had
More than one targeting agent, these groups that can be connected in series to formula (I) and/or this oligonucleotide.
If oligonucleotide construct comprises more than one targeting agent, different combinations is possible.Such as, protection
Group can be connected to 5 '-OH or the 3 '-OH end group of a chain of oligonucleotide.Alternatively possible combination includes being connected to
Article one, the medical compounds of 5 '-OH groups of oligonucleotide chain and a series of aptamers, described aptamers is attached to and another
The terminal units aptamers of formula (I) group of bar oligonucleotide chain combination.
C.The pharmaceutical composition of the present invention
Inventor has been found that the conjugate of the present invention has the ability of regulation expression of nucleic acid, and it is to put together by being directed to
The nucleotide sequence of thing is carried out.Such as, specific effect is comprised in presynaptic 5-HT at conjugate1AIn the case of the nucleic acid of R, when
When construct is delivered medicine to experimenter, it can induce midbrain enlargement of lymph nodes (that is, the 5-hydroxy tryptamine energy nerve in brain of experimenter effectively
Unit body place region) in 5-HT1AThe specificity of R reduces.
Therefore, it will be appreciated by those skilled in the art that the conjugate of the present invention is appropriate for the treatment of disease, its
Being probably from the reduction of gene expression dose benefit, the nucleic acid being present in conjugate of the present invention of described gene is oriented
's.Therefore, another aspect, the present invention relates to the conjugate used in medicine according to the present invention.It addition, the invention still further relates to
Pharmaceutical composition, it comprises the conjugate according to the present invention and pharmaceutically acceptable excipient.
Appropriate oligonucleotide construct of the present invention can press formula system with pharmaceutically acceptable excipient and/or carrier
Make to obtain pharmaceutical composition.The compositions comprising conjugate of the present invention can give experimenter with number of ways.Exemplary
In approach includes striatum, in Intraventricular, sheath, in Thin Film Tissue, (such as, in striatum), intranasal and eye give.Group
Compound can give with whole body, such as, by intravenous, subcutaneously or intramuscularly injects, and it is for giving conjugate to periphery god
It is useful especially through unit.It addition, the conjugate of the present invention is it is also possible to intranasal administration, its make by Noninvasive to prescription
Formula and Formulations for systemic administration.Further, intracerebroventricular administration may also be appropriate.Preferably route of administration is directly to arrive brain, such as,
Enter the ventricles of the brain or the hypothalamus of brain, or enter side or the dorsal part region of brain.
The pharmaceutical composition of the present invention may comprise multiple different conjugate, and the most different conjugates comprises and targets
The nucleic acid of the zones of different of identical target molecule.Thus, pharmaceutical composition may comprise at least 2, at least 3, at least 4, extremely
Few 5, at least 6 and more different conjugate, each different conjugate comprises different nucleic acid.
Known and commercially available data familiar to the person skilled in the art such as " Lei Shi medicine is complete works of " (Remington ' s
Pharmaceutical Science) (the 17th edition, Mack Publishing Co., Easton, Pa., 1985) and Gourde(G) graceful and
Gill graceful treatment pharmacological basis (Goodman and Gilman ' s ThePharmaceutical Basis of
Therapeutic) (the 8th edition., Pergamon Press, Elmsford, N.Y., 1990) discussed in principle and program, its
Herein, the two is incorporated herein by reference.
In the preferred embodiment of the present invention, it is configured to be suitable to the mankind and other sucklings by conjugate according to standardization program
The pharmaceutical composition that animal is administered.Typically, the compositions of intravenous or intracerebroventricular administration is sterile isotonic aqueous buffer
Solution.
If desired, compositions can also include solubilizing agent and for improving the local anesthesia of any pain of injection site
Agent.Normally, component is to provide individually or mixedly in unit dosage form, such as, denotes the amount of active component
Hermetically sealed container such as ampulla or medicine bag in lyophilized powder or anhydrous concentrating agents (water free concentrate).Work as combination
When thing is administered by injecting, it can make up a prescription by comprising the infusion bottle of the other water of sterile pharmaceutical grade or saline.When compositions is led to
When crossing drug administration by injection, it is possible to use the ampulla containing sterilized water for injection or saline is so that component can mix before use.
Except the situation of intravenous administration, compositions can comprise less amount of wetting agent or emulsifying agent, or pH buffering
Agent.Compositions can be liquid solution, suspension, Emulsion, gel, polymer or slow releasing preparation.Compositions can be with ability
Binding agent traditional known to territory is made by formula together with carrier.Preparation can include that standard vector such as pharmaceutical grade is other sweet
Dew alcohol, lactose, starch, magnesium stearate, saccharin sodium, cellulose, magnesium carbonate etc., inert carrier has in pharmaceutical preparation produces
The function of good determination.Various drug-supplying systems are known, it is possible in the administration of the treatment of the present invention, including lipid
Body encapsulating, microgranule, microsome and the like.
Also having another preferred embodiment, the therapeutic preparation including conjugate of the present invention can be with neutral or salt
Form is prepared.Pharmaceutically acceptable salt includes those salt formed with free amine group, such as, derive from hydrochloric acid, phosphoric acid, vinegar
Acid, oxalic acid, tartaric acid and the like, and with free carboxy formed those, such as derive from sodium, potassium, ammonium, calcium,
Hydrated ferric oxide., 2-aminopropane., triethylamine, 2-ethylaminoethanol, histidine, procaine or similar.
For giving the embodiment of compositions through blood brain barrier, compositions includes, such as, liposome, as such as existed
U.S. Patent number 6,372, described in 250 (Pardridge), and pharmaceutically acceptable carrier.Lipid described herein
Bioactivator can be transmitted by body through blood brain barrier, expresses subsequently in brain.Liposome and nanoparticle are nano-carriers
(nanocontainer) canonic form, is commonly used for the encapsulating of medicine.Liposome preferably has less than 200 nanometers
Diameter.The liposome of the diameter with 50-150 nanometer is preferred.Particularly preferably there is the fat of about 80 nanometer external diameters
Plastid or other nano-carriers.The liposome of suitable type is with neutral phospholipid such as 1-palmityl-2-oleoyl-Xi-sweet
Oil-3-phosphocholine (POPC), two phosphatidyl phosphocholines, DSPE (DSPE) or cholesterol, even
Make together with the cation lipoid such as didodecyldimethylammbromide bromide (DDAB) of (1%) in a small amount, in order to stable fat
DNA in plastid.
