CN103025357B

CN103025357B - Selectively deliver compositions and the method for the most specific neural metaclass of oligonucleotide molecules

Info

Publication number: CN103025357B
Application number: CN201180031362.1A
Authority: CN
Inventors: A·P·蒙特费尔特罗; G·阿尔瓦拉多·乌尔维纳; A·博尔托洛齐·比亚索尼; F·阿蒂加斯·法勒斯; M·维拉·博韦尔
Original assignee: Nlife Therapeutics SL
Current assignee: Nlife Therapeutics SL
Priority date: 2010-04-19
Filing date: 2011-04-19
Publication date: 2016-12-14
Anticipated expiration: 2031-04-19

Abstract

The present invention provides a kind of conjugate, it comprises (i) nucleic acid, its and its expression inhibiting complementary with target nucleic acid sequence or expression of minimizing target nucleic acids, and (ii) selective reagent, it can be bound to neurotransmitter transporters high-affinity.Conjugate of the present invention can be used for delivery of nucleic acids to cell interested, and thus be accordingly used in treatment disease, and it needs to lower the albumen encoded by target nucleic acids, and for developer being delivered to the diagnostic purpose of cell.

Description

Selectively deliver compositions and the method for the most specific neural metaclass of oligonucleotide molecules

Invention field

The present invention relates to conjugate, it comprises the nucleic acid special to target interested and group, and described group is to pass through Its to the mode of the affinity of the neurotransmitter transporters of described cell surface by specific in delivery of nucleic acids to central nervous system The group of cell.

Background technology

It is effective that the use of nucleic acid is proved the change of cell state.DNA (deoxyribonucleic acid) (DNA) or ribonucleic acid (RNA) expression that may be used for raising or lower the specific gene in cell it is incorporated in cell, thus, affect one or more Biochemical pathway.In the technology based on nucleic acid for changing cytophysiology, RNA interference (RNAi) is to multiple biological transfer The general name of gene expression is regulated and controled in level after record.RNAi gene silencing can come by homology short (21-23bp) dsRNA fragment Becoming, the latter is referred to as short interfering rna or " siRNA ".After long dsRNA is introduced into cell line, cellular enzymes Dicer is cut Become short interfering rna (siRNA) molecule.This short interfering rna molecule is now referred to as guide RNA.Guiding RNA-is lured by guide RNA Lead-silencing complex (RISC) to homology targets mRNA.Once it forms the hybrid structure of homologous mRNA sequence, and RISC will cut mRNA.As a result, the protein of mRNA coding will no longer be generated, thus cause gene silencing.RNA interference refers in animal by short dry Disturb the process of the sequence-specific PTGS that RNA (siRNA) mediates.But, develop encephalopathy based on RNAi reason and control The major obstacle for the treatment of approach is blood brain barrier (BBB).Nicergoline is crossed the existence of two kinds of barrier systems and is protected from potential poison Property material injury: blood brain barrier (BBB) and blood cerebrospinal fluid barrier (BCSFB).BBB is considered as the main of absorption serum part Approach, because the surface area of its surface area ratio BCSFB is larger about 5000 times.Composition BBB brain endothelium, be demonstrated by utilize for The major obstacle of the potential drug of the various disease conditions of CNS.As fundamental rule, the least lipophilic molecule can pass through BBB, i.e. From the blood of blood circulation to brain.There are a lot of medicines of more large scale or more high hydrophobicity in zooscopy to treatment CNS Disorder demonstrates result likely.

Except being administered in direct brain, it has been described that different strategies is to realize CNS by Formulations for systemic administration rnai molecule In gene silencing.Such as, Ku Maer (Kumar) et al. (natural, 2007, volume 448: the 39-44 page) (Nature, 2007,448:39-44) conjugate of the peptide having been described with siRNA and be derived from rabies virus glycoprotein, comprises nine poly-essence ammonia The ability that after acid, and they intravenous injections, silent gene is expressed in brain.Summer (Xia) et al. (study of pharmacy, 2007, the Volume 24: the 2309-2316 page) (Pharmaceutical Research, 2007,24:2309-2316) has been described with comprising The conjugate of biotinylated siRNA and the conjugate comprising avidin-anti-Transferrin Receptor Antibody, it can After systemic delivery, in central nervous system, silent gene is expressed.WO200979790 describes and comprises siRNA and be generically and collectively referred to as The conjugate of a series of peptides of Angiopeps, it can be by receptor-mediated transcytosis (transcytosis) with low Density lipoprotein receptor related protein-1 (LRP-1) comes through blood brain barrier, and it allows described for comprising of Formulations for systemic administration The conjugate of peptide is delivered to CNS.WO2007107789 describes the purposes of the compound that RNA can be caused to disturb, and it is in CNS The target existed is specific, and by utilizing intranasal administration to be delivered to CNS.

But, although all these systems all allow the siRNA of Formulations for systemic administration is delivered to CNS, and they do not allow to deliver Particular cell types to brain.It is true that the drug-supplying system the most not described can allow to be delivered to therapeutic agent Particular cell types in CNS.Delivery has the probability of the known specific siRNA to central nervous system will be to treatment The disease caused by the unexpected activity/expression of given gene is very useful, including depression, awareness obstacle, parkinson disease, A Er Ci Haimo is sick, etc..Depression is considered as the disease of central nervous system.Depression is biology and genetic allos barrier simultaneously Hinder, and have and show psychology, behavior and the symptom of physiological level.Send out it addition, depression shows with being total to of anxiety disorder height Property, anxiety self (being typically expected property anxiety) is one of the most popular symptom in depressive patient.It practice, most of anxieties barrier Hinder and also treat with antidepressant drug.

It is initially used for treating tricyclic antidepressant (TCA) and the monoamine oxidation that main depressed medicine is imipramine type Enzyme inhibitor (MAOI).These drug discoveries for late period and are proved to be effective in nineteen fifty, however they show multiple sternly The side effect of weight, this causes researching and developing new medicine, such as selective serotonin reuptake inhibitor (SSRI) or selectivity 5- Hydroxytryptamine and NRI (SNRI).

TCA class (with more late SSRI and SNRI) suppression reuptake monoamine 5-hydroxy tryptamine (5-HT) and norepinephrine (NA) presynaptic cell is entered, the level of 5-HT in increase synaptic space, thus strengthen its activity on postsynaptic receptor, this Plant and find to cause the etiologic of depression to assume initially that, i.e. it is by the deficiency of these monoaminergic nerve neurotransmitter systems activity in brain And cause.From that time, the antidepressant drug on all markets all targets 5-hydroxy tryptamine energy and/or norepinephrine energy turns Fortune body or receptor.

5-HT receptor is positioned in animal on the cell membrane of neurocyte and other cell type.Except 5-HT₃Receptor, all Other 5-HT receptor is all seven-transmembrane (or the seven spirals) receptor of G-protein coupling, second message,second messenger's cascade in its active cell.Some The 5-HT receptor differentiated includes 5-HT_1AAnd 5-HT_1B/1DReceptor, it is expressed in the presynaptic and (certainly experiences at 5-hydroxy tryptamine neuron Body) and synapse after be positioned 5-HT teleneuron.The 5-HT receptor being more directly connected with the antidepressant effect of SSRI is 5-HT_1AReceptor.

New antidepressant drug has been registered, and its mechanism of action is norepinephrine based on relative selectivity Reuptake suppression (NARI), such as reboxetine, or at double blocking (SNRI), such as venlafaxine or duloxetine.Other Medicine, such as nefazodone, Desyrel or Remeron have more weak activity and block monoamine energy on the contrary monoamine transporter Receptor.

But, although the commercial success of SSRI, these compounds have two main restrictions: 1) patient's table of only 60% Reveal therapeutic response (being reduced to the half of baseline seriousness), and 2) response only generation after the treatment continuously of several weeks.This It it is the negative feedback mechanism owing to occurring in presynaptic neuron.In brief, the height blocking induction of serotonin reuptake transporter 5-hydroxy tryptamine level will not only activate postsynaptic 5-hydroxytryptamine receptor, also activate presynaptic autoreceptor, and it is as cell Feedback transducer.The 5-HT that 5-HT causes_1AAutoreceptor activation (also referred to as presynaptic 5-HT_1AReceptor or presynaptic 5-HT_1AR), Or selective agonist, suppression cell discharge and stimulation dependency 5-HT release, otherwise 5-HT_1BReceptor controls in terminal horizontal 5-HT synthesis and release.5-HT_1AAnd 5-HT_1BBoth receptors also are located on 5-HT teleneuron postsynaptic neuron, mainly at skin Matter marginal zone.The reuptake of Sertraline (SERT, a kind of SSRI) blocks the increase of the extracellular 5-HT produced and has activated in midbrain Presynaptic 5-HT receptor in nuclei of raphe, suppression cell discharge and end release, this effect weakens reuptake and blocks the thin of generation The outer 5-HT of born of the same parents increases.5-HT_1BAutoreceptor is applied with similar negative feedback in own level.After repeat administration SSRI, 5- HT_1AAutoreceptor desensitizes, and it makes to produce 5-hydroxy tryptamine neuron and can recover cell discharge and cause the increase of extracellular 5-HT, The higher level can seen after single therapy.The neuro physiology of these (slowly carrying out) cerebral tissue adapt to be not only into The continuous SSRI in what usual multiple week use be antidepressant effect required reason occurs completely, be also why to increase The anxiety added is the reason of the common adverse effect in initial several days of use or week.These 5-HT known_1AAnd/or 5-HT_1BReceptor The blocking-up of the negative feedback mechanism of antagonist strengthens the 5-HT increase that SSRI produces, it is thus possible to cause the clinical effectiveness of SSRI Acceleration.

Accelerate during SSRI is administered by blocking presynaptic 5-HT_1AThe pharmacology of the antidepressant response that the activity of receptor causes Strategy with (±) pindolol tests.This compound is β_1-2Adrenergic aceptor antagonist and have presumption to 5-HT_1A The antagonistic activity of receptor.(±), pindolol antagonism was by maincenter 5-HT_1AThe multiple effect of the activity mediation of receptor, such as hypothermia Or hormone secretion.Generally, pindolol addition SSRI accelerates antidepressant response.But, although pindolol is at some Research shows under clinical dosage, in human brain, partly takes up 5-HT_1AReceptor, other research is found that low taking.It addition, 5-HT can not have been forgotten_1AReceptor is positioned at the postsynaptic neuron of serotoninergic neuron and serotoninergic neuron.It is true that One important relationship be these reagent to the presynaptic relative to postsynaptic 5-HT_1AThe selective disappearance of receptor: postsynaptic receptor Completely block may cancel by forebrain antidepressant drug produce 5-HT_1AThe transmission of the increase of receptor.

Therefore, although exploitation antidepressants have been in progress, it is still desirable to specific effect is in presynaptic 5-HT_1AReceptor can The compound selected.Parkinson disease (PD) are central nervous system's degenerating disorders, and it generally weakens the motor skill of patient, says Words, and other function (Oran promise (Olanow)).Parkinsonian symptom is by the dopaminergic cell of black substance dense area (SNpc) Activity is greatly lowered and causes (Oran promise, road gloomy (Olanow, Dawson)).These neuron projections are to striatum, and it loses Cause the change of the activity of neural circuit in the ganglion basal of regulation motion, be substantially direct path suppression with connect Exciting of road.Direct path promotes motion, and indirect pathway suppression is moved, thus the loss of these cells causes motor function to decline The movement disorder moved back.The shortage of dopamine causes the suppression of nucleus ventralis anterior thalami to increase, and it sends the irritability projection of encoding characteristics To motor cortex, thus motor function is caused to fail.

The feature of PD is the intracellular of the Progressive symmetric erythrokeratodermia loss of the dopaminergic neuron in SNpc and referred to as Louis body (LB) The existence of inclusion body.On neuro chemistry, PD is labeled as mitochondrial complex I dysfunction and the increase of oxidative stress index.Number Kind of PD pathogeny has been suggested, including oxidation and nitrification stress, mitochondria dysfunction, protein misfolding and gathering, And apoptosis.PD is typically accidental, but some PD cases have shown that it is familial.First family differentiated The PD gene of property is alpha-synapse nucleoprotein (α-syn), and it is in fact the key component of LB in all PD patients.Alpha-synapse core egg White conventional func is still not clear.Alpha-synapse nucleoprotein can be connected to lipid, and in neuron likely via Lipid Rafts with Presynaptic vesicle and plasma membrane are connected.The pathotype of the deposition of alpha-synapse nucleoprotein is by coagulation and shows lower than normal albumen molten Xie Xing.Have been described with three point mutation and cause familial PD, but also report the diploid of SNCA gene and triploid is PD Reason with Lewy body disease.Thus, even if not having series jump, alpha-synapse nucleoprotein dosage can also be Lewy body disease Reason.

Alpha-synapse nucleoprotein affects mitochondrion possible inducing cell apoptosis.It practice, there are many parts of evidences to indicate α-prominent Touch being closely connected between nucleoprotein and oxidative damage: the process LAN of the alpha-synapse nucleoprotein of sudden change makes neuron to oxidative stress The damage sensitization caused with dopamine and composite I inhibitor, causes in vitro and in vivo albumen carbon carbonylation and lipid peroxidation Increase.In turn, the dysfunction of mitochondrial complex I is relevant to the accidental form of PD.Composite I dependency oxidative damage It is neuron regression and the main cause of cell death in PD with the mitochondrial function of defect.Thus the mitochondrial function weakened and ROS produces cytochrome c storehouse (pool) level adding mitochondrial inner membrane space, when cell death agonist Bax is activated Time so that it is quickly discharge.Sum it up, the situation that the ROS that the situation of PD is neuron mitochondria dysfunction and increase produces, On the one hand alpha-synuclein aggregation will be increased, the cell death on the other hand activated b ax mediated.Further, alpha-synapse core Protein aggregation thus will increase cell ROS produce and Induction of neuronal degenerate.Most widely used PD treatment is various forms of L-DOPA.But, the L-DOPA of only 1-5% enters dopaminergic neuron.Remaining L-DOPA metabolism the most elsewhere is Dopamine, causes multiple side effect.Dopa decarboxylase inhibitor is also used for treating PD as carbidopa and benserazide, because they Contribute to preventing the metabolism of L-DOPA, arrive before dopaminergic neuron at it, and usually used as carbidopa/left-handed many Bar and the combination preparation of benserazide/levodopa.It addition, dopamine agonist appropriateness is effectively and by stimulating some dopamine to be subject to Body and act on.But, they cause dopamine receptor to become the most insensitive, thus finally increase symptom.

Antisense approach is likely to useful, and has been reported in rat and mouse brain and works.This approach based on this idea, I.e. alpha-synapse nucleoprotein is to be unnecessary for mankind's CNS function really, though because its display in mice but perhaps albumen water Flat appropriateness reduction also be enough to reduce PD process.

But, although the progress made in research and development PD therapy, it is still desirable to black substance dense area can be prevented by specificity The selectable compound that the activity of dopaminergic cell reduces.

Middle cortex and middle limbic brain dopamine (DA) system are played the part of in including schizoid multiple mental sickness Pivotal player.Schizophrenia midbrain dopaminergic nerve transmission conventional strengthen by proposed by Pharmacological Evidence (Xi Man and Lee, 1975；In gram this et al., 1976) (Seeman andLee, 1975；Creese et al, 1976).But, recently Summary show the middle cortex that the hyperactive of the transmission of DA under cortex and vigor go down.Traditional (DA D2 receptor antagonist Agent) and atypical psychosis (APD, preferably 5-HT_2A/2CTo DA D2 receptor antagonist) positive (psychosis) symptom for the treatment of General effect be similar.On the contrary, some reagent in group later, especially clozapine, to treatment negative symptoms and cognition Damage is an advantage over traditional antipsychotics.The energy that this Clinical symptoms at least partly discharges with the DA increased in midbrain cortical pathway Power is correlated with, and this is by the effect of atypical-rather than tradition-psychosis induction.It practice, optimal prefrontal lobe DA merit Can to working memory and perform function it is critical that.

DA release in middle cortex and middle limbic brain DA path is regulated by the multiple factor.First, it depends on VTA DA The discharge mode (catatonic type/phase type) of neuron.Secondly, it is tight by the activity of cytodendrite and end D2/3 autoreceptor Regulation, autoreceptor therein controls cell discharge and DA release.Finally, the reuptake that DA transporter (DAT) mediates determines that One of dynamic (dynamical) key mechanism of decline of extracellular DA concentration.Research before shows DAT and the stricture of vagina of different densities in PFC Shape body.

Remove between the Naokong of extracellular it addition, norepinephrine (NA) aixs cylinder potentially contributes to DA, because NA transporter (NAT) affinity similar to NA with DA is shown.Thus, NAT inhibitor in middle PFC (mPFC), compared to caudatum and Nucleus accumbens septi (NAc), preferential increase extracellular DA concentration.Thus, the NA aixs cylinder from nucleus ceruleus (LC) neuron potentially contributes to Extracellular DA concentration in regulation PFC, by absorbing or discharging DA altogether.Some researcheres have illustrated based on NA-target medicine The Combination nova treatment of thing (NAT inhibitor adds α 2-epinephrine antagonist) is to the effect of cortex DA transmission in Selective long-range DEPT.

It remains desirable, however, that the compound of cortex DA transmission in can strengthening.

Summary of the invention

The present inventor researched and developed comprise to press down to the selectivity of the special nucleic acid of target gene and neurotransmitter transporters The nucleic acid construct of preparation.These constructs demonstrate delivering nucleic acid interested to the cell expressing neurotransmitter transporters Inside is especially useful in.It is not intended to be bound by any theory, it is believed that the inhibitor of neurotransmitter transporters will be at table Combining corresponding neurotransmitter transporters on the surface of the cell reaching transporter, it shifts composite nucleic acid-inhibitor in turn and arrives The inside of cell.Therefore, as described by embodiments of the invention 3, comprise 5-hydroxy tryptamine 5-HT_1AReceptor-specific The construct of siRNA and specificity 5-hydroxy tryptamine-transporter inhibitors (Sertraline) causes 5-HT_1AThe minimizing of receptor mrna and sound The hypothermia answering 8-OH-DPAT responds the shortage of (measurement of 5-hydroxy tryptamine source property signal), and it obtains than from unconjugated siRNA Obtain is much higher.

It will be appreciated by those skilled in the art that the present invention is not restricted to puting together for delivery to serotoninergic neuron Thing.On the contrary, the result that the present invention provides illustrates: neuron be used for transporting the mechanism of neurotransmitter be suitable means for Promote the small molecular cell being delivered to be attached on the molecule to described neurotransmitter transporters display affinity.

Therefore, in first aspect, the present invention relates to conjugate, it comprises:

I) at least one selective reagent, its specific binding to one or more neurotransmitter transporters, and

Ii) at least one nucleic acid, it can be specific binding to target molecule, and wherein said target molecule is turning with neurotransmitter Fortune body same cell is expressed.

In a second aspect, the present invention relates to the conjugate of the present invention in medicine.

In further, the present invention relates to conjugate of the present invention, wherein

(i) selective reagent, it is selected from selective serotonin reuptake inhibitor (SSRI), and

(ii) oligonucleotide, it can be specific binding to target molecules, and described target molecules is selected from coding 5-hydroxy tryptamine Receptor 1A type (5-HT_1A) mRNA or coding 5-hydroxy tryptamine transporter (5-HHT transporter or SERT) mRNA or coding 5-hydroxytryptamine receptor 1B type (5-HT_1B) mRNA or coding TREK-1 potassium channel or the mRNA of Gir-K potassium channel.

For the disease that treatment or prevention of depression are relevant.

In further, the present invention relates to the conjugate of the present invention, wherein

I () selective reagent is selected from dopamine reuptake inhibitor (DRI) or norepinephrine-dopamine reuptake Inhibitor (NDRI) or 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor (SNDRI or three times-blocker), With

(ii) oligonucleotide can be specific binding to target molecules, and wherein target molecules is coding alpha-synapse nucleoprotein MRNA, deposits relevant disease for treatment or prevention to neurotransmitter vesicle function damage and Louis body.In further side In face, the present invention relates to the conjugate of the present invention, wherein

I () selective reagent presses down selected from dopamine reuptake inhibitor (DRI) or norepinephrine-dopamine reuptake Preparation (NDRI) or 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor (SNDRI or three times-blocker), and

(ii) oligonucleotide can specifically be bound to target molecules, and wherein target molecules is the mRNA of coding BAX

For disease (that is, parkinson disease and the A Er that treatment or prevention are relevant to neuronal apoptosis and cell death Ci Haimo is sick).

I () selective reagent is selected from NRI (NRI), and

(ii) oligonucleotide can specifically be bound to target molecules, and wherein target molecules is coding dopamine β hydroxylation The mRNA or the mRNA of coding norepinephrine transporter (NET) dopamine β-hydroxylase polypeptide of enzyme

For treating or preventing the disease that the dopamine deficiency in norepinephrine energy projection is relevant, as with dull-witted, press down The strongly fragrant memory relevant with neurodegenerative disease and cognitive process.

I () selective reagent is selected from NRI (NRI), and

(ii) oligonucleotide can specifically be bound to target molecules, and wherein target molecules is coding norepinephrine Transporter (NET) or the mRNA of norepinephrine transporter (NET) polypeptide

I () selective reagent presses down selected from dopamine reuptake inhibitor (DRI) or norepinephrine-dopamine reuptake Preparation (NDRI) or the group of 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor (SNDRI or three times-blocker), With

(ii) oligonucleotide can specifically be bound to target molecules, and wherein target molecules is the mRNA of coding Tau, uses In the disease that treatment or prevention are relevant to the neural degeneration that the sudden change on Protein tau causes, as Alzheimer.

(ii) oligonucleotide can specifically be bound to target molecules, and wherein target molecules is encoding huntingtin MRNA, the neural degeneration disease produced by the expression of the change (gene internal duplication) of Huntington protein for treatment or prevention Sick.

I () selective reagent is selected from NRI (NRI), and

(ii) oligonucleotide can specifically be bound to target molecules, and wherein target molecules is coding dopamine β hydroxylation The mRNA or the mRNA of coding norepinephrine transporter (NET) of enzyme

In another aspect, the present invention relates to conjugate, comprise

(i) at least one selective reagent, on its specific binding to one or more neurotransmitter transporters, and

(ii) contrast agent or labelled reagent.

Yet another aspect, the conjugate of the contrast agent that the present invention relates to comprise labelled reagent is used as diagnostic reagent.

These and other purposes of the present invention will be further described through in detailed description below part, and they not purports Limiting the present invention.Except as otherwise noted, all technology used herein and scientific terminology all have and those skilled in the art The equivalent being generally understood that.The practice of the present invention is may be used for similar or equivalent to the method for those described herein and material In.Run through entire disclosure and claims, word " comprise " and change be not intended to get rid of other technologies feature, additive, Component, or step.

Accompanying drawing explanation

Fig. 1. accept local 5-HT_1AR-targeting-siRNA (naked or put together) is little to dorsal raphe nucleus (DRN) (R) in Mus-(+)-8-hydroxyl-2-(two-n-propylamine) tetrahydronaphthalene hydrobromate (8-OH-DPAT, selectivity 5-HT_1AR is exciting Agent) induce hypothermia response do not exist, as 5-HT_1AThe example of the functional measure of R presynaptic activity.Mice accepts: I) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-siRNA), iv) naked 5-HT_1AR- SiRNA or v) 5-HT_1AR-NLF-siRNA (0.3 μ g/1 μ l/2 days to DRN).5-HT_1AR knocks out (5-HT_1AR-KO) its of mice Its group have also been made evaluation.Body temperature is administered before (1mg/kg lumbar injection) 5 minutes and 15,30,60 He afterwards at 8-OH-DPAT Within 120 minutes, it is estimated.Data are shown as the SEM of 5-7 mice of the meansigma methods of Temperature changing ± often organize.* p ＜ 0.01 is respectively With carrier, there were significant differences for ns naked siRNA and ns NLF-siRNA, utilizes repeated measure ANOVA (variance analysis), in tested The factor of variable and processing between the time, (Newman-Ke Yiersi examines to carry out multiple comparisons Newman-Keuls inspection subsequently Test).

Fig. 2 .5-HT_1AR-targeting-siRNA (naked or put together) is locally implanted to dorsal raphe nucleus (DRN) and induces 5- HT_1AThe specific downregulation of R protein level.Mice accepts: i) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-siRNA), iv) naked 5-HT_1AR-siRNA or v) 5-HT_1AR-NLF-siRNA (0.3 μ g/1 μ l/2 days To DRN).It is bound to 5-HT in figure post display mice DRN_1AR [³H] photodensitometric quantitation of-8-OH-DPAT, it is expressed as 5- HT_1AMeansigma methods ± SEM (2 observations of the 3AP level of the dorsal raphe nucleus of every animal, the often group of Rfmol/mg histone 4-5 animal).* p ＜ 0.05, * * p ＜ 0.01, with carrier, there were significant differences for ns naked siRNA and ns NLF-siRNA, utilizes single Factor ANOVA, carries out Newman-Keuls post hoc subsequently and checks (Newman-Ke Yiersi post-hoc tests).

Fig. 3. Intraventricular (i.c.v) is administered the 5-HT puted together_1AThe selectivity 5-HT that R-NLF-siRNA causes_1AAutoreceptor Reticent.A) 5-HT in rapheal nuclei_1AThe expression of R is assessed by situ hybridization.Mice acceptance is single is administered to dorsal part ventriculus tertius (D3V): i) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-siRNA), iv) Naked 5-HT_1AR-siRNA or v) 5-HT_1AR-NLF-siRNA (30 μ g/2.5 μ l/1 days).A1-a555 shows before 3 different Afterwards at (AP) coordinate, with³³The coronal section of the mice rapheal nuclei that the oligonucleotide of P-labelling combines is in terms of mm: from bregma- 4.84/-4.96 ,-4.36/-4.60 and-4.24/-4.36 (kiss tail is from left to right).Scale, 2mm.B) aobvious in a111-a555 The magnification at high multiple of the part shown.Scale, 500 μm.C) post figure shows 5-HT_1AIn the dorsal raphe nucleus of R-NLF-siRNA induction 5-HT_1AThe reduction of R mRNA level in-site.The 5-HT measured on film_1AThe photodensitometric quantitation of R mRNA positive particle is shown as average Optical density (OD) percentages ± SEM (n=4-5 mice often group and 2-4 sight of the 3AP level at dorsal raphe nucleus Examine).* p ＜ 0.01 and carrier, ns NLF-siRNA and naked 5-HT_1AThere were significant differences for R-siRNA, utilize single factor test ANOVA with Rear Newman-Keuls post hoc checks.

Fig. 4 .5-HT_1AR-NLF-siRNA induces presynaptic 5-HT_1AThe specific downregulation of R, and not at postsynaptic sites.The back of the body Seam nucleus (A), prefrontal cortex (B) and the 5-HT of hippocampus (C)_1AR protein level is combined with by autoradiography³ [H]-8-OH-DPAT assesses.Mice accepts the single dorsal part ventriculus tertius (D3V) of being administered to: i) carrier, ii) nonsense is naked SiRNA (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-siRNA), iv) naked 5-HT_1AR-siRNA or v) 5- HT_1AR-NLF-siRNA (30 μ g/2.5 μ l/1 days).Figure post represents 5-HT_1AThe meansigma methods of R fmol/mg histone ± SEM (n =4-5 mice often group and in 2 times of 3AP level observations of dorsal raphe nucleus with in prefrontal cortex and the left and right of hippocampus 2 observations in site).* there were significant differences for p ＜ 0.05 and other process all, utilizes single factor test ANOVA to be followed by Newman- Keuls post hoc checks.

Fig. 5 .5-hydroxytryptamine-5-HT transporter (5-HTT) and 5-HT_1BReceptor (5-HT_1BR) in the combination of dorsal raphe nucleus Level is not by 5-HT_1AR-siRNA processes and is changed.A) the 5-HTT protein level in dorsal raphe nucleus is tied by autoradiography Close and utilize³[H]-citalopram is evaluated.B) 5-HT in dorsal raphe nucleus_1BR protein level combines profit by autoradiography With¹²⁵[I] cyanoindole Luo Er blocks beta-adrenaline site in the presence of isoproterenol and evaluates.Mice accepts single One is administered to dorsal part ventriculus tertius

(D3V): i) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF- SiRNA), iv) naked 5-HT_1AR-siRNA or v) 5-HT_1AR-NLF-siRNA (30 μ g/2.5 μ l/1 days).Block diagram shows: A) 5- HTT fmol/mg histone meansigma methods ± SEM and B) (n=4 mice is every for average optical (OD) percentages ± SEM Group and in 2 times of 3AP level observations of dorsal raphe nucleus).

Fig. 6. (R)-(+)-8-hydroxyl-2-(two-n-propylamine) tetrahydronaphthalene hydrobromate (8-OH-DPAT, selectivity 5- HT_1AR agonist) hypothermia induced responds as presynaptic 5-HT_1AThe functional measure of R activity.Mice accepts single giving Medicine is to dorsal part ventriculus tertius (D3V): i) carrier, ii) the naked siRNA of nonsense (the naked siRNA of ns), iii) nonsense NLF-siRNA (ns NLF-siRNA), iv) naked 5-HT_1AR-siRNA or v) 5-HT_1AR-NLF-siRNA (30 μ g/2.5 μ l/1 days).Also have rated it The 5-HT of its group_1AR knocks out (5-HT_1AR-KO) mice.Body temperature is administered (1mg/kg lumbar injection) 5 minutes before at 8-OH-DPAT Or evaluate for 15,30,60 and 120 minutes afterwards.Note at the 5-HT puted together_1AR-NLF-siRNA and 5-HT_1A8-in R-KO mice The impact of body temperature is not existed by OH-DPAT.Numerical value is shown as the meansigma methods ± from often organizing 7-10 mice that body temperature changes SEM.* p ＜ 0.01 respectively with carrier, the naked siRNA of ns, ns NLF-siRNA and naked 5-HT_1AThere were significant differences for R-siRNA, utilizes Repeated measure ANOVA, in the factor of tested internal variable and processes between the time, is finally multiple comparisons Newman-Keuls Inspection.

Fig. 7. (R)-(+)-8-hydroxyl-2-(two-n-propylamine) tetrahydronaphthalene hydrobromate (8-OH-DPAT, 0.5mg/kg abdomen Chamber is injected) Formulations for systemic administration is on the impact of dialysis solution 5-HT level in prefrontal cortex in mice (mPFC).Each group mice is: i) carry Body, ii) nonsense NLF-siRNA (ns NLF-siRNA), iii) 5-HT_1ANLF-siRNA (the 5-HT of R-targeting_1AR-NLF- SiRNA) and iv) 5-HT_1AR knock-out mice (5-HT_1AR-KO).Mice was injected carrier or siRNA in l/1 days with 30 μ g/2.5 μ, Intracerebral ventricle injection, Microdialysis Experiments is carried out after injecting 24-48 hour.Notice at 5-HT_1AMediation 5-under autoreceptor HT_1AIn the mPFC of R-KO mice, the impact of the 8-OH-DPAT 5-HT level on reducing does not exists.Data representation is the hundred of baseline Proportion by subtraction is also shown as meansigma methods ± SEM (n=5-9 mice/group).* p ＜ 0.01 is notable with carrier and ns NLF-siRNA group Difference, utilizes repeated measure ANOVA, in the factor of tested internal variable and processes between the time, last multiple comparisons Newman-Keuls checks.Fig. 8. Sertraline (selective depressant of 5-hydroxy tryptamine transporter-5-HTT) is to the 5-puted together HT_1AR-NLF-siRNA is delivered to the impact of 5-HT neuron.A) acute Sertraline injection (mg/kg lumbar injection) avoids 5- HT_1AAutoreceptor is by the 5-HT puted together_1AThe silence of R-NLF-siRNA, and acute 8-OHDPAT is administered (selectivity 5-HT_1AR Agonist, 0.5mg/kg lumbar injection) reduce the 5-HT level in middle prefrontal cortex.Each group mice is: i) carrier, ii) nothing Justice NLF-siRNA (ns NLF-siRNA), iii) 5-HT_1ANLF-siRNA (the 5-HT of R-targeting_1AR-NLF-siRNA) and iv) 5-HT_1AR knocks out (5-HT_1AR-KO).Mice is little inject siRNA entrance D3V (30 μ g/2.5 μ l/1 days, intracerebral ventricle injection) 3 Selectivity 5-HTT inhibitor, the acute injection of Sertraline (20mg/kg lumbar injection) was accepted time before.It addition, one group of mice connects D3V is entered by carrier lumbar injection and carrier.Microdialysis is carried out real after intracerebral ventricle injection carrier or siRNA are administered 24 hours Test.Data representation is the percentage ratio of baseline and is shown as meansigma methods ± SEM (n=5-8 mice/group).* * p ＜ 0.001 is with right According to and 5-HT_1AThere were significant differences for R-NLF-siRNA group, utilizes single factor test ANOVA, followed by multiple comparisons Newman-Keuls to examine Test.B) selectivity 5-HTT inhibitor is used in advance, in the NLF-siRNA mice that Sertraline (20mg/kg lumbar injection) processes, 8-OH-DPAT is administered (1mg/kg lumbar injection) impact on body temperature.Mice group is similar in figure A.Unlike 5-HT_1AR-NLF- SiRNA group, at the 5-HT of Sertraline pretreatment_1AIn R-NLF-siRNA mice, 8-OH-DPAT is administered and creates hypothermia sound Should.Numerical value is shown as meansigma methods that body temperature changes ± from the SEM often organizing 6-10 mice.* * p ＜ 0.001 utilizes dual factors ANOVA followed by multiple comparisons Newman-Keuls checks.

Fig. 9. acute fluoxetine (selective depressant of 5-hydroxy tryptamine transporter-5-HTT, 20mg/kg lumbar injection) is given Medicine is on the impact of dialysis solution 5-HT level in prefrontal cortex in mice (mPFC).Each group mice is: i) carrier, ii) nonsense NLF- SiRNA (ns NLF-siRNA), iii) 5-HT_1ANLF-siRNA (the 5-HT of R-targeting_1AR-NLF-siRNA) and iv) 5-HT_1AR Knock out (5-HT_1AR-KO).Mice being injected carrier or siRNA, intracerebral ventricle injection in l/1 days with 30 μ g/2.5 μ, Microdialysis Experiments exists Carry out after injecting 24-48 hour.Notice that chlorine Xi Ting is to 5-HT_1AThe 5-HT level that autoreceptor is lowered in the mPFC of mice has Reinforced effects, is similar at 5-HT_1AThose in R-KO mice.Data representation be baseline percentage ratio and be shown as meansigma methods ± SEM (n=4-6 mice/group).There were significant differences for * p ＜ 0.01 and carrier and nsNLF-siRNA group, utilizes repeated measure ANOVA, in the factor of tested internal variable and processes between the time, subsequently multiple comparisons Newman-Keuls inspection.

Figure 10. at 5-HT_1AAutoreceptor is lowered anxiety in mice and is similar to behavior and does not change, but in pressure/depression phase Close the response changed in test.Each group mice is: i) carrier, ii) 5-HT_1ANLF-siRNA (the 5-HT of R-targeting_1AR-NLF- SiRNA) and iii) 5-HT_1AR knocks out (5-HT_1AR-KO).Mice carrier or siRNA, with 30 μ g/2.5 μ l/1 days, are injected into D3V, intracerebral ventricle injection.A) anxiety is similar to behavior Elevated plus-maze and is administered the post-evaluation of 24 hours at carrier or siRNA.With 5-HT_1AR knock-out mice (5-HT_1AR-KO) different, 5-HT_1AAutoreceptor lowers mice (5-HT_1AR-NLF-siRNA) display exists Enter number of times and Elevated plus-maze open arms spend time there is no difference.B) tail-suspention test is selected as example to comment Valency response under Acute Stress/Condition of depression.This test is estimated after carrier or siRNA are administered 48 hours.Compare In vehicle group, under stress situations, 5-HT_1AMediation 5-HT under autoreceptor_1AR-KO mice illustrates the motility of increase.Number Value is meansigma methods ± SEM (n=12-18 mice/group).* p ＜ 0.05, * * p ＜ 0.01, * * * p ＜ 0.001 and carrier have significantly Difference, utilizes single factor test ANOVA followed by Newman-Keuls post hoc to check.