Liposome can substitute by the molecule nano carrier less than 200nm with nanoparticle or any other diameter, works as preparation
The most in blood or when the cellular compartment of blood transportation to target cell, its can encapsulate DNA and protect nucleic acid from
Nuclease decomposes.Further, instead of using conjugation reagents such as PEG chain, and the material of one or more other polymerizations is used such as
Sphingomyelins, it can be connected to the surface of liposome or nano-carrier, and reach dual purpose: for sewing of " transportable peptide "
Close and support is provided and eliminates from blood for retard formulation and optimize plasma pharmacokinetics character.Further, this
Bright emphasis DNA is administered to any part of cell or organ, and it has specific target receptor.Liposome can serve as by DNA to
Give to organ, such as liver, lung and spleen.
The carrier of the delivery of other applicable conjugates of the present invention includes dendrimer.Term " dendrimer " is
Refer to there is a core and there is the macromole of apparatus derivatorius of the multiple shell launched from core.The shape of arborization carrier
It is to change with size.In some cases, the shape of arborization carrier can be substantially spheroid or spherical.And
And, arborization carrier can have about 15 angstroms (A) to the diameter in the range of about 250A, and the molecule of respective range
Amount, such as, from about 500 dalton to about 2 megadalton.Dendrimer can from various commercial channel (such as,
Dendritech, Midland, Michigan) obtain or obtained by the method synthesis that those skilled in the art will know that.Branch
Shape molecule can be roughly classified into low-molecular-weight class and high molecular class.The first kind includes dendrimer and dendron
(dendron), and Equations of The Second Kind comprises dendron polymer, dissaving polymer and brush polymer (also referred to as bottlebrush
(bottle-brushes)).Dendrimer and dendron are to repeat branch, the chemical combination of monodispersed and usual high degree of symmetry
Thing.Definition dendrimer and dendron do not has obvious difference.Dendron generally includes addressable base in pure chemistry
Group, it is referred to as focus.Due to the shortage of molar mass distribution, high molecular weight dendrimer and dendron be macromole and
Non-polymer.The character of dendrimer is to be determined by the functional groups of molecular surface.The dendroid bag of functional molecular
Envelope makes avtive spot isolate, and a structure, it simulates the structure of avtive spot in biomaterial, because dendroid support separates
Inside and outside function.Such as, when the end group of dendrimer is hydrophilic group, and as carboxyl, dendrimer can
Being water miscible.
Dendrimer is generally characterized by following character: (i) nuclei originis (I), and it may have one or more work
Property site and be that point-like or significant size are to affect the final topology of dendrimer;(ii) one layer
Or the repetitive of branch that multilamellar is connected on nuclei originis;(iii) functional end group, such as anionic group or sun from
Subbase group, is connected to the surface of dendrimer, and described connection is at random to be connected by linking group.
The most desired dendrimer may comprise lysine or lysine analogues construction unit.Term " relies
Propylhomoserin analog " refer to a molecule, it has single summit carboxylic group for being connected to the construction unit of last layer, and 2
Individual or 3 primary amine groups, it can be connected with construction unit, blocking group, joint or aryl acid group further.Phase herein
The example of " lysine analogues " hoped described in the PCT/AU2007/000352, such as glycyl-lysine (glycyl-
lys).In some specific examples, dendrimer only comprises lysine or a type of lysine analogues is made
For construction unit.
Other dendrimers the most desired include that those comprise polyethyene diamine (PAMAM), poly-(ether azanol)
Or polypropylene-base imines construction unit (PEHAM).In its object lesson, dendrimer only has polyethyene diamine
(PAMAM), poly-(ether azanol) (PEHAM) or polypropylene-base imines is as construct.
Core part may only include 1 junction point for connecting construction unit or 2,3 or more points may be comprised, it can
Can meeting or the possible connection that will not be used for construction unit further.Typically, junction point is free amine group.Core part can
Can include, comprise or derived from construction unit or be probably the molecule different from construction unit.Typical core part be
Illustrate herein and described in PCT/AU2007/000352.
Liposome and dendrimer may be combined with any applicable pharmaceutical carrier for intravenous administration.Compositions
Intravenous administration be preferred approach, owing to this has minimum invasive.Other administration route is possible, if it is desired to
If.Suitable pharmaceutically acceptable carrier include saline, Tris buffer, phosphate buffer or any other
Aqueous solution.Appropriate dosage can be determined by program well known by persons skilled in the art.
D.The therapeutic use of conjugate of the present invention
It is appreciated that the treatable clinical symptoms of conjugate of the present invention will depend upon which the part forming conjugate
The specificity of nucleic acid.Therefore, the conjugate of the present invention may be used for the treatment of any disease, and described disease can be by
Suppression cell expresses the gene interested of neurotransmitter transporters and improves.It will be appreciated by those skilled in the art that
Conjugate is useful for the treatment of following disease, and described disease is with unconventionality expression (such as, the Louis body of albumen in cell
The accumulation of middle alpha-synapse nucleoprotein) for characterize, or to target protein express horizontal abnormality but its can by reduce described target
The disease that the expression of albumen improves.
D.1.Comprising the conjugate of nucleic acid, described nucleic acid targeting acts on the 5-HT being positioned on serotoninergic neuron 1A Receptor, 5-hydroxy tryptamine transporter or ion channel
As it has been described above, when giving required experimenter by SSRI, have a negative feedback mechanism to occur, its result makes to be positioned at 5-
Hydroxytryptamine serotonergic neuron (presynaptic 5-HT1AR) 5-HT1AThe activation of receptor.The effect of SSRI causes high 5-hydroxy tryptamine water
Flat, described high 5-hydroxy tryptamine level is by the serotonin reuptake transporter transporter (SERT) being positioned on serotoninergic neuron
The blocking-up of serotonin reuptake transporter of mediation and induce.This fact will not only activate postsynaptic 5-hydroxytryptamine receptor, and
Also activate presynaptic 5-HT1AR, it acts as cell feedback transducer.These 5-HT1AThe activation of R causes 5-hydroxy tryptamine level
Reduce, because cell discharge and the suppression of pulse dependent 5-hydroxy tryptamine release, thus limit the administering effect of SSRI.