Figure 11. the 5-HT that intranasal administration is puted together_1AThe selectivity 5-HT that R-NLF-siRNA causes_1AAutoreceptor is reticent.Little Mus accepts single intranasal administration: i) carrier, ii) nonsense NLF-siRNA (ns NLF-siRNA) and iii) 5-HT_1AR-NLF- SiRNA (15 μ g/5 μ l in each nostril).A) 5-HT of dorsal raphe nucleus (DRN)_1AR is expressed and is assessed by situ hybridization.Post Shape figure shows 5-HT in DRN_1AThe 5-HT of R-NLF-siRNA induction_1AThe reduction of R mRNA level in-site.The 5-measured on film HT_1AThe photodensitometric quantitation of RmRNA positive particle is shown as average optical (OD) percentages ± SEM, and (n=4 mice is every Group and in 2 times of the 3AP level observations of DRN).B-D)5-HT_1AR-NLF-siRNA induces presynaptic 5-HT_1AUnder the specificity of R Adjust, but be not postsynaptic sites.Dorsal raphe nucleus (B), prefrontal cortex (C) and the 5-HT of hippocampus (D)_1AR protein level Combined by autoradiography and use³[H]-8-OH-DPAT evaluates.Figure post represents 5-HT_1AR fmol/mg histone average Value ± SEM (n=4 mice often group and in 2 times of the 3AP level observations of DRN with in prefrontal cortex and the left and right of hippocampus 2 observations in site).* there were significant differences for p ＜ 0.05, * * p ＜ 0.01 and carrier and ns NLF-siRNA, utilizes single factor test ANOVA followed by Newman-Keuls post hoc checks.

Figure 12 .8-OH-DPAT (selectivity 5-HT_1AR agonist) to 5-HT_1AAutoreceptor lower in mice physiology and The impact of neuro chemistry parameter does not exist.Each group mice single intranasal administration of acceptance: i) carrier, ii) nonsense NLF-siRNA (ns NLF-siRNA) and iii) 5-HT_1AR-NLF-siRNA (each nostril 15 μ g/5 μ l).A) with carrier and ns NLF-siRNA The mice processed is different, and the 8-OH-DPAT of 1mg/kg lumbar injection dosage is at 5-HT_1AIn R-NLF-siRNA mice to body temperature not Produce any change.Numerical value is shown as meansigma methods ± SEM (n=4-7 mice often group) that body temperature changes.B) carrier, nsNLF- SiRNA and 5-HT_1AThe mPFC of R-NLF-siRNA mice measures extracellular 5-HT level, then whole body by vivomicrodialysis It is administered 8-OH-DPAT (0.5mg/kg lumbar injection).In the mPFC of carrier and nsNLF-siRNA, 5-HT level all drops Low.But, 5-HT_1AR-NLF-siRNA mice shows and there is not 8-OH-DPAT to the impact of 5-HT level in mPFC.Tables of data Reach for the percentage ratio of baseline and be shown as meansigma methods ± SEM (n=4-9 mice/group).* p ＜ 0.01, * * * p ＜ 0.001 point Not and carrier and ns NLF-siRNA there were significant differences, be utilized respectively single or double factor ANOVA followed by multiple comparisons Newman- Keuls checks.

Figure 13. intranasal 5-HT_1AR-NLF-siRNA silence 5-HT_1A-autoreceptor also causes antidepressant similar response.Mice Accept single intranasal administration: i) carrier, ii) 5-HT_1AR-NLF-siRNA (each nostril 15 μ g/5 μ l) and iii) 5-HT_1AR- NLF-siRNA (each nostril 50 μ g/5 μ l).A) 5-HT in Elevated plus-maze_1AAny dosage of R-NLF-siRNA is the most not Affect anxiety and be similar to response (n=6).Numerical value is meansigma methods ± SEM.B) single intranasal administration 5-HT_1AR-NLF-siRNA (30 or 100 μ g) cause fixed dose dependent in tail-suspention test to reduce (n=10-15).Numerical value is meansigma methods ± SEM.Single factor test ANOVA shows the group of remarkable result, F_2,34=8.70, p ＜ 0.001.Relative to carrier * p ＜ 0.05, * * * p ＜ 0.001.C) Single intranasal administration 5-HT_1AR-NLF-siRNA (100 μ g) causes fixed reduction (n=13-16) in forced swimming test. Numerical value is meansigma methods ± SEM.Single factor test ANOVA shows the group of remarkable result, opposite carrier * p ＜ 0.05, * * p ＜ 0.01.

Figure 14. specificity 5-HT transporter (5-HTT) that the 5-HTT-NLF-siRNA that intranasal administration is puted together causes is reticent. A) 5-HTT of dorsal raphe nucleus (DR) is expressed and is evaluated by situ hybridization.The mice single administration of acceptance: i) carrier, ii) 5- HTT-NLF-siRNA, in each nostril 5 μ g/5 μ l (5-HTT-NLF-siRNA 10) and, iii) 5-HTT-NLF-siRNA, often 15 μ g/5 μ l (5-HTT-NLF-siRNA 30) in individual nostril.A1-a333 shows on (AP) coordinate before and after three differences With³³The coronal section of the mice rapheal nuclei that the 5-HTT-specific oligonucleotide of P-labelling combines, in terms of mm: from anterior fontanelle (kiss tail -4.24/-4.36 ,-4.36/-4.60 and-4.72/-4.84 from left to right).Scale, 500 μm.B) block diagram shows 5- The reduction of 5-HTT mRNA level in-site in the dorsal raphe nucleus of HTT-NLF-siRNA induction.The 5-HTT mRNA measured on film is positive The photodensitometric quantitation of granule is shown as average optical (OD) percentages ± SEM, and (n=4 mice often group, at dorsal suture nerve 2-4 observation of the 3AP level of core).* there were significant differences with carrier for p ＜ 0.05, * * p ＜ 0.01, utilize single factor test ANOVA with After be Newman-Keuls post hoc inspection.

The 5-hydroxy tryptamine transporter specific downregulation of Figure 15 .5-HTT-NLF-siRNA induction, by situ hybridization and radiation Autography combines and evaluates.The mice single administration of acceptance: i) carrier, ii) nonsense-NLF-siRNA, each nostril 15 μ g/5 μ l, Iii) 5-HTT-NLF-siRNA, each nostril 5 μ g/5 μ l (5-HTT-NLF-siRN A 10) and, iv) 5-HTT-NLF- SiRNA, each nostril 15 μ g/5 μ l (5-HTT-NLF-siRNA 30).A) block diagram shows that 5-HTT-NLF-siRNA induces In dorsal part (DR) and the reduction of the 5-HTT mRNA level in-site of middle part (MnR) rapheal nuclei.The 5-HTT mRNA measured on film is positive Granule photodensitometric quantitation is shown as average optical (OD) percentages ± SEM (n=7-10 mice often group).* p ＜ There were significant differences for the carrier of 0.05, * * * p ＜ 0.001 and same area and nonsense-NLF-siRNA, utilize single factor test ANOVA with Rear Newman-Keuls post hoc checks.B-C) photodensitometry that specificity 5-HTT combines is expressed as % and combines carrier note Enter the corresponding region of mice, in order to the degree that in each region, the 5-HTT of NLF-siRNA-induction lowers is described.Figure post represents flat The SEM of mean value ± 6-9 mice/group.* p ＜ 0.05, * * p ＜ 0.01 has with carrier and the nonsense-NLF-siRNA of same area Significant difference, utilizes single factor test ANOVA Newman-Keuls post hoc subsequently to check.

Figure 16 .A) acute fluoxetine (selective depressant of 5-HT transporter, 20mg/kg lumbar injection) be administered to mice The impact of dorsal part striatal dialysis solution 5-HT level.The mice single administration of acceptance: i) carrier, ii) 5-HTT-NLF-siRNA, Each nostril 5 μ g/5 μ l (5-HTT-NLF-siRNA 10) and, iii) 5-HTT-NLF-siRNA, each nostril 15 μ g/5 μ l (5- HTT-NLF-siRNA30).Microdialysis Experiments is carried out after applying 24-48 hour.Fluoxetine creates dorsal part stricture of vagina in vehicle group The increase of 5-HT level in shape body, does not then have in 5-HTT-NLF-siRNA group.B) selectivity 5-HT transporter inhibitors, west The phthalein Pulan (Cit) local influence to the 5-HT level in the dorsal part striatum of carrier and 5-HTT-NLF-sirRNA mice.West The topical of phthalein Pulan adds the 5-HT level in the dorsal part striatum of vehicle group with concentration dependant manner.But, west The only slight increase of 5-HT level in 50 μMs of striatums producing 5-HTT-NLF-siRNA group of phthalein Pulan.Data representation is base The percentage ratio of line is also shown as meansigma methods ± SEM (n=7-8 mice/group).There were significant differences with carrier for * p ＜ 0.01, utilizes Repeated measure ANOVA, in the factor of tested internal variable and processes between the time, subsequently multiple comparisons Newman-Keuls inspection Test.

Figure 17 .NLF-NS-siRNA-Cy3 selectivity targeting to the dopaminergic neuron of substantia nigra compacta.A and C shows Show the NLF-NS-siRNA-Cy3 of red-label, be administered siRNA 1 and after 3 hours at mice Ventral Midbrain ICV respectively.B The same tag merged that dyes with tyrosine hydroxylase (TH) is shown with D.NLF-NS-siRNA-Cy3ICV is administered 1 hour Afterwards (A and B), red-label (Cy3) can detect (blue) in TH-positive substantia nigra neuron, but can not be at black substance The aminobutyric acid serotonergic neuron of reticular part detects (*).Red-label follows point-like pattern (insertion).After injecting 3 hours, Any red cell internal labeling (C and D) can not be detected.

Figure 18 .NLF-NS-siRNA-Cy3 selectivity targeting to the noradrenergic neuron of nucleus ceruleus.A and C It is respectively displayed on ICV and is administered the red-label of NLF-NS-siRNA-Cy3 after siRNA 1 and 3 hours.B and D shows and cheese ammonia The same tag that acid hydroxylase (TH) dyeing merges.NLF-NS-siRNA-Cy3ICV is administered (A and B) after 1 hour, red Labelling (Cy3) mainly can be detected (blue) in TH-positive noradrenergic neuron.Red-label is followed a little Shape pattern (is inserted).After injecting 3 hours, any red cell internal labeling all can't detect (C and D).

Figure 19. the nonsense (C-ns-TOM) of 2-O '-methyl (the TOM)-modification of Sertraline-put together is at ridge 5- Selectivity accumulation in hydroxytryptamine neuron.Mice accepts single Intraventricular and injects the C-ns-TOM (30 μ g) of Cy3-labelling extremely Dorsal part ventriculus tertius also puts to death (n=2 mice) after injecting 24 hours.The laser copolymerization of YOYO1-immunoreactive cell core Burnt image (green) shows the C-ns-TOM (red) of the Cy3 labelling of local immunity.Scale is 40 μm.

Detailed Description Of The Invention

The author of the present invention it has been observed that unexpectedly, by described nucleic acid is covalently coupled to such molecule, Can by the cell interested of nucleic acid specificity targeted expression neurotransmitter transporters, described molecule can specific binding extremely Described neurotransmitter transporters and, more specifically, to the inhibitor of described transporter.

A.The conjugate of the present invention

At first aspect, the present invention relates to conjugate, it comprises:

I) at least one specific binding selective reagent to one or more neurotransmitter transporters,

Ii) at least one can the specific binding oligonucleotide to target molecules, described target molecules is identical thin Born of the same parents are expressed as neurotransmitter transporters.

As the term is employed herein " conjugate ", refer to by two or more single compound covalent bond formed any Compound.In the present invention, conjugate refers to comprise the molecule of the nucleic acid of covalent coupling and selective reagent, described coupling directly or Pass through linker compounds.

Term " covalent coupling " or " covalent bond " meaning are nucleic acid and selective reagent or the most covalently bound, Or by insertion portion each other indirectly by covalently bound, described insertion portion such as joint, or bridging, or isolated part.

A.1.Selective reagent

Express " selective reagent specific binding with one or more neurotransmitter transporters " as used herein, refer to Any material being combined with neurotransmitter transporters.This binding specificity makes the molecule being connected with described selective reagent deliver To cell, tissue or organ containing described neurotransmitter transporters.In this way, when being awarded animal or at body Outer when contacting with different types of cell population, the conjugate containing described selective reagent specificity is directed to described carefully Born of the same parents,

As used herein, the first molecular specificity is attached to the second molecule and refers to that the first molecule is attached to described second molecule Ability be markedly different from non-specific interaction to a certain extent.It is right that selective reagent according to the present invention can show It is at least about 10 in the Kd of target (neurotransmitter transporters)^-4M, the most at least about 10^-5M, the most at least about 10^-6M, can Selection of land at least about 10^-7M, the most at least about 10^-8M, the most at least about 10^-9M, the most at least about 10^-10M, the most extremely Few about 10^-11M, the most at least about 10^-12M or higher.

As the term is employed herein " neurotransmitter transporters ", referring to that a class belongs to the albumen of protein called membrane transporters, it is crossed over The cell membrane of neuron, and its major function is that delivery neurotransmitter is through these films guide it to be transported to cell further Interior specific position.The selective reagent of the present invention can include, but not limited to nerve with the neurotransmitter transporters of targeting Absorbing carrier present in the plasma membrane of unit and neurogliocyte, neurotransmitter is pumped into intracellular by it from extracellular space.Should Process depends on the Na striding across plasma membrane⁺Gradient, specifically Na⁺Cotransport.Identify the albumen of Liang Ge family.One family Including for GABA, monoamine such as norepinephrine, dopamine, 5-hydroxy tryptamine, and aminoacid such as glycine and proline Transporter.Common structural component includes 12 transmembrane spanning α-helices domains estimated, cytoplasmic N-and C-end, and Membrane spaning domain is divided into three or four parts by one big glycosylation extracellular loop.The homologous protein of this family by energy from Na⁺With Cl^-Ion and cotransporting of neurotransmitter are delivered to cell (Na⁺/Cl^-Neurotransmitter transporters).Second family include for The transporter of excitatory amino acid such as glutamic acid.Common structural component includes 6-10 membrane spaning domain of presumption, carefully N-and the C-end of kytoplasm, and glycosylated cells outer shroud.Described excitatory amino acid transporter does not relies on Cl^-, but can Intracellular K can be needed⁺Ion (Na+/K+-neurotransmitter transporters) (Liu, Y.et al. (1999) Trends Cell Biol.9:356-363).

Can be also included within intracellular cyst membrane with the neurotransmitter transporters that the selective reagent targeting of the present invention is combined Exist neurotransmitter transporters, typically in synaptic vesicle, its major function be in synapse transmittance process in vesicle Before tolerant exocytosis, will concentrate from cytoplasmic neurotransmitter and enter in vesicle.Vesicle transport utilizes and strides across vesicle film H⁺The electrochemical gradient that-ATP enzyme produces.The albumen of Liang Ge family relates to neurotransmitter and is transported into vesicle.One family master Proton exchange to be utilized is transported into Secretory vesicles to drive and includes the transporter of monoamine and acetylcholine.Such as, monoamine turns Fortune body is by every kind of molecule that two kinds of intracavity proton exchange are Cytoplasm mediator.Second family includes gaba transporter, and it relies on Positive charge in synaptic vesicle.This two classes Vesicle transport body demonstrates do not have sequence similarity each other and have and plasma membrane Distinct structure Schloss of carrier, P.et al. (1994) Curr.Opin.Cell Biol.6:595-599；Liu, Y.et al. (1999) Trends Cell Biol.9:356-363).

Can include with the particular type of the neurotransmitter transporters that the selective reagent targeting of the present invention is combined glutamic acid/ Aspartate Transporter, including, excitatory amino acid transporter 1 (EAAT1), excitatory amino acid transporter 2 (EAAT2), emerging Put forth energy acidic amino acid transporter 3 (EAAT3), excitatory amino acid transporter 4 (EAAT4), excitatory amino acid transporter 5 (EAAT5), vesicle glutamate transporter 1 (VGLUT1), vesicle glutamate transporter 2 (VGLUT2) and vesicle glutamate transporter 3(VGLUT3)；Gaba transporter, including, gaba transporter Class1 (GAT1), gaba transporter type 2 (GAT2), GABA turns Fortune body type 3 (GAT3), glycine betaine transporter (BGT1) and vesicle gaba transporter (VGAT)；Glycine transporter, including, sweet Propylhomoserin transporter Class1 (GlyT1), glycine transporter type 2 (GlyT2)；Monoamine transporter, including, DAT (DAT), norepinephrine transporter (NET), 5-hydroxy tryptamine transporter (SERT), vesicular monoamine transporter 1 (VMAT1), capsule Bubble monoamine transporter 2 (VMAT2)；Adenosine transport body, including, equilibrated type nucleoside transporting body 1 (ENT1), equilibrated type nucleoside transporting body 2 (ENT2), equilibrated type nucleoside transporting body 3 (ENT3) and equilibrated type nucleoside transporting body 4 (ENT4) and the transhipment of vesicle acetylcholine Body (VAChT).

In one preferred embodiment, selective reagent is not peptide.