This effect shows that wherein it shows and comprises Sertraline and 5-in such as embodiments of the invention 2 and 3
HT1AThe infusion of the conjugate of R-specific siRNA can stop by selectivity 5-HT1AThe hypothermic response of R agonist induction.This
Individual effect makes the conjugate of the present invention application in all that clinical symptoms, wherein it is desirable that the expression of suppressor gene,
The complementary nucleic acid of a part for described gene and formation conjugate.
In anti depressant therapy field, this is an important discovery, because the oligonucleotide of the present invention can be useful
, to offset the side effect of the SSRI of above-mentioned commercialization, i.e. onset is slowly and offer limited effectiveness.It addition, by the application present invention
High selectivity oligonucleotide construct, it is only necessary to the treatment oligonucleotide giving low dosage just can reach desired effect
Really.Therefore, the construct of the present invention is useful to treatment disease, the 5-hydroxyl of the abnormal concentrations of described disease and synaptic zones
The disease that tryptamines is relevant, particularly not enough to 5-hydroxy tryptamine transmission relevant those diseases (i.e. 5-hydroxy tryptamine concentration water in synapse
Flat minimizing), such as depressed relevant disease.
Correspondingly, if the targeting of nucleic acid is the component for presynaptic serotoninergic neuron, conjugate will be suitable for
In treatment disease, wherein need the activity reduction of presynaptic serotoninergic neuron.Therefore, in yet another aspect, the present invention
Relate to conjugate of the present invention, wherein
I () selective reagent is taken the photograph selected from serotonin reuptake inhibitor (SSRI), 5-hydroxy tryptamine-norepinephrine again
Take inhibitor (SNRI) or norepinephrine energy and specificity 5-hydroxy tryptamine energy antidepressant (NASSA) and
(ii) oligonucleotide can specifically be bound to target molecule, and described target molecule is selected from 5-hydroxytryptamine receptor 1A type
(5-HT1A) mRNA, 5-hydroxy tryptamine transporter mRNA, TREK-1mRNA, 5-hydroxytryptamine receptor 1A type (5-HT1A) polypeptide, 5-hydroxyl color
Amine transporter polypeptide and TREK-1 polypeptide
For the depressed associated conditions for the treatment of or prevention.
Alternatively, the present invention relates to a kind for the treatment of or the method for the depressed associated conditions of prevention, it is tested that it comprises to needs
Person is administered the conjugate of the present invention, wherein
I () selective reagent is taken the photograph selected from serotonin reuptake inhibitor (SSRI), 5-hydroxy tryptamine-norepinephrine again
Take inhibitor (SNRI) or norepinephrine energy and specificity 5-hydroxy tryptamine energy antidepressant (NASSA) and
(ii) oligonucleotide can specifically be bound to target molecule, and described target molecule is selected from 5-hydroxytryptamine receptor 1A type
(5-HT1A) mRNA, 5-hydroxy tryptamine transporter mRNA, TREK-1mRNA, 5-hydroxytryptamine receptor 1A type (5-HT1A) polypeptide, 5-hydroxyl color
Amine transporter polypeptide and TREK-1 polypeptide.
Expression " depressed associated conditions " used herein refers to be characterized with the low-level singularly of 5-hydroxy tryptamine in synapse
Those symptoms, and it is at American Psychiatric Association (American PsychiatricAssociation), Washington
Psychotic diagnostic and statistical manual fourth edition (the Diagnostic and Statistical Manual of that DC publishes
Mental Disorders--Fourth Edition) defined in (DSM-IV), and include, it is not limited to, major depression
Disease, long term depression, tolerance to treatment depression, dysthymia, with sadness, despair, setback, " dejected ", melancholy being felt as
The mental status of the depressive emotion of feature, low self affirmation sense, compunction and self-accusation, exit human communication, and somatization example
If feed is with sleep disordered.Preferably, depressed associated conditions is selected from: major depression, compulsive disorder (OCD), comprehensive
Mental development obstacle (PDDs), post-traumatic stress disorder (PTSD), anxiety neurosis, bipolar disorder, eating disorders
And chronic pain.
It addition, conjugate of the present invention comprises selective reagent specific to serotoninergic neuron and lowers 5-HT1A
The oligonucleotide of receptor, it is released in the 150-200% of 5-hydroxy tryptamine increase about baseline value in prefrontal cortex, and by individually
50% increase that antidepressant produces compares (see Fig. 8).As it was previously stated, traditional antidepressant is designed to improve 5-hydroxyl color
The transmission of amine, but due to presynaptic 5-HT1AThe activation of receptor and the most limited effect.Therefore, with the oligonucleoside of the present invention
Acid con-struct, overcomes the major limitation (onset slowly and offer limited effectiveness) of described antidepressant.Therefore, can reach in a short time
To the active response to antidepressant treatment, and relative to only treating with commercialization antidepressant (i.e. SSRI), can improve
Adapt to the number of the patient for the treatment of.Therefore, another aspect, the present invention relates to a kind of method treating depressed associated conditions, its
Comprise conjugate and the antidepressant being administered the present invention.
The oligonucleotide construct of the present invention can with general antidepressant (SSRIs, NARIs, MAOI, TCA etc.) simultaneously
It is administered.The administration of oligonucleotide sequence blocks 5-HT1AThe expression of autoreceptor, makes the effect of these antidepressant improve, and it is
The decay increased by reuptake is blocked the extracellular 5-HT produced carries out what suppression realized
D.2.Comprising the conjugate of nucleic acid, described nucleic acid targets synapse nucleoprotein
Another aspect, the present invention relates to conjugate of the present invention, wherein
I () selective reagent presses down selected from dopamine reuptake inhibitor (DRI) and norepinephrine-dopamine reuptake
Preparation (NDRI) and
(ii) oligonucleotide can specifically be bound to target molecule, and it is coding alpha-synapse nucleoprotein or alpha-synapse core egg
The mRNA of white polypeptide
For the disease that treatment or prevention are relevant with Louis body deposition.
Term " disease relevant with Louis body deposition " refers to the symptom being characterized with the disorder of alpha-synapse nucleoprotein metabolism,
It causes the formation of abnormal neuron alpha-synapse nucleoprotein inclusion body.More specifically lewy body disease includes parkinson disease (PD), road
Easily body dull-witted (DLB), Parkinsonism dementia (PDD) and multiple system atrophy.
Preferably, conjugate of the present invention may be administered together with commercialization antidepressant such as SSRI, is used for treating depression
And/or depression associated conditions.
D.3.Comprising the conjugate of nucleic acid, described nucleic acid targets norepinephrine transporter
The most as explained in the background section, the increase of the DA conveying of middle Cerebral cortex may be to have to schizoid treatment
?.Because to NA with DA, NA transporter (NAT) shows that similar affinity, NAT inhibitor preferentially increase at inner side PFC
(mPFC) EC of DA in, compared with caudatum and nucleus accumbens septi (NAc).Therefore, from the NA of locus coeruleus (LC) neuron
Aixs cylinder may facilitate the EC of DA in regulation PFC, by absorbing or common-release.
Another aspect, the present invention relates to the conjugate of the present invention, wherein
I () selective reagent is selected from dopamine reuptake inhibitor, NRI, 5-hydroxyl color
Amine-NRI and norepinephrine-dopamine reuptake inhibitor (NDRI) and
(ii) oligonucleotide can specifically be bound to target molecule, and described target molecule is coding noradrenaline transporter
Body or the mRNA of norepinephrine polypeptide
For treatment or prevention by norepinephrine reuptake suppression mediation or to norepinephrine reuptake
The sensitive disease of suppression.
Such medical symptom includes, by way of example, and pain disorder such as neuropathic pain and chronic pain, press down
Strongly fragrant disease such as severe depression, affective disorder such as anxiety neurosis, attention deficit hyperactivity disorder, cognitive disorder is the most dull-witted, and
Stress urinary incontinence.
D.4.Comprising the conjugate of nucleic acid, described nucleic acid targets dopamine-β-hydroxylase
The most as explained in the background section, the increase of the DA conveying of middle Cerebral cortex may be to schizoid treatment by
Useful.This increase may be realized by the application of norepinephrine transporter inhibitor, or, alternatively, pass through
Dopamine-β-hydroxylase is suppressed to realize.This enzyme is responsible for becoming Dopamine Turnover norepinephrine, and therefore, instantly
Timing, the raising of dopamine level that will cause in NA neuron.This is comprising the norepinephrine energy of NA by being sequentially generated
In vesicle and the DA of higher level.This increases the DA level of NA projection area and improves the cognition of brain and remember relevant function.
Therefore, another aspect, the present invention relates to conjugate of the present invention, wherein
I () selective reagent is selected from norepinephrine transporter inhibitor (SDNRI) and norepinephrine-dopamine
Reuptake inhibitor (NDRI) and
(ii) oligonucleotide can specifically be bound to target molecule, its be coding dopamine-β-hydroxylase or dopamine-
The mRNA of B-hydroxylase polypeptide
For the relevant disease that treatment or prevention are not enough with the dopamine of norepinephrine energy projection.
Expression used herein " relevant disease not enough with the dopamine of norepinephrine energy projection " refer to dull-witted,
The depressed memory relevant with neurodegenerative disease and cognitive process.
D.5.Comprising the conjugate of nucleic acid, described nucleic acid targets BAXIn yet another aspect, the present invention relates to the present invention sew
CloseThing, wherein
I () selective reagent is selected from 5-hydroxy tryptamine-dopamine-NRI (SDNRI) and go
Methylepinephrine-dopamine reuptake inhibitor (NDRI) and
(ii) oligonucleotide can specifically be bound to target molecule, and it is the mRNA of coding BAX or BAX polypeptide
For the disease that treatment or prevention are relevant to the apoptosis of neuron and cell death.
Terminology used herein " disease relevant to the apoptosis of neuron and cell death " refers to that many people are neural
" terminal " of sexual disorders, include but not limited to Alzheimer, parkinson disease and Huntington Chorea, apoplexy/wound, multiple firmly
Change and amyotrophic lateral sclerosis.The apoptosis of the neuron with cortex of Hippocampus is the reason of the symptom of Alzheimer;
The death using the midbrain neuron of neurotransmitter dopamine is that Parkinsonian basis occurs;Huntington Chorea relates in striatum
Control the death of the neuron of health action;And the mortality table of LM reveals amyotrophic lateral sclerosis.It addition,
Cerebral ischemia and the necrosis in wound-induced microcephalus region, then it is withered away to bigger by apoptosis diffusion neuronal cell
Brain region, due to the neurotoxic substances of non-viable non-apoptotic cell release.The extinction of the neuronal cell of apoptosis is also seen in aging brain
Observe, as a physiological process.
D.6.Comprising the conjugate of nucleic acid, described nucleic acid targets tau
In yet another aspect, the present invention relates to conjugate of the present invention, wherein
I () selective reagent is selected from 5-hydroxy tryptamine-dopamine-NRI (SDNRI) and go
Methylepinephrine-dopamine reuptake inhibitor (NDRI) and
(ii) oligonucleotide can specifically be bound to target molecule, and it is the mRNA of coding tau or Tau polypeptide
For treating or preventing tau relevant disease.
Terminology used herein " tau relevant disease " refers to relevant disease abnormal to Tau and the disease of " Tau pathological changes "
Sick.Tau relevant disease includes, but not limited to the hypotype including frontotemporal dementia and No. 17 parkinson's syndromes that chromosome is relevant
(FTDP-17) frontotemporal dementia (frontotemporal dementia), progressive supranuclear plasy, cortical basal ganglionic degeneration,
Creutzfeldt jakob disease, argyrophilic grain disease, and parkinson disease, mongolism, postencephalitic parkinsonism, steinert's disease, Buddhist nun
Graceful-pik c-type disease, boxer's dementia, Blint disease, prion disease, amyotrophic lateral sclerosis, pass island parkinson's syndrome, many
The property sent out hardening, glaucoma, diabetic retinopathy, and traumatic brain injury;And Huntington Chorea, dementia with Lewy body, proper gram-
Ma Li-Du Sishi disease, hereditary spastic paraplegia and multiple system atrophy.Defined herein " Tau pathological changes " means and the fibre in brain
The neurodegenerative disease that the Tau albumen (entanglement tangles) of dimensionization form is relevant.These diseases include AD;But, other Tau
Pathological changes includes, but not limited to the volume temporo of the hypotype including frontotemporal dementia and No. 17 Parkinson's diseases that chromosome is relevant (FTDP-17)
Dementia, progressive supranuclear plasy, cortical basal ganglionic degeneration, a creutzfeldt jakob disease and argyrophilic grain disease.