In one preferred embodiment, selective reagent is selected from serotonin reuptake inhibitor (SRI), selectivity Serotonin reuptake inhibitor (SSRI), 5-hydroxy tryptamine-NRI (SNRI), noradrenaline Element can be with the antidepressant (NASSA) of specificity 5-hydroxy tryptamine energy, NRI (NRI), dopamine Reuptake inhibitor (DRI), Endocannabinoids reuptake inhibitor (eCBRI), adenosine reuptake inhibitor (AdoRI), emerging Put forth energy acidic amino acid reuptake inhibitor (EAARI), glutamic acid reuptake inhibitor (GluRI), GABA reuptake inhibitor (GRI), glycine reuptake inhibitors (GlyRI) and norepinephrine-dopamine reuptake inhibitor (NDRI).

Term " serotonin reuptake inhibitor " or " SRI ", refer to hinder the molecule of 5-hydroxy tryptamine picked-up, including choosing (its specificity hinders 5-hydroxy tryptamine picked-up to have no substantial effect on other nerves to selecting property serotonin reuptake inhibitor (SSRI) Mediator) and also include non-selective serotonin reuptake inhibitor such as 5-hydroxy tryptamine-norepinephrine reuptake suppression Agent (SNRI) and 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor (SNDRI).

Term " 5-hydroxy tryptamine selectivity reuptake inhibitor " or " SSRI ", refer to the Selective depression of serotonin reuptake transporter Agent, it has no substantial effect on the picked-up of other neurotransmitter or delivery system.These compounds are mainly at presynaptic 5-hydroxy tryptamine energy Cell work, cause the raising of the Intracellular levels of neurotransmitter serotonin, thus improve the level of 5-hydroxy tryptamine, make It can be in conjunction with postsynaptic receptor the activity deficiency inverting brain this monoaminergic nerve neurotransmitter systems interior.The exemplary non-limit of SSRI Property example processed includes Sertraline (CAS 79617-96-2), Sertraline-analog, fluoxetine (CAS 54910-89-3), Fluvoxamine (CAS 54739-18-3), paroxetine (CAS 61869-08-7), indalpine (CAS63758-79-2), Qi Mei Fixed (CAS 56775-88-3), citalopram (CAS 59729-33-8) and escitalopram (CAS 219861-08-2).Determine to Determine compound whether taking on the assay method of SSRI is such as, to reduce external picked-up 5-hydroxy tryptamine and the p-chloroamphetamine of antagonism The ability of 5-hydroxy tryptamine-consumption behavior, and do not affect rat heart picked-up intravenous [³H] norepinephrine, as at Koe Et al. (J.Pharmacol.Exp.Ther., 1983,226:686-700) substantially describes.

At one preferred embodiment, described SSRI is Sertraline or its analog and has structure (I)

Wherein, independently, R₁、R₂、R₃、R₄、R₅And R₆It is hydrogen or any substituted C1-C6 alkyl；X and Y each be selected from hydrogen, Fluorine, chlorine, bromine, trifluoromethyl, C1-C3 alkoxyl and cyano group；And W is selected from hydrogen, fluorine, chlorine, bromine, trifluoromethyl, nitro and C1-C3 Alkoxyl.In some embodiments, Sertraline analog is with the configuration of cis-isomery.Term " cis-isomery " refers to NR in cyclohexene ring₁R₂Relative bearing (that is, they are all in the same side of ring) with phenyl moiety.Because 1-carbon and 4- Carbon is all Asymmetrical substitute, and each cis-compound has 2 to represent (with reference to I-carbon) with cis-(1R) and cis-(1S) enantiomer Enantiomeric form.

Some useful Sertraline analog is following compound, with (1S)-enantiomer or (1S) (1R) raceme shape Formula, and their pharmaceutically acceptable salt:

-cis-N-methyl-4-(3,4-Dichlorobenzene base)-1,2,3,4-tetrahydrochysenes-naphthalidine；

-cis-N-methyl-4-(4-bromophenyl)-1,2,3,4-tetrahydrochysenes-naphthalidine；

-cis-N-methyl-4-(4-chlorphenyl)-1,2,3,4-tetrahydrochysenes-naphthalidine；

-cis-N-methyl-4-(3-trifluoromethyl)-1,2,3,4-tetrahydrochysenes-naphthalidine；

-cis-N-methyl-4-(3-trifluoromethyl-4-chlorophenyl)-1,2,3,4-tetrahydrochysenes-naphthalidine；

-cis-N, N-dimethyl-4-(4-chlorphenyl)-1,2,3,4-tetrahydrochysenes-naphthalidine；

-cis-N, N-dimethyl-4-(3-trifluoromethyl)-1,2,3,4-tetrahydrochysenes-naphthalidine；With

-cis-N-methyl-4-(4-chlorphenyl)-7-chloro-1,2,3,4-tetrahydrochysenes-naphthalidine.

Also of interest is cis-N-methyl-4-(3,4-Dichlorobenzene base)-1, (1R) of 2,3,4-tetrahydrochysenes-naphthalidine-right Reflect body.

Sertraline analog is also described in U.S. Patent number 4,536,518.Other relevant compounds include (S, S)- N-demethyl Sertraline, raceme-cis-N-demethyl Sertraline, (1S, 4S)-demethyl Sertraline, 1-remove (methylamine)-1- Carbonyl-2-(R, S)-hydroxyl Sertraline, (1R, 4R)-demethyl Sertraline, Sertraline, sulfonamide, Sertraline (reversely) methylsulfonyl Amine, 1R, 4R Sertraline, enantiomer, N, N-dimethyl Sertraline, nitro Sertraline, Sertraline aniline, Sertraline iodide, house Bent woods sulfonamide NH2, Sertraline sulfonamide ethanol, Sertraline nitrile, Sertraline-CME, the reverse sulfonamide of dimethyl Sertraline, house The bent reverse sulfonamide of woods (CH2 joint), Sertraline B-ring ortho position methoxyl group, Sertraline A cyclohexyl methyl ester, Sertraline A-ring ethanol, Sertraline N, N-dimethyl sulfonamide, Sertraline A ring carboxylic acid, Sertraline B-ring para-position phenoxy group, Sertraline B-ring para-position-trifluoro Methane, N, N-dimethyl Sertraline B-ring and para-position-fluoroform and UK-416244.The following institute of structure of these analog Show.

Term " 5-hydroxy tryptamine-NRI " or " SNRI " refer to pass through blocking 5-hydroxytryptamine Transporter and suppress 5-hydroxy tryptamine reuptake and by block norepinephrine transporter and suppress norepinephrine The chemical families of reuptake.This family includes compound such as venlafaxine (CAS 93413-69-5), desmethylvenlafaxine (CAS 93413-62-8), duloxetine (CAS116539-59-4), midalcipran (CAS 92623-85-3), sibutramine (106650-56-0), tramadol (CAS 27203-92-5) and bicifadine (CAS 71195-57-8).Determine given compound Assay method as SNRI is, such as, and the ability that brain synaptosome picked-up 5-hydroxy tryptamine and norepinephrine reduce, as Substantially at Bolden-Watson C, Richelson E. (Life Sci.1993；52 (12): 1023-9) described in.SNRI A particular type be tricyclic antidepressant, it is the SNRI with the usual molecular structure containing three rings.Tricyclic antidepressants resists The representative of depressant drug is linear tricyclic antidepressants, such as, imipramine, desipramine, amitriptyline, nortriptyline, and protriptyline is filled in more Flat, Imipramine N-oxide, mianserin, dosulepin, amoxapine, dibenzepin, melitracen, maprotiline, flupentixol, A Zha Fen, the related compound of tianeptine activity similar with display.Angular tricyclic anti-depressants includes indriline, clodazone, promise Meter Fen Xin, and related compound.The variant of the antidepressants that other structure is different, such as, iprindole, the general product of cloth, Nyala Amine, midalcipran, phenelzine and tranylcypromine have shown that have shares activity.They merits with tricyclic antidepressant Can be equal, and be therefore included within the scope of the invention.Thus, the present inventor is wanted by term tricyclic antidepressant, Including the broad variety of antidepressants mentioned above with have the related compound of general characteristics, they are owned by antidepressant and live Property and include, and being not limited to, compound such as amitriptyline, amitriptylinoxide, carbamazepine, butriptyline, clomipramine, ground is beautiful For woods, desipramine, dibenzepin, dimetacrine, dosulepin/dosulepin, doxepin, imipramine, imipraminoxide, Yi Pu Indole, lofepramine, melitracen, metapramine, nitre sand Xiping, nortriptyline, noxiptiline, Pregabalin, propizepine, Protriptyline, quinupramine and trimeprimine.

Term " NRI ", " NRI ", " NERI ", " Adrenergic reuptake suppression Agent " or " ARI " refer to the compound of such a family, its can by block norepinephrine transporter (NET) activity And block norepinephrine and adrenergic reuptake.The compound of this family includes selective N RI, and it blocks exclusively NET, and do not affect other monoamine transporter, and non-selective NRI such as SNRI, its block norepinephrine transporter and 5-hydroxy tryptamine transporter (sees above), norepinephrine-dopamine reuptake inhibitor (NDRI), and it blocks noradrenaline Element and DAT (seeing below), tricyclic antidepressant and tetracyclic antidepressants (seeing above).It is applicable to the present invention Suitable selective N RI include, but not limited to atomoxetine/tomoxetine (Strattera or CAS 83015-26- 3), Mazindol (Mazanor, Sanorex or CAS 22232-71-9), reboxetine (Edronax, Vestra or CAS 98819-76-2) with viloxazine (Vivalan or CAS 46817-91-8).

Term " dopamine reuptake inhibitor " or " DRI " become by blocking the activity of DAT (DAT) The reuptake inhibitor of neurotransmitter dopamine.This thus cause intracellular dopamine concentration increase and thus increase dopamine Can neurotransmission.The DRI being suitable for includes, but not limited to medical such as survector, benztropine/benzatropine, An Fei His ketone, dexmethylphenidate, esketamine, etybenzatropine/Ethybe, ethybenzatropine, fencamfamin, fencamine, ketamine, profit is non- He is bright, medifoxamine, mesocarb, methylphenidate, nefopam, nomifensine, pipradrol, prolintane, and pyrovalerone replaces Carry out his bright and tripelennamine；Chemical drugs in research such as altropane (training south), amfonelic acid, phencyclidine, Bu Suo Fragrant new, bromantan, DBL-583, dichloropropane=, diclofensin, phenylcyclohexyl diethylamide (Dieticyclidine), Difluoro puts down (dfluoropine), gacyclidine, GBR-12, and 935, indatraline, ioflupane, iometopane, Ma Nifaxin, thunder Da Faxin, tametraline, for Suo Fenxin, troparil and vanoxerine.Suitably DRI can be with known to those skilled in the art Analysis method identify, such as measure the DRI of presumption by the synaptosome preparation prepared from rat striatum the high parent of suppression With the ability of power picked-up dopamine, use method disclosed in documents below: Kula et al., (LifeSciences 34: 2567-2575,1984).

Term " Endocannabinoids reuptake inhibitor " or " eCBRI ", as used herein, refer to by block endogenous big The activity of fiber crops element transporter and any compound of reuptake inhibitor as Endocannabinoids.There is the chemical combination of this activity Thing can be identified by the method being described in documents below: and Beltramo, M.et al. (Science, 1997,277:1094- 1097), Endocannabinoids reuptake inhibitor based on presumption blocks cannabinoid by neurons of rats and spider cell The ability of picked-up, and include, but not limited to AM404, N-arachidonic Rhizoma et radix valerianae amine (arvanil) and olvanil.

Term " adenosine reuptake inhibitor " or " AdoRI " refer to by blocking one or more equilibrated type nucleoside transporting body (ENTs) behavior and as purine nucleosides and the compound of the reuptake inhibitor of neurotransmitter adenosine.This thus cause thin Therefore the increase of intracellular adenosine concentration also increases adenosine energy neurotransmission.Have AdoRI activity compound can utilize below Method is identified, i.e. based on presumption AdoRI at the analyzed in vitro suppressed by erythrocytic adenosine uptake with based on presumption AdoRI The vasodilatory effects of suppression adenosine and the analyzed in vitro of promotion of the collateral vessel growth of prevention adenosine mediation, all these all Can carry out essentially according to the description in US6984642.Suitably AdoRI includes, but not limited to acadesine, acetic acid Leuprorelin, barbiturates, Benzodiazepines, calcium channel blocker, carbamazepine, carisoprodol, cilostazol, ring benzene is pricked Woods, dilazep, dipyridamole, estradiol, ethanol (ethanol), flumazenil, hexabendine, hydroxyzine, indomethacin, inosine, KF24345, meprobamate, Nitrobenzol methyl Thioguanosine, Nitrobenzol methyl NSC-40774, papaverine, pentoxifylline, phenol thiophene Piperazine, phenytoin, Progesterone, propentofylline, propofol, puromycin, R75231, RE102BS, rope fluorine piperazine (Soluflazine), Toyokamycin, tracazolate, tricyclic antidepressant.

Term " excitatory amino acid reuptake inhibitor " or " EAARI ", refer to by blocking excitatory amino acid transporter Or EEATs and suppress the compound of excitatory amino acid reuptake.Already known multiple compounds combines EAAT and suppresses transhipment The function of body.EAAT inhibitor is divided into two main classifications, and they differences are its binding mode: non-Transshipment Permitted blocker and Competitive substrate.Suitably EAARI includes, but not limited to DL-Soviet Union-β-benzyloxy aspartic acid, kainite, dihydroxy Kainate, 2S4R4MG, threo-beta-hydroxy aspartic acid, trans-pyrrolidine-2 of L-, 4-dicarboxylic acids (t-2,4-PDC).Close Suitable EEARI can be identified by the analysis method that such as documents below describes: Shimamotot et al. (Molecular Pharmacology, 1998,53:195-201), based on supposing that human excitability amino acid transporter-1 is expressed in EEARI suppression Or the Cos-1 cell of human excitability amino acid transporter-2 (EEAT2) energy to radiolabeled glutamate uptake (EAAT1) Power.

Term " glutamic acid reuptake inhibitor " or " GluRI ", refer to the row by blocking one or more glutamate transporter For and as the compound of glutamic acid reuptake inhibitor.Suitably glutamic acid reuptake inhibitor includes known in the art What such inhibitor, including, such as, threo-3 hydroxyl-DL-aspartic acid (THA), (2S)-trans-pyrrolidine-2,4-dicarboxyl Acid (PDC), aminocaproic acid, and (2S, 3S)-3-{3-[4-(trifluoromethyl) Benzoylamide] benzyloxy } aspartic acid.Have The compound of GluRI activity can utilize the analysis being such as described in documents below to identify: Shimamotot et al. (MolecularPharmacology, 1998,53:195-201), based on supposing that GluRI suppression is expressed human excitability amino acid and turned The Cos-1 cell of fortune body-1 (EAAT1) or human excitability amino acid transporter-2 (EEAT2) is to radiolabeled glutamic acid The ability of picked-up.

Term " GABA reuptake inhibitor " or " GRI ", refer to the behavior by blocking γ-aminobutyric acid transporter (GAT) And the compound of the reuptake inhibitor as neurotransmitter γ-aminobutyric acid (GABA).It thus cause intracellular GABA's Concentration increases and thus adds the neurotransmission of GABA energy.Suitable GABA reuptake inhibitor includes, but not limited to add passes through Leaf hypericin (is found in Herba Hyperici perforati (St.John ' s Wort)), CI-966, deramciclane (EGIS-3886), tetrahydrochysene cigarette Acid (C10149), hyperforine (is found in Herba Hyperici perforati (St.John ' s Wort)), nipecotic acid, NNC 05-2090, NNC-711, SKF-89976A, SNAP-5114, stiripentol and tiagabine (Gabitril), it is described in Borden LA et Al. (Eur J Pharmacol.1994,269:219-224).Differentiate whether given compound is GABA reuptake inhibitor Method is to it known in the art, such as at US6906177；US6225115；US4383999 and AIi, F.E., et al. Description in (J.Med.Chem.1985,28,653-660).These methods generally comprise and make cells contacting radiolabeled GABA also detects the picked-up of GABA in the case of candidate compound exists and do not exists.

Term " glycine reuptake inhibitors " or " GlyRI " refer to by block glycine transporter (GlyT) behavior and As the compound of the reuptake inhibitor of neurotransmitter glycine, including following compound: block glycine transporter (1 type) GlyTI, relates to removing glycine from synaptic cleft；And GlyT2, be glycine reuptake and refill entrance synaptic vesicle required for (Gomeza et al., 2003；CurrOpin Drug Discov Devel 6 (5): 675-82).Conjunction for the present invention Suitable glycine reuptake inhibitors include GlyT1 specific inhibitor such as N-methyl-N-[[(1R, 2S)-1,2,3,4-tetra- Hydrogen-6-methoxyl group-1-phenyl-2-naphthyl] methylglycine (free alkali of MTHMPNM glycine), 4-[3-fluoro-4-the third oxygen benzene Base] it is described in WO0007978 with-spiral shell [2H-1-.alpha.-5:6-benzopyran-2,4 '-piperidines]-1 '-acetic acid (free alkali of FPPSBPAA) With in WO0136423, ALX 5407, sarcosine, 5,5-diaryl-2-amino-4-valeric acids or be described in the chemical combination of WO0208216 Thing, and GlyT2-specific inhibitor, such as, be described in the compound of WO05044810A, and its content is integrally incorporated this with it Literary composition is as reference.The method of detection GlyT1-specificity or GlyT2-specificity reuptake inhibitor is to it known in the art, bag Include such as, the method being described in WO05018676A or WO05044810, wherein express the thin of associated receptor (GlyT1 or GlyT2) Born of the same parents contact radiolabeled glycine in the presence of tested reuptake inhibitory activity compound, after one period of preset time The amount of the glycine of intracellular discovery is determined.