D.7.Comprising the conjugate of nucleic acid, described nucleic acid targets Huntingdon
Another aspect, the present invention relates to conjugate of the present invention, wherein
I () selective reagent is selected from 5-hydroxy tryptamine-dopamine-NRI (SDNRI) and go
Methylepinephrine-dopamine reuptake inhibitor (NDRI) and
(ii) oligonucleotide can specifically be bound to target molecule, and it is coding Huntingdon or the mRNA of Huntingdon polypeptide
For treating or preventing Huntingdon relevant disease.
Terminology used herein " Huntingdon relevant disease " refers to the anomalous structure by saltant type Huntington protein or gathering
Or express the disease caused, and include, but not limited to Huntington Chorea and mutation thereof.
The therapeutic dose of the present invention, it will be effective in the treatment of particular condition or symptom, will depend upon which obstacle or disease
The character of shape, and can be determined by standard clinical techniques, set up well in the dosage regimen for the treatment of.In preparation
The exact dose of employing also be will depend upon which the seriousness of route of administration and disease or disease, and should be according to the judgement of doctor
Determine with the needs of patient.The suitable dosage range of intracranial administration is typically every microlitre about 103 to 1015 infectious unit
Viral vector, with in the single volume injected of 1 to 3000 microlitre be administered.In every microlitre, the addition of the infectious unit of carrier leads to
Often will include 10 4,10 5,10 6,10 7,10 8,10 9,10 10,10 11,10 12,10 13,1014 infectious units
Viral vector, gives with about 10,50,100,200,500,1000 or 2000 microlitres.Effective dose may from based on external or
The dose-response curve of iii vivo test systems deduces.
For the intracerebroventricular administration of conjugate of the present invention, the multiple catheters with access port can be implanted to particular patient body
Interior for complete treatment.In a preferred embodiment, every brain or hemisphaerium cerebelli have a mouth and a conduit system, and also
Permitted to have multiple.Once being completed to implant by neurosurgeon, the neurologist, nerve specialist doctor of patient can carry out course of therapy, described
Course of therapy be repetition bolus injection conjugate within the time of exceedance thoughtful several months, during this period of time treat simultaneously
The monitoring of effect.Device can keep the treatment implanting some moons or year for full course for the treatment of.After therapeutic effect confirms, access port can
Can selectively remove, and can seal and abandon conduit, or remove equally.Device materials should not disturb magnetic resonance to become
Picture, and, certainly, siRNA preparation must be compatible with access port and tube material and any surface coatings.
The synthesis of conjugate the most of the present invention
Typical case's synthesis of the conjugate of the present invention is to use the standardization program in organic synthesis to synthesize.Technical staff will
Being understood by, definite synthesis step will depend upon which the precise structure of conjugate to be synthesized.Such as, if conjugate comprises
The single nucleic acid chains of selective reagent it is conjugated to, then synthesis is generally by the carrying out of following description, by by amino by 5 ' ends
Activation oligonucleotide contacts connection with reaction activation selective reagent to be carried out.
When conjugate comprises double-strandednucleic acid, then justice is separately synthesized with antisense strand and uses standard molecular biology program
External annealing.In typical conjugate, the first nucleic acid chains is loaded with selective reagent, and the second nucleic acid chains is loaded with blocking group.
Also in a preferred embodiment, selective reagent is coupled to 5 ' ends and/or the blocking group connection of the first nucleic acid chains
To the second nucleic acid chains 5 ' end, although the connection of selective reagent or the connection of blocking group can also hold in the 3 ' of nucleic acid chains into
OK.
The synthesis of conjugate can be carried out according to following:
[1] conjugate has following structure
Selective reagent-[oligonucleotide]-3 '
Typically synthesize by following steps:
(i) activation selective reagent.Preferably, the activated group in selective reagent is butanimide group or ammonia
Base;
(ii) at 5 ' end activation oligonucleotide.Preferably, the activated group in oligonucleotide is amino (wherein selectivity examination
Agent is activated by butanimide group) or carboxyl (wherein selective reagent has passed through amino-reactive) and
(iii) it is being suitable between two activated groups under conditions of reaction, by the widow of the selective reagent of activation with activation
Nucleotide contact connects.
[2] there is the conjugate of following structure
Blocking group-[positive-sense strand]-3 '
3 '-[antisense strand]-selective reagent
Following steps are typically used to synthesize:
(i) activation selective reagent.Preferably, the activated group in selective reagent is butanimide group or ammonia
Base,
(ii) at 5 ' end activation positive-sense strands of positive-sense strand.Preferably, the activated group in oligonucleotide is that amino (wherein selects
Selecting property reagent is activated by butanimide group) or carboxyl (wherein selective reagent has passed through amino-reactive),
(iii) it is being suitable between two activated groups under conditions of reaction, by the selective reagent of activation with activation just
Justice chain contact connects,
(iv) blocking group is added to immobilized antisense strand.The step for be preferably used active group and be acetylation
Or the oligonucleotide that benzylation (furan group), 2-cyanoethylation (di-phosphate ester connection) and FMOC (exocyclic amino group) close comes
Carry out.
V positive-sense strand and antisense strand are annealed by ().
E.1.The synthesis of the conjugate comprising nucleic acid and be connected to the 5 ' SSRI held
The conjugate of the present invention can prepare by technology well known by persons skilled in the art.The synthesis of conjugate can
Can relate to selective protection and the deprotection of functional groups.Suitably blocking group is to well known to a person skilled in the art.Example
As, by Wuts, P.G.M. and Greene T.W. at " blocking group in organic synthesis " (Protecting Groups in
Organic Synthesis) (fourth edition .Wiley-Interscience), and Kocienski P.J. is at " blocking group "
Blocking group in the organic chemistry provided in (Protecting Groups) (third edition Georg Thieme Verlag)
Summary.
In the context of the present invention, the meaning of following term is described in detail below:
-term " C1-C6Alkyl " refer to the linear or alkyl of branch that is made up of carbon and hydrogen atom, it does not include unsaturation
Group, has 1 to 6, preferably 1 to 3 (C1-C3Alkyl) individual carbon atom, and it is other parts being combined in molecule by singly-bound
On.The example of alkyl include but not limited to alkyl such as methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, the tert-butyl group, penta
Base and hexyl.Preferably, alkyl refers to methyl.
-term " halogen " refers to bromine, chlorine, iodine or fluorine.
-term " alkylhalide group " refers to that alkyl as defined above, at least one of which hydrogen atom are replaced by halogen atom.
The example of alkylhalide group includes but not limited to CF3、CCl3、CHF2、CF2CF3.Preferably, alkylhalide group refers to CF3。
-term " C6-C10Aryl " refer to the aromatic group with 6-10 carbon atom, comprise 1 or 2 aromatic proton, by
Carbon-carbon bond or condense combines, including such as phenyl, naphthyl and diphenyl.Preferably, " aryl " refers to phenyl.
-term " heterocyclic radical " refers to stable 3-to 10-unit ring group, preferably 5-or 6-ring, its by carbon atom and
1-5 the hetero atom composition selected from nitrogen, oxygen and sulfur, and it can the most saturated or (" heteroaryl of fragrance
Base ").For the purposes of the present invention, heterocycle can make monocycle base, bicyclic group or three ring group modes, and it can include fused rings
Mode.In a specific embodiment, heterocyclic group is butanimide.
The compound of the present invention represented by formula (I) potentially includes stereoisomer as described above, and it depends on hands
The existence at property center.Single isomer, enantiomer or non-corresponding isomer and mixture thereof each fall within protection scope of the present invention.
Except as otherwise noted, the compound used by the present invention is intended to cover in the existence of one or more isotope enrichment atom
Lower and the most different compounds.Such as, except substituting hydrogen with deuterium or tritium, or with 13C-or14C-enrichment carbon or15N-
It is within the scope of the invention that enriched in nitrogen substitutes the compound with present configuration outside carbon.
i.The Sertraline derivant synthesis of the nucleic acid derivative with amino and activation
In first embodiment, the conjugate of the present invention can be by being coupled to Sertraline by the nucleic acid that amino is derivative
Or the activated derivatives form of its analog and obtain, wherein the activated derivatives of selective reagent is formula (II) compound:
Wherein
R1、R2、R3、R4And R5It is independently selected from hydrogen and C1-C6Alkyl;
X and Y is independently selected from hydrogen, halogen, C1-C3Alkyl, C1-C3Alkylhalide group, ORaAnd SRb, wherein RaAnd RbIt is independent
Ground is selected from C1-C3Alkyl and C6-C10Aryl;
R6It it is carbonyl-activating base;
W is selected from hydrogen, halogen, CN, NO2、C1-C3Alkyl, C1-C3Alkylhalide group, NRcRd、SO2NReRf、NRgSO2Rh、CO2Ri, its
Middle Rc、Rd、Re、Rf、Rg、RhAnd RiIt is independently selected from hydrogen and C1-C3Alkyl;
N and p is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13.
Term " carbonyl-activating base " refers to the substituent group of carbonyl, and it makes carbonyl that nucleophilic addition easily to occur.At a tool
In the embodiment of body, it forms anhydride, carboxylic acid halides or ester group together with carbonyl.In one preferred embodiment, carbonyl is lived
Change base be selected from halogen ,-OC (O) R ,-OR ' ,-SR ";Wherein R, R ' and R " it is independently selected from C1-C6Alkyl, alkylhalide group, heterocycle
Base, aryl and heteroaryl.
In a specific embodiment, R6It it is succinimido.Therefore, in another embodiment, this
Bright conjugate can be by being coupled to the activated derivatives form of Sertraline or its analog, wherein by the nucleic acid that amino is derivative
The activated derivatives of selective reagent is formula (III) compound:
Wherein
R1, R2, R3, R4And R5It is independently selected from hydrogen and C1-C6Alkyl;
X and Y is independently selected from hydrogen, halogen, C1-C3Alkyl, C1-C3Alkylhalide group, ORaAnd SRb, wherein RaAnd RbIt is independent
Ground is selected from C1-C3Alkyl and C6-C10Aryl;
W is selected from hydrogen, halogen, CN, NO2、C1-C3Alkyl, C1-C3Alkylhalide group, NRcRd、SO2NReRf、NRgSO2Rh、CO2Ri, its
Middle Rc、Rd、Re、Rf、Rg、RhAnd RiIt is independently selected from hydrogen and C1-C3Alkyl;
N and p is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13.
According to specific embodiment, the activating compounds of formula (III) is compound (1):
According to an embodiment, formula (I) compound can be prepared by following sequence, including:
A) formula (IV) compound
With formula (V) acylation reaction:
Wherein p is as defined above, and Z is halogen or OH and PG is that amido protecting group is to obtain formula (VI) compound
The blocking group being generally used for amino includes carbamates, the such as tert-butyl group, benzyl, 2,2,2-tri-chloroethenes
Base, 2-trimethylsilyl ethyl, 9H-fluorenylmethyloxycarbonyl (Fmoc), pi-allyl or nitrophenylcarbamate;Amide
Class, such as benzamide type, ethanamide, trifluoroacetyl amine, sulfonamides, trifluoromethyl sulfonyl amide-type or the tert-butyl group
Sulfonyl amide-type;With aryl or aralkyl amine, such as p-methoxyphenyl, benzyl, p-methoxy-benzyl, 3,4-diformazan
Oxy-benzyl, dimethoxytrityl or monomethoxytrityl amine.In a specific embodiment, formula
(V) acylating agent is 9H-fluorenylmethyloxycarbonyl-6-aminocaprolc acid.
Formula (IV) compound such as can be sequentially prepared according to the method described in US6455736 and obtain.Specifically, formula is worked as
(IV), during Formula Sertraline, it can process with suitable alkali from its corresponding hydrochlorate (can commercial buy)
Arrive, including the organic or carbonate of inorganic basis such as alkali or alkaline-earth metal or hydroxide, ammonium salt or amine such as trimethylamine,
Triethylamine, diisopropylethylamine, pyridine, piperidines, morpholine and the like.
B) the amido protecting group deprotection in formula (IV) compound is to generate formula (VII) compound:
Suitably deprotection condition is known to the skilled person, such as " blocking group in organic synthesis "
(Protecting Groups in Organic Synthesis) (Wuts, P.G.M.andGreene T.W., fourth edition
And " blocking group " (ProtectingGroups () Kocienski P.J., third edition .Wiley-Interscience)
.Georg Thieme Verlag).In a specific embodiment, blocking group is to remove in the case of there is amine
, such as piperidines, morpholine, hexanamine, diisopropylethylamine or dimethylamino naphthyridine, preferably in the presence of piperidines.