Term " norepinephrine-dopamine reuptake inhibitor " or " NDRI ", as used herein, refer to by hindering respectively Disconnected norepinephrine transporter (NET) and the behavior of DAT (DAT) and as neurotransmitter norepinephrine The compound of the reuptake inhibitor with dopamine.This thus cause the cell adding norepinephrine and dopamine Extracellular concentration, and therefore increase adrenergic and dopaminergic neurotransmission.Suitable NDRI for conjugate of the present invention Include, but not limited to amineptine (Survector, Maneon, Directin), BUP (Wellbutrin, Zyban), dexmethylphenidate (Focalin), fencamfamin (Glucoenergan, Reactivan), fencamine (Altimina, Sicoclor), Li Feitaming (Santenol), methylphenidate (Ritalin, Concerta), nomifensine (Merital), piperazine benzene Methanol (Meretran), prolintane (Promotil, Katovit), pyrovalerone (Centroton, Thymergix), Nai Fu Dissolving (Acupan), Adhyperforin. (is found in Herba Hyperici perforati (St.John ' s Wort)), and hyperforine (is found in Herba Hyperici perforati (St.John ' s Wort)), cocaine, 2-benzhydryl piperidines (Desoxypipradrol) (2-DPMP), hexichol Base dried meat ammonia alcohol (Diphenylprolinol) (D2PM), methylene dioxypyrrole pentanone (MDPV), cilobamine, Ma Nifaxin (GW-320,659), radar method pungent (GW-353,162), tametraline (CP-24,441).

In one preferred embodiment, the conjugate of the present invention comprises selective reagent, in fact selectivity 5-hydroxyl color Amine reuptake inhibitor (SSRI).In a preferred embodiment, SSRI is Sertraline or its knot as defined above Structure analog.

A.2.The nucleic acid of conjugate of the present invention

Second component of the conjugate according to the present invention be can the specific binding nucleic acid to target molecules, described target Mark molecule is at the cell inner expression identical with neurotransmitter transporters.Typically, the nucleic acid of the present invention can suppress target molecules Function.Therefore, if target molecules is mRNA, then nucleic acid (typically siRNA, shRNA or antisensenucleic acids) is by suppression The translation of mRNA and the protein level that causes this mRNA to encode reduces and works.If target molecules is albumen, then nucleic acid (allusion quotation It is aptamers type) worked by the activity of suppression albumen.

Term " nucleic acid ", as used herein, refer to that there is two or more deoxyribonucleotide, ribonucleotide or nucleoside The polymer of acid-like substance molecule, and similar in construction to self nucleic acid, but in one or more nucleic acid backbone (such as, The phosphoric acid of self nucleic acid), nucleic acid glycosyl (such as, the ribose of the deoxyribose of self DNA and self RNA) and nucleic acid base (example Such as, the adenosine in self nucleic acid, cytosine, guanine or thymus pyrimidine) on be different from self nucleic acid and (such as, repaiied by chemistry Decorations) molecule.

Oligonucleotide can be double-strand or single stranded oligonucleotide, includes, but not limited to siRNA (siRNA), little Folder RNA (shRNA), Microrna (miRNA), antisense oligonucleotide or ribozyme.If use double-strandednucleic acid, it comprises and target First positive-sense strand of complementary nucleic acid and second antisense strand complementary with positive-sense strand, it allows by the alkali between the first and second chains Basigamy to and form double-stranded DNA.

Term " antisense strand " refers to a chain of double-strandednucleic acid, and it includes substantially complementary with target sequence region.When mutually Mending region not exclusively and the target sequence mutual added time, mispairing can allow outside 2-7 the nucleotide that the 5 ' of antisense strand is held.

Term " positive-sense strand ", as used herein, refer to a chain of dsRNA, it includes the most mutual with the region of antisense strand The region mended.

Term siRNA (" siRNA ") refers to induce the little inhibition AMPLIGEN of rnai pathway.These molecules can With change in length (usual 18-30 base pair) and comprise in antisense strand with its target mRNA complementation in various degree.One A bit, but be not all, of siRNA and there is the unpaired overhanging base that positive-sense strand and/or the 5 ' of antisense strand or 3 ' is held.Term " siRNA " includes the double-stranded chain (duplexes) of two chains separated.As used herein, siRNA molecule is not limited to RNA molecule, But comprise the nucleic acid with the acid of one or more chemically modified nucleoside, such as morpholino thing further.

" shRNA " or " short hairpin RNA " refers to such dsRNA as the term is employed herein, and its two chains pass through a chain 3 ' end and another chain 5 ' hold between continuous nucleotide chain couple together to form bifilar structure.

Term " Microrna " or " miRNA " refer to short single strand RNA molecule, typically about 21-23 length of nucleotides, and Can express by controlling gene.MiRNA can be artificial (that is, recombinant) or natural.Natural miRNA is transcribed by from DNA Gene code, and be processed as short arm-ring structure (" precursor-miRNA ") from primary transcript (" primary-miRNA "), and Eventually become ripe miRNA.Ripe miRNA molecule partial complementarity is in one or more mRNA molecules, and by disturbing class with RNA As process or by suppression mRNA translate and down-regulation of gene expression.

" antisense sequences ", as used herein, including antisense or sense oligonucleotides, it comprises can be in conjunction with target mRNA The single strand nucleotide sequence (RNA or DNA) of (just) or DNA (antisense) sequence.CDNA sequence based on the given albumen of coding and Obtain the ability description of antisense or sense oligonucleotides in, such as, Si Tanyin and Koln, cancer research, volume 48: page 2659, 1988 (Steinand Cohen, Cancer Res.48:2659, (1988)) and model obtain Koror et al., biotechnology, and the 6th Volume: page 958,1988 (van der Krol et al., BioTechniques 6:958, (1988)).

As used herein, term " ribozyme " or " RNase " or " catalytic RNA " refer to the RNA molecule that catalytic chemistry reacts.Very Many natural nuclear enzymes are catalyzed the hydrolysis of one of himself phosphodiester bond, or the hydrolysis of key in other RNA, but have also been discovered that it Be catalyzed ribosomal aminotransferase activity, the ligase of DNA ligase activity, and traditional protease realize multiple other Chemical reaction.

" aptamers " finger as used herein combines the nucleic acid ligands in more than one site in target molecules, and combination therein is not It is " complementary ", i.e. the base pair being not due between nucleic acid ligands and target nucleic acid sequence is formed.Aptamers can be designed as knot Close the target of any anticipation, including polypeptide.Aptamers provides the purposes of biotechnology and treatment use, because of be provided for The molecular recognition properties that conventional use of biomolecule antibody is competed mutually.In addition to its Selective recognition, aptamers also provides for The advantage being better than antibody, because it can be processed completely in test tube, it is easy to produced by chemosynthesis, have desired Shelf-stable characteristic, and cause little or no immunogenicity in therapeutic is applied.Aptamers can be by repetitive cycling External differentiation, screen and amplify to synthesize, the method referred in the art as " SELEX " (index concentration Fas lignand system is evolved, Systematic Evolution of Ligands by ExponentialENrichment) (husky agate et al., chemical research is commented State .2008,41:130-8 page (Shamah etal, Acc.Chem.Res.2008,41 pp.130-8)).Alternatively, it can With by the most progressively Solid phase synthesis.

The nucleic acid of the present invention can connect in core base, between glycosyl and/or nucleotide and comprise one or more modification.

The modification of one or more framework residues of nucleic acid can comprise modifies below one or more: 2 ' glycosyl modified examples Such as 2 '-O-methyl (2 '-OMe), 2 '-O-methoxyethyls (2 '-MOE), 2 '-O-methoxyethoxies, 2 '-fluorine (2 '-F), 2 '-allyl Base (2 '-AIIyI), 2 '-O-[2-(methylamino)-2-oxygen ethyl], 2 '-O-(N-methyl carbamate)；4 ' glycosyl modified include 4 '-sulfur generation, 4 '-CH₂-O-2 '-bridging, 4-(CH₂)₂-O-2 '-bridging；Lock nucleic acid (LNA)；Peptide nucleic acid(PNA) (PNA)；Insert nucleic acid (INA)；Nucleic acid (TINA) is inserted in distortion；Hexitol nucleic acid (HNA)；Arabinose nucleic acid (ANA)；Hexamethylene nucleic acid (CNA)；Hexamethylene Alkene nucleic acid (CeNA)；Soviet Union's nucleic acid (TNA)；Morpholine ring oligonucleotide；Clearance body (Gap-mer)；Mixture (Mix-mer)；Mix Arginine is rich in peptide；Add the engineered rna of 5 '-phosphoric acid；RNA aptamers (fault-Ge Wosi NS, gene therapy, in February, 2007；The Volume 14 the 4th phase: 283-91 page) (Que-Gewirth NS, Gene Ther.2007Feb；14 (4): 283-91.)；Specific RNA fits The RNA aptamers of antidote regulation in the object of part (with reference to Ou Nuo S, oligonucleotide .2007 autumn；The 3rd phase of volume 17: 265-74 page .) (ref.Oney S, Oligonucleotides.2007 Fall；17 (3): 265-74.) or its any combination.

The modification connected between one or more nucleoside of nucleic acid can comprise modifies below one or more: D2EHDTPA Ester, phosphoramidate, di(2-ethylhexyl)phosphate carboxylic acid amide esters, phosphorodithioate, phosphoroselenoate, two phosphoroselenoate, thiophosphoramidate Ester (phosphoroanilothioate) and phosphoramidate (phosphoranilidate), or its combination in any.

Lock nucleic acid (LNA), is often referred to inaccessible RNA, is the RNA nucleotide of a kind of modification.The ribose of LNA nucleotide Extra bridge modified (O2 ', the C4 '-methylene bridge) of part connection 2 ' and 4 ' carbon.This bridge " is locked " and has been lived 3 '-internal structure structure Ribose in as, is typically found in the A-type of DNA or RNA.If necessary, LNA nucleotide can in nucleic acid with DNA or RNA base mixes.Such oligomer is commercially available.Lock ribose conformation enhances base stacking and pre-group of skeleton Knit.This dramatically increases heat stability (melting temperature) and the hybridization affinity of the nucleic acid that LNA-modifies, additionally there is improvement Mismatch binding ability.These characteristics make it highly useful to technology based on antisense.Further, LNA anti-miR oligonucleotide It is tested in primates, and obtains incentive result and hypotoxicity.

Peptide nucleic acid(PNA) (PNA) is the polymer being similar to DNA or RNA of synthetic, and controls for biological study and medicine Treat.PNA is known not to be naturally-occurring.DNA and RNA is respectively provided with ribodesose and ribose glycosyl skeleton, but the skeleton of PNA Bonded and form by peptide by N-(2-the aminoethyl)-Glycine Unit repeated.Multiple purine and pyrimidine bases pass through methylene Base carbonyl bond is connected to skeleton.PNA is similar to peptide and describes, and has N-end at initial (left) position and C-end on the right side.Due to PNA's Skeleton does not comprise charged phosphate group, and the combination between PNA/DNA chain is stronger than between DNA/DNA chain, because not having There is Coulomb repulsion.In terms of base pairing identification, mixing base pna molecule is real DNA molecular imitator.PNA/PNA ties Composition and division in a proportion PNA/DNA combines more intensive.

Inserting nucleic acid (INA) is the nucleic acid analog modified, and comprises deoxyribonucleotide and is covalently attached to hydrophobic insertion. INA has the high-affinity to complementary DNA, has the stability of up to 11 degree to every kind of modification.INA has than normal DNA entirely Join target and compare the higher specificity of mismatched target.INA has the purposes to DNA higher affinity, and to make it to utilize shorter Probe also thus further enhances specificity.Further, INA is DNA selective oligonucleotide analogs, have differentiation DNA and The unique ability of RNA.Although INA has the high-affinity to complementary DNA, it has relatively low parent to the complementary series of complementary INA And power.Distortion is inserted nucleic acid and is expressed as TINA.

Hexitol nucleic acid (HNA) is by natural nucleobases and phosphorylation 1, the oligonucleoside of 5-anhydrohexitol framework construction Acid.Molecular link between HNA and RNA than between HNA and DNA and natural acid (dsDNA, dsRNA, DNA/RNA) between more It is stable.Other manually modified oligonucleotide comprises ANA (arabinose nucleic acid), CAN (hexamethylene nucleic acid), CeNA (hexamethylene Alkene nucleic acid) and TNA (Soviet Union's nucleic acid).

Morpholine ring is synthetic molecules, and it is the redesign product of natural acid structure.In structure, morpholine ring and DNA or Difference between RNA is that morpholine has standard core base, and those bases are bound to hexa-atomic morpholine ring rather than deoxyribose/core In sugar ring, and nonionic di(2-ethylhexyl)phosphate amide, the subunit connection ionic di-phosphate ester of replacement is bonded.Morpholine ring is sometimes referred to as PMO (di(2-ethylhexyl)phosphate amide morpholino oligonucleotide).Hexa-atomic morpholine ring has chemical formula O-(CH₂-CH₂)₂-NH。

Clearance body (Gapmer) or " gap oligomeric compounds " are RNA-DNA-RNA chimeric oligonucleotide probes, wherein DNA Other RNA oligonucleotide that is normal or that modify is inserted in window or " gap ", and the latter becomes " wing " (wing).This kind is modified to be increased The affinity of the internal stability of oligonucleotide and probe and the effect of target, such that it is able to effectively use shorter probe. Preferably, the ribonucleotide that the wing is 2 '-O-methyl (OMe) or 2 '-O-methoxyethyl (MOE) is modified, it protects interior section From nuclease degradation.Further, the nucleotide forming gap or the wing can pass through phosphodiester bond or pass through thiophosphate Bonded, so that its tolerance RNase degraded.It addition, the nucleotide forming the wing can also be by merging 3 ' methyl acid phosphates Ester connects the base combined and modifies.

The nucleic acid of the conjugate of the present invention can be expressed in the specific binding cell identical at neurotransmitter transporters Target molecule.The combination of nucleic acid and target molecule can by Watson-gram in gram (Watspn-Crick) act on and occur, wherein target Molecule is the nucleic acid containing the sequence complementary with nucleic acid sequences.Alternatively, when target molecules is polypeptide, the present invention sews The nucleic acid of compound also can be with described molecular action, and nucleic acid is as aptamers in this case.

When forming the nucleic acid array complementation of nucleic acid and target mRNA of the part for conjugate of the present invention, to this area Standards different for technical staff may be used for selecting most suitable nucleic acid.As example, when forming a conjugate part When nucleic acid is siRNA, they can be by the AA dinucleotide of mRNA sequence of scanning target record that AA downstream follows closely 19 Nucleotide.Other method can be used for selecting nucleic acid target.In one embodiment, the selection of siRNA target sequence is complete (see, e.g., Soviet Union G et al., PNAS, volume 99: 5515-20 page, 2002) (Sui G is determined by experience Et al., Proc.Natl.Acad.Sci.USA 99:5515-20 (2002)), as long as target sequence originates in GG and uses Blast search analysis does not has significant sequence homology with other gene.In another embodiment, a kind of more detailed side Method is used for selecting siRNA target sequence.This process make use of such observation, and wherein any of endogenous mRNA can be close to site Can be targeted by artificial oligodeoxyribonucleotide/RNase H method and (see, e.g., Lee NS et al., nature with degraded Biology techniques, volume 20: 500-05 page, 2002) (Lee NS et al., NatureBiotechnol.20:500-05 (2002))。

Alternatively, hair clip siRNA expression cassette is configured to comprise the positive-sense strand of target, is followed by a shorter interval, target Antisense strand, and 5-6 T is as transcription terminator.Positive-sense strand and the order of antisense strand in siRNA expression construct can change Become, and do not affect the active for gene silencing of hair clip siRNA.In certain embodiments, the reversion of order may cause gene silencing The part of activity reduces.

Length as the nucleotide sequence of the trunk of siRNA expression cassette can such as change in the range of 19-29. The size of ring can change in the range of 3-23 nucleotide.Other length and/or ring size can also use.

In another one embodiment, it is possible to use 5 ' extensions of hair clip siRNA construct, condition is hair clip siRNA Function in gene silencing.In a specific embodiment, 5 ' extensions include about 6 nucleotide residues.

In another one embodiment, the target sequence of RNAi is 21 sequence monomer fragments.5 ' ends of target sequence Having a dinucleotide " NA ", wherein " N " can be any base and " A " represents adenine.Remain 19 sequence monomers there is GC to contain Amount is between 35% and 55%.It addition, residue 19 sequence monomers do not include any four continuous print A or T (that is, AAAA or TTTT), three continuous print G or C (that is, GGG or CCC), or seven " GC " in a line.

Other standard can be used for selecting RNAi target sequence.Such as, the G/C content remaining 19 sequence monomers can limit System is between 45% and 55%.And, any have three identical bases of continuous print (that is, GGG, CCC, TTT, or AAA) or tool 19 sequence monomers having the palindrome of 5 or more base are all excluded.Further, remain 19 sequence monomers can be chosen as There is the low sequence homology with other gene.In a specific embodiment, potential target sequence passes through BLASTN pin Mankind UniGene (term single gene) bunch sequence library of NCBI is searched for.Mankind UniGene data base contains nonredundancy collection Gene targeting bunch.Each UniGene bunch of sequence including representing a unique gene.Can select under BLASTN searches for Do not produce 19 sequence monomers of the collision to other human gene.Under this search, e-value could be arranged to tight value (such as “1”)。

SiRNA sequence, and the expression of other RNAi sequence pair silence target gene any derived according to the present invention Effectiveness, can evaluate by multiple method known in the art.

Term " reticent " and " suppression is expressed ", " lower and express ", " gag expression " etc., when it points to target gene, this At least part of suppression of the expression of literary composition middle finger target gene, shows as the minimizing of the amount of target mRNA, and it can be turned from target gene First cell of record or groups of cells are separated, and the processed expression making target gene is suppressed, compared to the Two cells or groups of cells, it is substantially identical with the first cell or groups of cells, but its not processed (compared with control cells).Suppression journey Spend usual following term to express:

(compared with control cells mRNA)-(process cell mRNA) * 100%

(compared with control cells mRNA)

Alternatively, suppression degree can obtain according to the reduction of the parameter contacted with target gene expressive function, example Such as the amount of albumen of, target gene coding or show the number of certain phenotypic cell.In principle, target gene group silence can To determine in any cell of constitutive character or gene engineering expression target, by any suitable analysis.But, when needs are joined Examine to determine given nucleic acid whether with to a certain degree suppress target gene expression and thus when comprising in the present invention, hereafter real Execute in example provide and analysis known in the art will be as such reference.Such as, in some example, the table of target gene Reach by the administration suppression at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45% of double chain oligonucleotide, or 50%.In some embodiments, target gene is administered suppression at least 60%, 70%, or 80% by double chain oligonucleotide.One In a little embodiments, target gene is administered suppression at least 85%, 90%, or 95% by double chain oligonucleotide.