C) formula (VII) compound and formula (VIII) or (IX) acylation reaction:
Wherein n is as defined above, and Z is halogen or OH, generation formula (X) compound:
In a specific embodiment, formula (VII) acylating agent is succinic anhydride,
D) formula (X) compound is processed with carbonyl-activating base.
Term " carbonyl-activating base " refers to a compound, and the carbonyl of hydroxy-acid group is converted into and is easier to nucleophilic addition by it
The compound of reaction, such as anhydride, carboxylic acid halide, carbodiimides, halogenating agent, disulphide etc..Concrete at one
In embodiment, carbonyl-activating base is selected from halogenating agent, R (O) COC (O) R, RC (O) halogen, R ' OH, R " SH, R " SSR ";Wherein
R, R ' and R " it is independently selected from C1-C6Alkyl, alkylhalide group, heterocyclic radical, aryl and heteroaryl.
In a specific embodiment, carbonyl-activating base is N-hydroxy-succinimide.In that case, instead
Should preferably carry out under there is other carbonyl-activating base.
Therefore, in a specific embodiment, step d) comprises and is used in the situation that there is other carbonyl-activating base
Lower N hydroxyl butanimide processes formula (X) compound.
The carbonyl-activating base being suitable for this method includes carbodiimide class, such as dicyclohexylcarbodiimide (DCC) and two
Diisopropylcarbodiimide (DIC) and triazole alcohols (triazolols), such as 1-hydroxy-benzotriazole (HOBt) and 1-hydroxyl
Base-7-azepine-benzotriazole (HOAt).In a specific embodiment, formula (VI) compound is sub-at diisopropyl carbon two
React with N-hydroxy-succinamide in the presence of amine to provide the activated derivatives of formula (II).
According to another aspect, present invention is generally directed to the intermediate shown in formula (VI),
Wherein R1-R5, X, Y, W, p and PG as defined above.In one preferred embodiment, R1It is methyl, R2-R5It is
Hydrogen, X and Y is chlorine, and W is hydrogen, and p is 5 and PG to be 9H-fluorenylmethyloxycarbonyl.It is highly preferred that formula (VI) compound is compound (2)
According to another aspect, present invention is generally directed to the intermediate shown in formula (VII),
Wherein R1-R5, X, Y, W and p as defined above.In one preferred embodiment, R1It is methyl, R2-R5It is hydrogen,
X and Y is chloride, and W is hydrogen, and p is 5.It is highly preferred that formula (V) compound is compound (3)
According to another aspect, present invention is generally directed to the intermediate shown in formula (X)
Wherein R1-R5, X, Y, W, p and n as defined above.In one preferred embodiment, R1It is methyl, R2-R5It is
Hydrogen, X and Y is chloride, and W is hydrogen, and p is 5 and n to be 2.It is highly preferred that formula (VIII) compound is compound (4)
According to another aspect, present invention is generally directed to the intermediate shown in formula (II),
Wherein R1-R6, X, Y, W, p and n as defined above.
According to another aspect, present invention is generally directed to the intermediate shown in formula (III)
Wherein R1-R5, X, Y, W, p and n as defined above.In one preferred embodiment, R1It is methyl, R2-R5It is
Hydrogen, X and Y is chloride, and W is hydrogen, and p is 5 and n to be 2.It is highly preferred that formula (II) compound is compound (1)
The siRNA chain that will be connected to selective reagent is formed by progressively solid phase synthesis on a solid support,
The method of described formation edits printing in 1985 " synthesis of oligonucleotide, practical method according to M.J.Gait.IRL
(Oligonucleotide synthesis, a practical approach). method disclosed in ".
In order to put together selective ligands, oligonucleotide needs by amino derivatization.This can be carried out at 5 ' or 3 ' ends.One
Individual preferred embodiment in, selective ligands be connected to 5 ' end.
According to an embodiment, the preparation of the conjugate of formula (I) can be by by formula described above (II) or (III)
The amido modified oligonucleotide of compound and formula (XII) carries out reaction and obtains:
Use the general procedure of amino linker dressing agent activation oligonucleotide typically by below scheme:
Formula (XII) compound can be by the amido modified dose of reaction by 5 '-OH groups of oligonucleotide Yu formula (XIII)
And prepare:
Wherein m is as defined above, and PG is amine protecting group group.The blocking group being generally used for amine includes amino first
Esters of gallic acid, the such as tert-butyl group, benzyl, 2,2,2-trichloroethyl, 2-trimethylsilyl ethyl, 9H-fluorenylmethyloxycarbonyl (Fmoc),
Pi-allyl or nitrophenylcarbamate;Amide-type, such as Methanamide, acetamide, trifluoroacetamide, sulfonamide, fluoroform
Base sulfonyl amide or tert-butylsulfonyl amides;And aryl or aralkyl amine, such as p-methoxyphenyl, benzyl, right
Methoxy-benzyl, 3,4-dimethoxy-benzyl, dimethoxytrityl or monomethoxytrityl amine.In concrete enforcement
In mode, the amino linker of formula (XIII) be 6-(trifluoroacetyl amido) hexyl-[(2-cyanoethyl)-(N, N-diisopropyl)]-
Phosphoramidite (amido modified dose of-CEP of 5 '-TFA-C6-) or 6-(4-mono methoxy triphenylmethylamino) hexyl-[(2-cyanogen second
Base)-(N, N-diisopropyl)]-phosphoramidite (amido modified dose of-CEP of 5 '-MMT-C6-).
By oligonucleotide 5 '-OH group be coupled to amino linker after, amine protecting group group under the conditions of known remove.
Such as, the aminoderivative of TFA-protection can be with ammonia treatment and deprotection;And the aminoderivative of MMT-protection can use vinegar
Acid, monoxone, dichloroacetic acid or trifluoroacetic acid process and deprotection.
The general synthetic method of amido modified oligonucleotide:
I () prepares joint/dressing agent molecular solution (commercially available aminoderivative of most of business in anhydrous acetonitrile
(amidite) 0.1M solution is used) and place it in the extra groove of synthesizer (Y)
(ii) when the synthesis of required oligonucleotide sequence starts, Y base is added at 5 ' ends.This by make joint from Y-slot/
Dressing agent molecule is coupled to the end of oligonucleotide sequence.
(iii) appropriate coupling cycle is used to start synthesis.Identical coupling cycle will be used to realize joint/dressing agent
Molecule coupling.
(iv) when oligonucleotide end of synthesis, wash vehicle also finally uses gas drying carrier
V () takes off solid carrier from post, and it be transferred in screw-cap vial, and completes 2 step deprotections.
Amido modified oligonucleotide should be puted together for selective reagent further by deprotection.In order to following this
Individual purpose, all residue blocking groups on oligonucleotide are removed as follows.500 μ l are comprised 20%v/v methylamine (aqueous solution
40%w/v) mixed liquor with 80%v/v saturated ammonia solution (comprises 30-32%w/v NH3) join and (weigh containing oligonucleotide
The amount of 200nmole) Eppendorf tube in.By the seal of tube and heat 45 minutes be 65 DEG C to temperature.This process removes nucleoside
Blocking group (the 2-cyanoethylation that the acetylation of furanose or henzylate and di-phosphate ester connect) on the phosphorus atoms of acid, Yi Jihuan
The blocking group (Bz, Ac, IBu) of outer amino.Then, mixture cools down and filters, and is dried by supernatant.Residual lamellar is sunk
Thing 1M triethylamine-HF in shallow lake reacts blocking group (2 '-fert-butyidimethylsilyl that 3 hours with the 2 ' of separately nucleotide at 65 DEG C
Silicyl-TBDMS).Finally, the desalination in sephadex column of gained solution, leave amido modified-5 '-oligonucleotide.
In the case of 3 ' OH ends combine amido modified dose of joint;Should use corresponding polymer support (CPG ball) and
And synthetic schemes is carried out according to following sketch accordingly:
(ammonium hydroxide or Beckman reagent can be used to be hydrolyzed) (methylamine: ammonium hydroxide)
In both cases, deprotection steps will be identical, and conjugation methods is also identical in this case,
But there is efficiency in various degree.In most of the cases, more preferable result is reached by 5 '-amino derivatization.
In a preferred embodiment, oligonucleotide can comprise the sequence selected from SEQ ID NO:5 to 12.
Then, the oligonucleotide of amino-reactive derives with the activation of formula defined above (II) or (III) selective reagent
Thing reacts.Obtain and there is the conjugate of following structure:
Wherein R1-R5, X, Y, W, p and n be as defined above, and m is 2-10.
In one preferred embodiment, conjugate has a following structure:
In a particular embodiment, oligonucleotide is first to react with bivalence or three valent phosphors amide.In this manner it is possible to achieve
Compound with 2 or 3 coupling positions, in order to 2 or 3 selective reagent molecules can be coupled to oligonucleotide.Described 2
Individual or 3 selective reagents can be similar or different.
In a particular embodiment, 2 or 3 identical selective reagent molecules are coupled to oligonucleotide.Separately
In one embodiment, 2 or 3 different selective reagents are coupled to oligonucleotide.
In embodiments, oligonucleotide and bivalence or trivalent phosphoramidite react production (XX) or (XXI) compound:
Wherein
PG, PG " and PG " ' it is independently selected from H and hydroxy-protective group;
R, r ', r ", s, s ', s ", t and u be independently selected from 0,1,2,3,4,5,6,7,8,9,10,11,12 and 13;
V is independently selected from 0 and 1;And
X 1 、X 2 And X 3 It is independently selected from CH2, O, S, NH, CO, C (O) O and C (O) NH.
Hydroxy-protective group, and suitably protection and deprotection condition, be known to the skilled person, such as " organic
Blocking group in chemistry " (Protecting Groups in Organic Synthesis) (Wuts, P.G.M.and
Greene T.W., fourth edition .Wiley-Interscience) and " blocking group " (Protecting Groups)
In (Kocienski P.J., third edition .Georg Thieme Verlag).
In a specific embodiment, hydroxy-protective group is selected from ethers, silicyl ethers, esters, sulfonic acid esters, secondary sulphur
Esters of gallic acid, sulfinic acid esters, carbonates and carbamates.In preferred embodiment, hydroxy-protective group is
Selected from acetyl group, benzoyl, benzyl, methoxyl group ethoxymethyl ether (MEM), dimethoxytrityl (DMT), methoxy methyl
Base ether (MOM), Methoxytrityl (MMT), p-methoxy-benzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), four
Hydrogenation pyranose (THP), trityl (Tr), 9H-fluorenes methoxy carbonyl (Fmoc), trimethyl silyl (TMS), tert-butyl group diformazan
Base silicyl (TBDMS), t-butyldimethylsilyloxy ylmethyl (TOM) and triisopropylsilyl (TIPS) ether.
Preferably, PG, PG ' and PG " it is independently selected from H, DMT and Fmoc.
In a particular embodiment, the hydroxy-protective group in formula (XX) or (XXI) compound is different, so it
Can optionally deprotection and coupling if desired, can carry out with different molecules.
One specific embodiment is directed to formula (XX) compound, and wherein r and r ' is 4, s and s ' is 1, t and v is 0, X1
And X2Represent C (O) NH and PG1And PG2It is independently selected from H, DMT and Fmoc.Another embodiment relates to formula (XX) chemical combination
Thing, wherein r is 2, r ' it is 0, s is 1, s ' it is 0, t and v is 0, X1And X2Represent CH2And PG1And PG2Be independently selected from H and
DMT。
One embodiment is directed to formula (XXI) compound, wherein r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and v is
0, X1、X2And X3Represent O and PG1、PG2And PG3It is independently selected from H and DMT.Another embodiment relates to formula (XXI) and changes
Compound, wherein r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1, X1、X2And X3Represent O and PG1、PG2And PG3
It is independently selected from H and DMT.
Then, formula (XX) and (XXI) compound are by deprotection, if necessary, and amido modified with formula (XIII)
Agent is reacted:
Wherein m and PG is as defined above and obtain formula (XXII) or (XXIII) compound respectively:
Wherein
m、m’、m”、r、r’、r”、s、s’、s”、t、u、v、X1、X2And X3It is as previously defined.
Formula (XXII) and (XXIII) compound can react with formula (II) compound further, preferred with
Formula (III) compound reacts, and generates conjugate (XXIV) and (XXV) respectively:
Wherein
m、m’、m”、n、n’、n”、p、p’、p”、r、r’、r”、s、s’、s”、t、u、v、X1、X2、X3、R1-R5, W, X, Y and Z be
As described earlier.