Such as, the cell of expression target gene can be imported into according to the nucleotide sequence of the present invention.Intracellular target gene MRNA level in-site can by use RT-PCR (reverse transcriptional PCR), RNA trace or other standard method any measure.Optional Ground, the level of polypeptide of target mRNA coding can use Western blotting, ELISA (enzyme-linked immunosorbent assay) or any other Immunology or nonimmune method are measured.Import mRNA or the protein expression of target gene coding after siRNA sequence The material alterations of level imply that the siRNA sequence effectiveness in the expression of suppression target gene.A concrete enforcement In example, before and after importing siRNA sequence, the expression of other gene is also monitored.Can select target gene is expressed There is inhibition and the siRNA of the expression of other gene of not appreciable impact.In another specific embodiment, multiple SiRNA or other RNAi sequence can be imported in identical target cell.These siRNA or RNAi sequence-specifics suppression target Mark gene expression and do not affect the expression of other gene.In another one specific embodiment, it is possible to use suppression target base The siRNA of the expression of cause and other gene or other RNAi sequence.

It would be recognized by those skilled in the art that the specificity of the nucleic acid molecules of conjugate incorporated herein selects to rely on The type of selective reagent in conjugate.Thus, nucleic acid is to expressing the target being expressed in the cell of neurotransmitter transporters Molecule is specific, and neurotransmitter transporters therein is specific binding with selective reagent.

In one preferred embodiment, nucleic acid is to 5-hydroxytryptamine receptor Class1 A (5-HT_1A) it is specific.At core Acid is antisense, and in the case of siRNA, shRNA or ribozyme, nucleic acid is by working, this with target molecules base pairing In the case of target molecules be coding 5-hydroxytryptamine receptor Class1 A (5-HT_1A) mRNA.If nucleic acid is aptamers, target molecules It is 5-hydroxytryptamine receptor Class1 A (5-HT_1A) polypeptide.

Term " Class1 A 5-hydroxytryptamine receptor " or " 5-HT_1AR ", as used herein, refer to main at presynaptic 5-hydroxy tryptamine The class 5-hydroxytryptamine receptor found in serotonergic neuron.These receptors are activated by extracellular 5-hydroxy tryptamine, cause cell discharge to be lived Property reduction, and thus reduce in major forebrain areas 5-hydroxy tryptamine release.This negative feedback limits synapse 5-hydroxy tryptamine Increasing, it can be by the acute induction of antidepressants.Over time, the autoreceptor of body dendron becomes insensitive, it is allowed to The complete effect of SSRI is expressed at forebrain.This time period has been found to the incubation period of the outbreak corresponding to antidepressant activity [Jefferson Pérez, V., et al., lancet, 1997, volume 349: 1594-1597 page] [Perez, V., et al., The Lancet, 1997,349:1594-1597].Thus, it is the intracellular of inactivation at 5-hydroxy tryptamine Class1 A receptor, as blocking 5- The increase of the extracellular 5-hydroxy tryptamine of the result of hydroxytryptamine transporter will not result in the reduction of cell firing activity, thus prevents Relevant negative feedback is processed to serotonin reuptake inhibitor.

Can be able to be any Class1 A by the Class1 A 5-hydroxytryptamine receptor of the nucleic acid targeting of the conjugate of the present invention 5-hydroxytryptamine receptor, includes, but not limited to mankind 5-HT_1AR, its sequence in SwissProt data base in accession number P08908 Under be given, mice 5-HT_1AR, its sequence is given in SwissProt data base under accession number Q64264, rat 5-HT_1AR, Its sequence is given in SwissProt data base under accession number P19327, Canis familiaris L. 5-HT_1AR, its sequence is in SwissProt data Storehouse is given under accession number Q6XXX9.

It would be recognized by those skilled in the art that coding 5-HT_1AThe mRNA of R is that the nucleic acid of the specific present invention can be used Any method mentioned above selects, and tests the ability of the substantial reduction of the level of the corresponding mRNA of its induction.The present invention Author identified 5-HT_1AThe region of the sequence of R mRNA, it can be preferentially targeted by the nucleic acid of the present invention.These regions Region corresponding to high conservative between different plant species or the non-coding region corresponding to major transcription product, to avoid coding Region is translated the potential interference of complex.

Therefore, in one preferred embodiment, nucleic acid array complementation is in corresponding to mice 5-HT_1ARmRNA is (at NCBI The sequence of accession number NM_008308 of data base) nucleotide 621-1640 or the region of nucleotide 1880-2400, or other The 5-HT of species_1AThe corresponding region of R cDNA.Described corresponding region can be by contrast to described cDNA and mice 5-HT_1AR CDNA or by multiple ratio to different 5-HT_1AWith mice 5-HT in R cDNA discriminating other cDNA described_1AIn R cDNA The region selecting region overlapping determines.

Method to two given nucleotide sequences is to well known to a person skilled in the art in contrast, can pass through BLASTN [BLAST handbook, Altschul, S., et al., the US National Biotechnology Information center state-run health of state-run medical library is ground Study carefully institute, Bei Saisida, Malaysia and China Lanzhou 20894 (BLASTManual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md.20894), Altschul, S., et al., J. Mol. BioL, volume 215: 403-410 page, nineteen ninety (Altschul, S., et al., J.Mol.Biol.215:403-410 (1990))] canonical algorithm realize, use acquiescence ginseng Number.The comparison method of multiple nucleotide sequences can use CLUSTALW (Thompson JD et al., nucleic acids research, 1994, the 22nd Volume: 4673-4680 page (Thompson JD et al, Nucleic Acids Res, 1994,22:4673-4680)) standard Algorithm realizes, and uses default parameters.Once 5-HT in different plant species_1AThe region of R cDNA is authenticated, it is possible to differentiate permissible The Suitable nucleic acids sequence of the nucleic acid of conjugate incorporated herein.In one preferred embodiment, the conjugate of the present invention Comprising such nucleotide sequence, it comprises targeting 5-HT_1ASelected from SEQ IDNO:1 (mice 5-HT in R mRNA_1AThe core of R mRNA Thuja acid 1841-1910), SEQ ID NO:2 (mice 5-HT_1AThe nucleotide 591-700 of R mRNA), SEQ ID NOSEQ ID NO:3 (mice 5-HT_1AThe nucleotide 831-940 of RmRNA), SEQ ID NO:4 (mice 5-HT_1AThe nucleotide 2120-of R mRNA 4441) nucleotide sequence in region.

In a preferred embodiment, the nucleic acid of the conjugate of the present invention comprises selected from SEQ IDNO 5, SEQ ID NO7, SEQ ID NO:9, and SEQ ID NO:11 sequence (seeing table 2) provided that nucleic acid be double-strandednucleic acid (example As, siRNA), oligonucleotide matches by SEQ IDNO6, SEQ ID NO8, SEQ ID NO:10, and SEQ ID NO:12 provides Corresponding antisense sequences (seeing table 2).In another embodiment, the nucleic acid of the present invention is for coding 5-hydroxy tryptamine transporter MRNA (its amplifying nucleic acid by with target base pairing and work) or as this type of 5-hydroxy tryptamine transporter (its amplifying nucleic acid make For aptamers by directly in conjunction with suppression polypeptide active and work).Term " 5-hydroxy tryptamine transporter " or " SERT ", such as this Literary composition is used, refers to such polypeptide, and it is a kind of integral membrane protein, and transports neurotransmitter serotonin from synaptic space to synapse Front neuron.The sequence of the mankind, rat, mice and cattle SERT is provided in SwissProt data base, and accession number is respectively P31645, P31652, Q60857 and Q9XT49.With targeting 5-HT_1AThe nucleic acid of R cDNA is similar to, any district in SERT cDNA Territory can be targeted, as long as it causes the substantive suppression of level of albumen of mRNA or described mRNA coding of correspondence.Therefore, Suitably SERT-specific nucleic acid can differentiate according to described above, after having contacted tested nucleic acid by described cell Measure SERT mRNA or the level of SERT albumen in the cell expressing SERT.

By the way of embodiment, it is possible to use be described in molecule psychiatry, in August, 2005；The 8th phase of volume 10: 782-9, page 714 (Mol.Psychiatry.2005 Aug；10 (8): 782-9,714) and receptor. signal transmits. research magazine 2006；Volume 26: 527-47 page (J.Recept.Signal Transduct.Res.2006；SERT-26:527-47) is special Opposite sex siRNA.In an embodiment more preferably, SERT-specific siRNA contains sequence

5 ' CUCCUGGAACACUGGCAACdTdT 3 ' (SEQ ID NO:13)

In another one embodiment, SERT-specific siRNA comprises the sequence described in Table X.

Except presynaptic 5-HT1_A, it is also possible to by regulation 5-HT1_ASome ion channels in behavior downstream and regulate 5- HT1_ABehavior, such as TREK-1 or GIRK.These passages make film hyperpolarization by producing the inflow of a large amount of potassium ions thus regulate Neuronal activity.The change of these transmembrane potentials, it is suppressed that Neural spike train.It has been proposed that TREK-1 or GirK agonist will improve Neuronal activity.This by finally upset high level 5-hydroxy tryptamine in the presence of presynaptic 5-HT_1AInhibition.

In another embodiment, the nucleic acid of the present invention is for coding 5-HT_1AThe ion channel worked in behavior downstream MRNA (its amplifying nucleic acid is by working with target base pairing) or for 5-HT_1AThe ion channel worked in behavior downstream (its amplifying nucleic acid as aptamers by directly in conjunction with or suppression polypeptide active and work).Those passages are by producing a large amount of potassium Ion flows into and makes film hyperpolarization thus regulate neuronal activity.Inhibitory neuron is discharged by the change of transmembrane potential.This will be final Upset the presynaptic 5-HT in the presence of high level 5-hydroxy tryptamine_1AInhibition.5-HT in a preferred embodiment_1ADownstream The ion channel worked is TREK-1 or GIRK.

Term " TREK-1 ", as used herein, refer to also referred to as KCNK2, TREK, TPKC1, K2p2.1, TREK1, hTREK- The polypeptide of 1c, hTREK-1e, MGC126742, MGC126744 and KCNK2, it is diplopore territory type background potassium-channel, by two Individual homodimer is formed, and it sets up a passage making potassium ion discharge from cell to control resting membrane potential.But, this passage Can be opened by some anesthetis, film stretching, intracellular acidosis and heat.In the mankind, there are three kinds by TREK base Because of alternative splicing and the hypotype that causes, provide under following accession number at ncbi database: NP_001017424.1, NP_ 001017425.2 and NP_055032.1.Canis familiaris L. (domesticated dog), chimpanzee (chimpanzee), cattle (cattle), rat (Rattus norvegicus) and mice The TREK-1 xenogenesis isotype of (house mouse) provides in NCBI Protein Data Bank respectively under following accession number: XP_ 849278, XP_001171677, NP_777111, NP_742038 and NP_034737.With targeting 5-HT_1AThe nucleic acid of R cDNA Seemingly, any region in TREK-1 cDNA all can be targeted, as long as it causes the albumen of corresponding mRNA or described mRNA coding Level significantly suppressed.Thus, suitable TREK-1-specific nucleic acid can differentiate according to mentioned above, by described Cell measures intracellular TREK-1 mRNA or the level of TREK-1 albumen expressing TREK-1 with tested nucleic acid after contacting.

The TREK-1 specific siRNA of the conjugate that may be used for the present invention includes, but not limited to by Santa Cruz biological The sc-37180 siRNA that technology company (Santa Cruz Biotechnology) provides, and described in the US2009317811 Antisense molecule.

The inward rectifier potassium channels of term G-protein coupling, GIRK or Kir3.x, as used herein, refer to inward rectification Any member of potassium-channel family, it conducts by originating in the signal of the g protein coupled receptor (GPCR) of ligand activation Cascade is activated (opening).GPCR is successively from the G-protein β γ of disactivation Heterotrimeric G-Protein complex (G α β γ) release activation Subunit (G β γ).Final G β γ protein dimerization with GIRK channeling so that its opening thus it becomes permeable to potassium ion, Cause the hyperpolarization of cell.The inward rectifier potassium channels of G-protein coupling is the ion channel of a kind of G-protein gate, due to GIRK passage is by G-protein subunit direct activation.

Suitably GIRK includes, but not limited to all members of J subfamily, including member 3 (also referred to as GIRK1 or Kir3.1) such as mankind GIRK1, corresponding to the nucleic acid differentiated under accession number U39196 of NCBI gene database, or it is referred to as The brain variant of GIRKd, member 6 (also referred to as GIRK2 or Kir3.2) such as mankind GIRK2, corresponding to NCBI gene database The nucleic acid differentiated under accession number U24660, member 9 (also referred to as GIRK3 or Kir3.3) such as mankind GIRK3, corresponding to NCBI base The nucleic acid differentiated under accession number U52152 of factor data bank, member 5 (also referred to as GIRK4 or Kir3.4) such as mankind GIRK4 is right The nucleic acid that should differentiate under accession number U39195 of NCBI gene database, member 2 (also referred to as IRK1 or Kir2.1) such as people Class IRK1, corresponding to the nucleic acid differentiated under accession number U24055 of NCBI gene database, and member 4 (also referred to as IRK3 or Kir2.3) such as mankind IRK3, corresponding to the nucleic acid differentiated under accession number U07364 of NCBI gene database.

Can the suitable nucleic acid of targeting GIRK include, such as, the ribozyme described in WO2005054848, antisense molecule.

Targeting 5-HT_1AR mRNA or 5-HT_1AR albumen, SERT mRNA or albumen, TREK-1mRNA or albumen or GIRK Those nucleic acid of mRNA or albumen are preferably coupled to can be in conjunction with the selective reagent of neurotransmitter transporters, described neurotransmitter Transporter is present in 5-HT_1AIn the cell that R, SERT, TREK-1 or GIRK are expressed, i.e. dopaminergic neuron.Thus, this The conjugate of invention comprises 5-HT_1AR-specific nucleic acid, SERT-specific nucleic acid, TREK-1 specific nucleic acid or GIRK-are special Property nucleic acid, it is coupled to can be in conjunction with the selective reagent of 5-hydroxy tryptamine transporter, and it can be that non-selective 5-hydroxy tryptamine turns Fortune body (such as SRI or SNRI) or, it is further preferred that selective serotonin reuptake inhibitor (SSRI).

In another embodiment, the nucleic acid of a part of the conjugate of the present invention is formed for synapse nucleoprotein.

Term " synapse nucleoprotein ", as used herein, refer to the polypeptide of synapse nucleoprotein member family, it comprises high conservative Alpha-helix fat binding motif, similar to the A2 lipoid binding structural domain of commutative apolipoproteins, and can be formed referred to as The intracellular aggregates of Louis body, it occurs in some sacred disease, such as parkinson disease, Alzheimer and Louis body Sick.Term " synapse nucleoprotein " refers to alpha-synapse nucleoprotein, β-synapse nucleoprotein or γ-synapse nucleoprotein.A preferred reality Executing in mode, the nucleic acid of the part forming the conjugate of the present invention is special to alpha-synapse nucleoprotein.

The sequence of the mankind, rat, mice and cattle alpha-synapse nucleoprotein is respectively by the following accession number of SwissProt data base There is provided: P37840, P37377, O55042 and Q3T0G8.With targeting 5-HT_1AThe nucleic acid of RcDNA is similar to, and alpha-synapse nucleoprotein is special Property nucleic acid can differentiate by any method described above or select, and test its induction corresponding mRNA or described mRNA coding The ability significantly suppressed of level of albumen.Thus, suitable alpha-synapse nucleoprotein specific nucleic acid can be as described above Differentiate, measure alpha-synapse nucleoprotein mRNA or alpha-synapse nucleoprotein after being contacted with tested nucleic acid by described cell and expressing The intracellular level of alpha-synapse nucleoprotein.

In one preferred embodiment, alpha-synapse nucleoprotein specific nucleic acid for mankind's alpha-synapse nucleoprotein- The region of cDNA.In another embodiment, the nucleic acid of the present invention is for coding 5-HT_1AThe ion worked in behavior downstream leads to The mRNA (its amplifying nucleic acid is by working with target base pairing) in road or for 5-HT_1AThe ion worked in behavior downstream leads to Road (its amplifying nucleic acid as aptamers by directly in conjunction with or suppression polypeptide active and work).Those passages are a large amount of by producing Potassium ion flows into and makes film hyperpolarization thus regulate neuronal activity.Inhibitory neuron is discharged by this change of transmembrane potential.This By finally upset high level 5-hydroxy tryptamine in the presence of presynaptic 5-HT_1AInhibition.5-in a preferred embodiment HT_1AThe ion channel worked in downstream is TREK-1.

Suitable targets region in alpha-synapse nucleoprotein-mRNA includes, but not limited to those described in WO07135426 (such as nucleic acid), and specifically siRNA, comprise the sequence of group selected from the siRNA described in the WO2006039253, such as

5 '-GGAAAGACAAAAGAGGUGdTdT-3 ' SEQ ID NO:16

5 '-GGAAAGACAAAAGAGGUGdTdT-3 ' SEQ ID NO:17

5 '-GGAGGAAUUUUAGAAGAGGdTdT-3 ' SEQ ID NO:18

5 '-UGUUGGAGGAGCAGUGGUGdTdT-3 ' SEQ ID NO:19

5 '-GGACCAGUUGGGCAAGAAUdTdT-3 ' SEQ ID NO:20

Or hairpin oligonucleotide, has sequence

5’-GATCCCCGGACCAGTTGGGCAAGAATTTCAAGAGAATTCTTGCCAACTGGTCCTTTTTGGAAA-3’ With

5’-CTAGTTTCCAAAAAGGACCAGTTGGGCAAGAATTCTCTTGAAATTCTTGCCCAACTGGTCCGGG- 3’

Correspond respectively to SEQ ID NO:21 and 22.

Other synapse nucleoprotein specific siRNA sequence is those (embodiments XVII being described in US2008139799 Described in sequence, its content is included from there through quoting) and WO2009079399 described in siRNA sequence, choosing Group from following:

5 '-GGUGUGGCAACAGUGGCUGAG-3 ' SEQ ID NO:23

5 '-AACAGUGGCUGAGAAGACCAA-3 ' SEQ ID NO:24

5 '-AUUGCAGCAGCCACUGGCUUU-3 ' SEQ ID NO:25

5 '-AAGUGACAAAUGUUGGAGGAG-3 ' SEQ ID NO:26

5 '-GAAGAAGGAGCCCCACAGGAA-3 ' SEQ ID NO:27

5 '-CGGGUGUGACAGCAGUAGCdTdT-3 ' SEQ ID NO:28

5 '-UCCUGACAAUGAGGCUUAUdTdT-3 ' SEQ ID NO:29

5′-U*CCUGACAAUGAGGCUUAUdT*dT-3 ' SEQ ID NO:30

5 '-CUACGAACCUGAAGCCUAAdTdT-3 ' SEQ ID NO:31

5′-C*UACGAACCUGAAGCCUAAdT*dT-3 ' SEQ ID NO:32

5 '-C*UACGAACCUGAAGCCUAAdT*dT-3 ' SEQ ID NO:33

5 '-CUAUUGUAGAGUGGUCUAUdTdT-3 ' SEQ ID NO:34

5′-C*UAUGAGCCUGAAGC*UAAT*T-3 ' SEQ ID NO:35

5′-C*UAUGAGCCUGAAGCCUAAT*T-3 ' SEQ ID NO:36

Wherein * represents phosphorothioate bond, and the nucleotide of underscore represents 2 '-O-Me and modifies.

They are preferably coupled to can be in conjunction with the choosing of neurotransmitter transporters present in the cell of expression synapse nucleoprotein Selecting property reagent.Thus, the conjugate of the present invention comprises synapse nucleoprotein specific nucleic acid, and it is coupled to mediate internalization and enters The selective reagent of monoaminergic nerve unit.Thus, the nucleic acid of targeting synapse nucleoprotein mRNA or albumen is coupled to promote institute State nucleic acid internalization and enter 5-hydroxy tryptamine energy, norepinephrine energy and/or the reagent of dopaminergic neuron.Therefore, at one In preferred embodiment, synapse nucleoprotein specific nucleic acid is coupled to 5-hydroxy tryptamine energy, norepinephrine energy and DOPA The selective reagent of aminergic neuron, it is selected from dopamine reuptake inhibitor (DRI), and norepinephrine-dopamine is taken the photograph again Take the group of inhibitor (NDRI) (SNDRI or three times-blocker).

In another embodiment, the nucleic acid of part of the conjugate of the present invention is formed for nitric oxide synthetase (NOS)。

As used herein, " nitric oxide synthetase " or " NOS " meaning is natural the depositing of internal catalysis nitric oxide synthesis Enzyme.Nitric oxide (NO) by the guanidino group of L-arginine by the enzyme family of referred to as nitric oxide synthetase (NOS) Synthesis.This term application is in all hypotypes of nitric oxide synthetase (NOS) found in biosystem and includes, but does not limits In, the constitutive character form of NOS, NOS3 (eNOS), neuronal nitric oxide synzyme (nNOS) and can luring Lead nitric oxide synthetase (iNOS).

The sequence of the iNOS of the mankind, rat, mice, Canis familiaris L. and cattle is respectively provided for the accession number of SwissProt data base Under P35228, Q06518, P29477, O62699 and Q27995.The sequence of the eNOS of the mankind, rat, mice and cattle provides respectively Under accession number P29474 of SwissProt data base, Q62600, P70313 and P29473.The mankind, rat, mice and cattle The sequence of nNOS is respectively provided under accession number P29475 of SwissProt data base, P29476, Q9Z0J4 and P29473.

Any region in NOS cDNA all can be targeted, as long as it causes the albumen of corresponding mRNA or described mRNA coding Level significantly suppressed.Thus, suitable NOS-specific nucleic acid can differentiate as mentioned before, by described cell Measure intracellular NOS mRNA or the level of albumen of NOS expression after contacting tested nucleic acid, or be determined by the thin of process The NOS activity of intracellular.NOS activity can be measured by any method known in the art, to determine iNOS, eNOS and nNOS Activity, depends on the circumstances.Such as, NOS activity can by radiometry method measure [³H]-arginine to [³H]-L-melon ammonia The conversion of acid and determine, or utilize in lattice this (Griess) to analyze in nitric oxide is formed.

Suitable NOS-specificity silencing agent includes, but not limited to the nNOS-specificity described in WO08100591 SiRNA, by following polynucleotide to obtaining:

-CAAAGAGATCGACACCATC (SEQ ID NO:58) (just),

GATGGTGTCGATCTCTTTGTT (SEQ ID NO:59) (antisense)；

-CACGCATGTCTGGAAAGGC (SEQ ID NO:60) (just) and

GCCTTTCCAGACATGCGTGTT (SEQ ID NO:61) (antisense)；

-GGTCTATCCAATGTCCACA (SEQ ID NO:62) (just) and

TGTGGACATTGGATAGACCTT (SEQ ID NO:63) (antisense)

-there is the iNOS-specific siRNA of following sequence: 5 '-

CCACCAGTATGCAATGAAT-3 ' (SEQ ID NO:64)

-the eNOS-that can obtain from hero company (Invitrogen) (Carlsbad, California) (Carlsbad, CA) Specific siRNA, has oligomer discriminating HSS 107326, HSS 107327 and HSS 107328

INOS-described in the table 2 of-virtue et al. (Fang et al.) (RNA, 2010, volume 16: 1429-1435 page) Specific siRNA

-there is the iNOS-specific siRNA of following sequence: 5 '-

ACAACAGGAACCUACCAGCTT-3 ' (SEQ ID NO:65) (just) and 5 '-

GCUGGUAGGUUCCUGUUGUTT-3 ' (SEQ ID NO:66) (antisense).

Exemplary and the non-limiting NOS specific antisense thing being suitable for the present invention includes:

-there are the iNOS-specific antisense oligo of following sequence: 5 '-ACAGCTCAGTCCCTTCACCAA-3 ' (SEQ ID NO:67), be described in Richard Grasso et al. (Grasso et al.) (experimental biology and medical science, 2003, the 228th Volume: 491-8 page).(Exp.Biol.Med., 2003,228:491-8)

-there is the iNOS-specific antisense oligo of following sequence: 5 '-TTTGCCTTATACTGTTCC-3 ' (SEQ ID NO:68) be described in black nurse uncommon et al. (Hemmrich et al.) (American Physiological Association's magazine, cytophysiology, 2003 Year, volume 285: C489-C498) (Am.J.Physiol.Cell Physiol., 2003,285:C489-C498).

The iNOS-specific antisense oligo that in-WO0152902, Tables 1 and 2 describes.

INOS-described in the table 1 of-virtue et al. (Fang et al.) (RNA, 2010, volume 16: 1429-1435 page) Specific antisense molecule.

NOS specificity silencing agent is preferably coupled to can neurotransmitter transhipment present in the cell in conjunction with NOS expression The selective reagent of body.Thus, the conjugate of the present invention comprises NOS specific nucleic acid, and it is coupled to mediate internalization and enters The selective reagent of monoaminergic nerve unit.Thus, the nucleic acid of targeting synapse nucleoprotein mRNA or albumen is coupled to promote institute State nucleic acid internalization and enter 5-hydroxy tryptamine energy, norepinephrine energy and/or the reagent of dopaminergic neuron.Therefore, at one In preferred embodiment, synapse nucleoprotein specific nucleic acid is coupled to 5-hydroxy tryptamine energy, norepinephrine energy and DOPA The selective reagent of aminergic neuron, it is selected from dopamine reuptake inhibitor (DRI), and norepinephrine-dopamine is taken the photograph again Take the group of inhibitor (NDRI) (SNDRI or three times-blocker).

In another embodiment, the nucleic acid of part of the conjugate of the present invention is formed for noradrenaline transporter Body.

Term " norepinephrine transporter ", " NAT ", " noradrenaline transporter " or " NET " are used in this article Regardless of referring to monoamine transporter distinctively, neurotransmitter norepinephrine (noradrenaline) and dopamine are transported by it from synapse Return in vesicle to store until using.NET is 617 amino acid longs, comprises 12 membrane spaning domains, by SLC6A2 base Because of coding.

The mankind, Canis familiaris L. (Canis familiaris), chimpanzee, (Pan troglodytes), and cattle (Bostaurus), rat The sequence of the norepinephrine transporter of (Rattus norvegicus) and mice (Mus musculus) is respectively at NCBI number According to accession number P23975 in storehouse, XM_544398.2, XM_001167680.1, NM_174608.2, NM_031343.1 and NM_ There is provided for 009209.2 time.Any region in NET cDNA all can be targeted, as long as it causes corresponding mRNA or described mRNA The significantly suppression of the level of the protein of coding.Thus, suitable NET-specific nucleic acid can differentiate as mentioned before, logical Cross after the tested nucleic acid of described cells contacting, measure intracellular NET mRNA or the level of albumen expressing NET.

Suitable NET-specific nucleic acid includes, but not limited to any SLC6A2-specific RNA i such as can be from hero Accession number HSS109852 that company (Invitrogen) obtains, the RNAi under HSS109853 and HSS185858.

In another embodiment, the nucleic acid of part of the conjugate of the present invention is formed for dopamine-β-hydroxylation Enzyme.

Term " dopamine-β-hydroxylation enzyme ", as used herein, referring to Dopamine Turnover is norepinephrine Polypeptide.

The sequence of the dopamine of the mankind, rat, mice and cattle-β-hydroxylation enzyme stepping at NCBI Protein Data Bank respectively There is provided under record NP_000778, NP_037290, NP_620392 and NP_851338.With other nucleic acid of the targeting according to the present invention Nucleic acid be similar to, any region in dopamine-β-hydroxylation enzyme cDNA all can be targeted, as long as its cause corresponding mRNA or The significantly suppression of the level of the protein of described mRNA coding.Thus, suitable dopamine-β-hydroxylation enzyme-specific nucleic acid Can differentiate as mentioned before, express dopamine-β-hydroxylation enzyme by measuring after the tested nucleic acid of described cells contacting Intracellular dopamine-β-hydroxylation enzyme mRNA or the level of albumen.

Suitably dopamine-β-hydroxylation enzyme-specific nucleic acid includes, but not limited to described in WO2008019159 There is the nucleic acid of following sequence:

5 '-GACCACGUACUGGUGCUACAUTA-3 ' (SEQ ID NO:37)

And commercially available dopamine-β-hydroxylation enzyme-specific nucleic acid, such as can be biological from Santa Cruz Technology company (Santa Cruz Biotechnology) (catalogue #sc-35180), from hero company (Invitrogen) (catalogue #HSS175953, HSS175954 and HSS175955), from Ya Nuofa company (Abnova) (catalogue # H00001621-R01), Applied biosystems (Applied Biosystems) (siRNA ids s3946, s3947 And s3945) dopamine-β-hydroxylation enzyme spcificity siRNA of obtaining.

The nucleic acid of those targeting dopamine-β-hydroxylation enzyme mRNA or albumen is preferably coupled to can be in conjunction with such cell Present in neurotransmitter transporters, wherein said cell is expressed in dopamine-β-hydroxylation enzyme and wherein said cell Need the shortage reducing the neurotransmitter causing case-specific situation with compensation of dopamine-β-hydroxylation enzyme.Thus, the present invention Conjugate comprise dopamine-β-hydroxylation enzyme spcificity nucleic acid, it is coupled to suppress in conjunction with norepinephrine reuptake The selective reagent of agent (NRI).

In another embodiment, the nucleic acid specificity of the part of the conjugate of the composition present invention is for BAX.Term " BAX " or " BCL2 be correlated with X protein " is as used herein, refers to promote apoptosis BCL-2 family member, its activation relate to subcellular fraction transfer and Dimerization.In living cells, the be correlated with major part of X protein of BCL-2 is single aggressiveness and finds in Cell sap or relax with film Connect.Under death stimulates, the poly-BCL2-of Cell sap list X protein of being correlated with is transferred to mitochondrion, and in this, it becomes crosslinkable film Integral protein.BCL-2 is correlated with, and to form the ability of the conductance fenestra of ion of uniqueness may be partly to cause cell death to X protein The reason of mitochondria dysfunction (Coase prunus mume (sieb.) sieb.et zucc. is refined et al., Cold SpringHarbor quantitative biology, 1999, volume 64,343-350 page； Coase prunus mume (sieb.) sieb.et zucc. is refined et al., cell death and variation, 2000, volume 7,1166-1173 page) (Korsmeyer et al., Cold Spring Harb.Symp.Quant.Biol., 1999,64,343-350；Korsmeyer et al., Cell Death Differ., 2000,7,1166-1173).Term " BAX " refers to its any shearing variant, including BAX-α (GenBank accession number L22473), BAX-β (GenBank accession number NM004324)), BAX-γ (oere Te Woyi et al., cell, 1993, the 74th Volume, 609-619 page) (Oltvai et al., Cell, 1993,74,609-619), BAX-δ (GenBank accession number AI382305) (A Pute et al., genomics, nineteen ninety-five, volume 26,592-594) page (Apte et al., Genomics, 1995,26,592-594), BAX-ω (GenBank accession number AF008196) (week et al., journal of biological chemistry, 1998 years, the Volume 273,11930-11936 page) (Zhou et al., J.Biol.Chem., 1998,273,11930-11936) and BAX-ε (GenBank accession number AF007826) (suitable et al., biochemistry and biophysical research communication, 1999, volume 254,779- Page 785) (Shiet al., Biochem.Biophys.Res.Commun., 1999,254,779-785).Coding BAX-α, BAX- The nucleotides sequence of β and BAX-γ is listed in disclosed in U.S. Patent number 5,691,179 and 5,955,595 and prescription.Coding The nucleotides sequence of BAX-ω is listed in disclosed in U.S. Patent number 6,140,484 and corresponding PCT Publication WO 97/01635 and requirement Right.U.S. Patent number 6,140,484 also disclosing that, 22 of exon 5/ intron 5 junction for mankind BAX-ω is gathered Body antisense oligonucleotide.

Suitable BAX-specific nucleic acid for the conjugate according to the present invention includes:

-sequence 5 '-UCGAUCCUGGAUGAAACCCtg-3 ' (SEQ ID NO:38) (described in CN101255422),

83-102 and the 103-122 bit base of-targeting mankind BAX (Manfredi Buddhist nun et al., open by antisense nucleic acid medicament Send out, 1998, volume 8, (Manfredini etal., Antisense Nucleic Acid Drug described in 341-350 page Dev., 1998,8,341-350)) and neutrophil (Di Bo top grade people, PNAS, 1999, volume 96, 13330-13335 page (Dibbert et al., Proc.Natl.Acad.Sci.U.S.A., 1999,96,13330-13335)) Antisense oligonucleotide.

Arbitrary sequence disclosed in-US20040077583 (table 1 and 3), its content is incorporated herein by.

The nucleic acid of targeting BAX mRNA or albumen is preferably coupled to pass in conjunction with nerve present in the cell of expression BAX The selective reagent of matter transporter.Thus, the conjugate of the present invention comprises BAX specific nucleic acid, in it is coupled to mediate Change and enter 5-hydroxy tryptamine energy, norepinephrine energy and the selective reagent of dopaminergic neuron.Therefore, at one preferably In embodiment, selective reagent presses down selected from dopamine reuptake inhibitor (DRI) or norepinephrine-dopamine reuptake Preparation (NDRI) or 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor (SNDRI or three times-blocker).

In another embodiment, nucleic acid targeting microtubule-associated protein taumRNA of the conjugate of the present invention or albumen. Term " tau " refers to any albumen of Protein tau family, includes but not limited to, any source includes the mankind (P10636), Canis familiaris L. (XM_ 844939), chimpanzee (NM_001009068.1), mice (Z12133), Brachydanio rerio (BI981282.1) and nematicide (NM_ 001027407.2) natural Protein tau monomer, precursor Protein tau, tau peptide, tau intermediate, metabolite and tau are derivative Thing, it can be stood and cause conjugate spirals fiber filaments and the super phosphorylation of fibers straight filament self assembly confusion, relate to A Erci The silent disease in sea and the pathological pathogeny of other tau.

Suitably tau-specific nucleic acid includes, but are not limited to:

The siRNA with following sequence described in-WO2005118858:

5 '-AATCACACCCAACGTGCAGAA-3 ' (SEQ ID NO:39)

With

5 '-AACTGGCAGTTCTGGAGCAAA-3 ' (SEQ ID NO:40)

The siRNA with following sequence described in-US2004241854:

-Caceres et al., neurobiology magazine, 1991, volume 11: 1515-1523 page (Caceres et Al.J.Neuroscience, 1991,11:1515-1523) the tau-specific antisense nucleic acids with following sequence described in:

GGTTCAGCCATGCTGCTTCAAAGCC SEQ ID NO:53

With

TGATAATCGACAGGAGGCGAGGACA SEQ ID NO:54

The nucleic acid of targeting tau mRNA or albumen is preferably coupled to pass in conjunction with nerve present in the cell of expression Tau The selective reagent of matter transporter.Thus, the conjugate of the present invention comprises Tau-specific nucleic acid, in it is coupled to mediate Change the selectivity examination entering monoaminergic nerve unit especially 5-hydroxy tryptamine energy, norepinephrine energy and dopaminergic neuron Agent.Therefore, in one preferred embodiment, selective reagent is selected from dopamine reuptake inhibitor (DRI) or nor-kidney Upper parathyrine-dopamine reuptake inhibitor (NDRI) or 5-hydroxy tryptamine-norepinephrine-dopamine reuptake inhibitor (SNDRI or three times-blocker).

In another embodiment, the nucleic acid targeting Huntingdon mRNA of the conjugate of the present invention or protein.Term is " prosperous Pause albumen in the court of a feudal ruler " refer to the albumen of the 350kDa of the unknown function of UniPortKB database login P42858, and leave login in The albumen of the nucleic acid sequence encoding under number L12392, and in Canis familiaris L. (NCBI accession number XP_536221.2), (NCBI logs in chimpanzee Number XP_517080.2), cattle (NCBI accession number XP_871851.2), rat (NCBI accession number XP_573634.1) or mice Its ortholog thing found in (NCBI accession number NP_034544.11), and its variant that the extension of CAG repetition causes is (wild CAG6-37 in raw type albumen repeats to the CAG35-121 in mutain).CAG extension has resulted at Huntington protein In the mutain of extension containing many glutamic acid bundle.

During suitably Huntingdon-specific nucleic acid includes, but not limited to the table 4 of US2008039418A and table 5 and Antisense oligonucleotide described in the table 1,2,7,8,9 and 10 of US7320965, having described in US2005042646A is as follows The siRNA of sequence:

5 '-AAGAGGAGGAGGCCGACGCCC-3 ' (SEQ ID NO:55)

The nucleic acid of targeting Huntingdon mRNA or albumen is preferably coupled to deposit in conjunction with in the cell of expression Huntington protein The selective reagent of neurotransmitter transporters.Thus, the conjugate of the present invention comprises Huntingdon-specific nucleic acid, and it is even It is coupled to mediate internalization and enters monoaminergic nerve unit especially 5-hydroxy tryptamine energy, norepinephrine energy and dopaminergic nerve The selective reagent of unit.Therefore, in one preferred embodiment, selective reagent is selected from dopamine reuptake inhibitor (DRI) or norepinephrine-dopamine reuptake inhibitor (NDRI) or 5-hydroxy tryptamine-norepinephrine-dopamine again The group of uptake inhibitor (SNDRI or three times-blocker).

Selective reagent and the suitably combination of nucleic acid according to the present invention are summed up in Table 1.

A.3.The joint area of the conjugate of the present invention

Nucleic acid and selective reagent can be direct couplings.However, preferably two parts are all connected by linking group.

The equal expression of term used herein " linking group " and " joint " and grammatical thereof refers to connect compound The organic moiety of 2 parts.Arbitrarily justice or the antisense nucleotide that selective reagent can be connected in nucleic acid, but It can preferably pass through 3 ' terminal nucleotides and/or 5 ' terminal nucleotide couplings.Internal conjugate may be directly or through joint Be coupled indirectly to nucleotide on 2 ' positions of ribose groups, or the correct position to other.

In the case of nucleic acid is double-strandednucleic acid, conjugate can be connected to justice 3 ' terminal nucleotides, justice 5 ' end nucleoside Acid, antisense 3 ' terminal nucleotide, and/or antisense 5 ' terminal nucleotide.

Although being not intended to by defining or arranging to be limited, in this application, the length of joint is by calculating atomic number Being described, described atomic number is to represent to connect conjugation moiety to the atom of joint and the terminal phosphate relevant to oligonucleotide The atomic number of the beeline between the oxygen atom of part, its center tap is connected to oligonucleotide by oxygen atom.At joint bag In the case of one or more ring structures, preferably counting represents the atom around ring of shortest path.

For the present invention be suitable for linking group include, but not limited to modify or the ucleotides of unmodified, core Glycoside, polymer, sugar, carbohydrate, polyolefin such as polyethylene glycols and polypropylene glycols, polyhydric alcohol, polypropylene type, second Alkene and the mixture of propylene glycols, poly-alkyl amine, the most lysins of polyamine class and spermidine, the most poly-(acrylic acid of polyesters Ethyl ester), polyphosphoric acid two esters, aliphatic compound and alkene.Additionally, based on Ω-amino-1,3-glycol, Ω-amino-1,2- Glycol, hydroxyl dried meat ammonia alcohol, Ω-amino-alkanol, diethanolamine, Ω-hydroxyl-1,3-glycol, Ω-hydroxyl-1,2-glycol, Ω-sulfur Generation-1,3-glycol, Ω-sulfur generation-1,2-glycol, Ω-carboxyl-1,3-glycol, Ω-carboxyl-1,2-glycol, co-hydroxyl-alkanol (co-hydroxy-alkanols), Ω-sulfur generation-alkanol, Ω-carboxyl-alkanol, functionalization widow ethylene glycol (functionalized Oligoethylene glycols), allylamine, acrylic acid, 1-propenol-3, propargylamine, the connecing of propilolic alcohol and more chemical constitution Head/joint (linkers/linker) can apply to herein to produce the joint of suitable length.

Joint is also possible to make oligonucleotide conjugates have other desired character and improves water solublity, conjugation moiety and few core Optimal spacing between thuja acid, elasticity (or lacking it), specificity orientation, branch, and other.

Preferably, described linking group has following structure

Wherein

M, n and p are selected from 0,1,2,3,4,5,6,7,8,9,10,11,12 and 13,

Wherein the summation of m+n+p is selected from the integer of 7,8,9,10,11,12,13,14,15,16,17 and 18, and

Wherein k is 0 or 1.

In one preferred embodiment, p is 5, and n is 2, and k is 1 and m to be 6, obtains the joint of following structure:

Another preferred embodiment in, p is 5, n and k is 0 and m to be 6, obtains the joint of following structure:

In a specific embodiment, joint comprises the coupling of more than one selective reagent.At one preferably In embodiment, joint is the joint of bivalence or trivalent, i.e. the selective reagent of 2 or 3 molecules can coupling respectively.

In the case of the selective reagent of more than one molecule is coupled on nucleic acid by joint, described molecule energy can Represent same or different selective reagent.

In a specific embodiment, the joint of bivalence or trivalent has a following structural formula:

Wherein

M, m ', m ", n, n ', n ", p, p ', p ", r, r ', r ", s, s ', s ", t and u independently selected from 0,1,2,3,4,5,6, 7,8,9,10,11,12 and 13；

K, k ', k " and v independently selected from 0 and 1；And

X¹、X²And X³Independently selected from CH₂, O, S, NH, CO, C (O) O and C (O) NH.

According to the price of above-mentioned group, branch joint can be symmetrical or asymmetric.

In a specific embodiment, joint is bivalent linker as implied above, and wherein p and p ' is 5, n and n ' is 2, k and k ' is 1 and m and m ' to be 6.In a specific embodiment, joint is bivalent linker, and wherein p and p ' is 5, n, N ', k and k ' are 0 and m and m ' to be 6.

In a specific embodiment, joint is bivalent linker as implied above, and wherein r and r ' is 4, s and s ' is 1, t and v is 0 and X¹And X²Represent C (O) NH.In another embodiment, joint is bivalent linker, and wherein r is 2, r ' be 0, s is 1, s ' it is 0, t and v is 0 and X¹And X²Represent CH₂。

In a specific embodiment, joint is bivalent linker, and wherein p and p ' is 5, n and n ' is 2, k and k ' is 1, M and m ' is 6, r and r ' is 4, s and s ' is 1, t and v is 0 and X¹And X²Represent C (O) NH.

In another embodiment, joint is bivalent linker, and wherein p and p ' is 5, n and n ' is 2, k and k ' is 1, m and M ' is 6, and r is 2, r ' it is 0, s is 1, s ' and it is 0, t and v is 0 and X¹And X²Represent CH₂。

In another embodiment, joint is bivalent linker, and wherein p and p ' is 5, n, n ', k and k ' be 0 and m and m ' Being 6, r and r ' is 4, s and s ' is 1, t and v is 0 and X¹And X²Represent C (O) NH.

In another embodiment, joint is bivalent linker, and wherein p and p ' is 5, n, n ', k and k ' be 0 and m and m ' Being 6, r is 2, r ' it is 0, s is 1, s ' and it is 0, t and v is 0 and X¹And X²Represent CH₂。

In a specific embodiment, joint is trivalent joint as implied above, wherein p, p ' and p " it is 5, n, n ' And n " be 2, k, k ' and k " be 1 and m, m ' and m " be 6.In a specific embodiment, joint is trivalent joint, wherein P, p ' and p " it is 5, n, n ', n ", k, k ' and k " it is 0 and m, m ' and m " it is 6.

In a specific embodiment, joint is trivalent joint as implied above, wherein r, r ' and r " it is 3, s, s ' And s " it is 1, t is 1, and v is 0 and X¹、X²And X³Represent O.In another embodiment, joint is trivalent joint, wherein r, r ' And r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1 and X¹、X²And X³Represent O.

In a specific embodiment, joint is trivalent joint, wherein p, p ' and p " it is 5, n, n ' and n " it is 2, k, K ' and k " it is 1, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and v is 0 and X¹、X²And X³Represent O.

In another embodiment, joint is trivalent joint, wherein p, p ' and p " it is 5, n, n ' and n " it is 2, k, k ' and K " it is 1, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1 and X¹、X²And X³Represent O.

In another embodiment, joint is trivalent joint, wherein p, p ' and p " it is 5, n, n ', n ", k, k ' and k " be 0, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and v is 0 and X¹、X²And X³Represent O.

In another embodiment, joint is trivalent joint, wherein p, p ' and p " it is 5, n, n ', n ", k, k ' and k " be 0, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1 and X¹、X²And X³Represent O.

A.4.The targeting moiety (moiety) of conjugate of the present invention

Another modification of conjugate of the present invention relates to being coupled chemically to nucleic acid or to the one or more portion of blocking group Dividing or conjugate, it strengthens activity of nucleic acid, cell distribution or cellular uptake.Such part includes but not limited to lipid part Such as cholesterol moiety (Letsinger et al, Proc.Natl.Acid.Sci.USA, 199,86,6553-6556), cholic acid (Manoharan et al, Biorg.Med.Chem.Let., 1,994 4 1053-1060), thioether, such as, beryl-S-triphen Methyl mercaptan (Manoharan et al, Ann.N.Y.Acad.Sci., 1992,660,306-309；Manoharan et al, Biorg.Med.Chem.Let., 1993,3,2765-2770), sulfydryl cholesterol (Oberhauser et al, Nucl.Acids Res., 1992,20,533-538), aliphatic chain such as dodecanediol or undecyl residues (Saison-Behmoaras et Al, EMBO J, 1991,10,1111-1118；Kabanov et al, FEBS Lett., 1990,259,327-330； Svinarchuk et a/., Biochimie, 1993,75,49-54), phospholipid such as two-hexadecyl-rac-glycerol or Triethyl group-amine 1,2-bis--O-hexadecyl-rac-glycerol-3-hydrogen phosphonate ester (Manoharan et al, Tetrahedron Lett., 1995,36,3651-3654；Shea et al, Nucl.Acids Res., 1990,18,3777-3783), polyamine or Polyglycol chain (Manoharan et al., Nucleosides and Nucleotides, 1995,14,969-973), or Adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995,36,3651-3654), palmityl part (Mishra et ai, Biochim.Biophys.Acta, 1995,1264,229-237), or 18-amine. or hexylamino-carbonyl Base oxycholesterol part (Crooke et al., J.Pharmacol.Exp.Ther., 1996,277,923-937).

Alternatively, it is possible to the part strengthening cell distribution is probably low molecular weight compound or polypeptide, and it can pass through The unitransport body being present in described biological containment is used to apply receptor-mediated endocytosis specifically to pass Biological containment shifts.A series of receptors absorbed widely and carrier, have the most greater number of receptor-specificity Part, is known in the art.For according to the mediation endocytosis used by the present invention and/or receptor preferred of transcytosis Part includes, such as part for or its be specifically bound to thiamine transporter, folate receptor, vitamin B12 are subject to Body, asialoglycoprotein receptor, α (2,3)-asialoglycoprotein receptor (contain, such as, by yamma single domain antibodies (sdAbs) FC5 and the FC44 nano antibody (nanobodies) formed is as receptor-ligands specific), transferrins-1 and-2 Receptor, scavenger receptor (type A or B, I, II or type III, or CD36 or CD163), low density lipoprotein, LDL (LDL) receptor, LDL-associated protein 1 receptor (LRP1, Type B), LRP2 receptor (the hugest albumen or glycoprotein 330), diptheria toxin receptor (DTR, it is that the film of heparin binding epidermal growth factor like growth factor (HB-EGF) combines precursor), Insulin receptor INSR, islets of langerhans Element like growth factor (IGF) receptor, leptin receptor, Arg-Pro-Lys-Pro-Gln-Gln-Phe-Phe-Gly-Leu-Met-NH2 receptor, glutathion receptor, glutamate receptor and mannose 6-phosphorus Hydrochlorate receptor.

Meeting what the present invention used, the preferred part being combined with these receptors includes, such as part is selected from: lipoproteinesterase (LPL), alpha2-macroglobulin (α 2M), receptor associated protein(RAP) (RAP), lactoferrin, desmoteplase, tissue and urokinase type fiber Pepsinogen activator (tPA/uPA), plasminogen activator inhibitor (PAI-I), tPA/uPA:PAI-1 are compound Thing, protein melanotransferrin (or P97), thrombospondin 1 and 2, hepatic lipase, factor VIIa/tissue factor approach restrainer (TFPI), the VIIIA factor, the IXa factor, Abetal-40, amyloid-beta precursor (APP), C1 inhibitor, Complement C_3, load fat Albumen E (apoE), Pseudomonas exotoxin A, CRM66, HIV-I Tat albumen, rhinovirus, GELB (MMP- 9), MMP-13 (collagenase-3), Saposin (SAP), pregnoglobulin, Antithrombin III, heparin co factor II, Alpha antitrypsin, heat shock protein 96 (HSP-96), platelet derived growth factor (PDGF), SP-40 (apoJ or TRPM-2), ABETA to apoJ and apoE, aprotinin, angiopeptin (angio-pepl), very low density lipoprotein (VLDL) (VLDL), Transferrins, insulin, leptin, insulin like growth factor, epidermal growth factor, agglutinin, peptide mimetic and/or humanization Monoclonal antibody or specific effect in described receptor peptide (such as, be bound to human TfR sequence HAIYPRH and THRPPMWSPVWP, or monoclonal antibody A24 of anti-human transferrin receptor (TfR)), hemoglobin, diphtheria toxin, diphtherotoxin polypeptide chain Non-toxic component, diphtheria toxin, diphtherotoxin B chain all or part of (include DTB-His (such as Spilsberg et al., 2005, Toxicon., described by 46 (8): 900-6)), the non-toxic mutant of diphtheria toxin, diphtherotoxin CRM197 all or part of, carry fat Protein B, apo E (after such as, being bound to tween 80 coating nanoparticle), vitamin D binding protein, vitamin A/ Retinol-binding protein, vitamin B12/cobalamine plasma carrier albumen, glutathion and cobalamin transfering protein-B12.

A.5.Blocking group

Form the nucleic acid of a part of conjugate of the present invention at them through organic different liquids and the transhipment of component Period, they must be protected from degradation factor degraded, (inside/outside cuts nucleic acid to described degradation factor such as nuclease Enzyme).For this purpose, oligonucleotide is designed to resist enzymic digestion, and improves internal stability and the biology of oligonucleotide Availability.Preferably, nucleic acid is by by stoping the chemistry carried out in the presence of the group of nuclease-mediated degraded to be repaiied Decorations.

For the purposes of the present invention, " cap " or " blocking group " is understood to refer to chemical modification, and it closes And to the either end of oligonucleotide.The non-limitative example of 5 '-cap includes inverting basic moiety (inverted abasic Residue) (part), the acid of 4 ', 5 '-methylene nucleoside；1-(β-D-furan erythrose) nucleotide, 4 '-thio nucleotides, carbocyclic ring Nucleotide；1,5-dewatering hexitol nucleotide；L-nucleotide；α-nucleotide；Modified base nucleotide；Phosphorodithioate is even Connect；The acid of Soviet Union-pentofuranonucleoside；The acid of acyclic 3 ', 4 '-open nucleoside；Acyclic 3,4-dihydroxy butyl nucleotide；Acyclic 3,5-bis- Hydroxy pentyl nucleotide, 3 '-3 '-reversion nucleotide segment；3 '-3 '-reversion basic moiety (inverted abasic moiety)；3 '-2 '-reversion nucleotide segment；3 '-2 '-reversion basic moiety；BDO phosphate ester；3 '-phosphoramidic acid Ester；Hexyl phosphate ester；Aminohexyl phosphate ester；3 '-phosphate；3 '-phosphorothioate；Phosphorodithioate；Or bridging or non-bridge Methylphosphonic acid ester moiety even.Details is described in detail in WO97/26270, herein incorporated by reference.3 '-cap includes, Such as, 4 ', 5 '-methylene nucleoside acid；1-(β-D-furan erythrose) nucleotide；4 '-thio nucleotides, homocyclic nucleus thuja acid；5′- Amino alkyl phosphate ester；1,3-diaminourea-2-propyl phosphate, 3-Aminopropyphosphinic acid ester；6-Aminohexyl phosphate ester；1, 2-aminododecane base phosphate ester；Hydroxypropyl phosphate ester；1,5-dewatering hexitol nucleotide；L-nucleotide；α-nucleotide；Modify Nucleotide base；Phosphorodithioate；The acid of Soviet Union-pentofuranonucleoside；The acid of acyclic 3 ', 4 '-open nucleoside；3,4-dihydroxy butyl Nucleotide；3,5-dihydroxy amyl group nucleotide, 5 '-5 '-reversion nucleotide segment；5 '-5 '-reversion basic moiety；5 '-amino phosphorus Acid esters；5 '-phosphorothioate；BDO phosphate ester；5 '-amino；Bridging and/or non-bridged 5 '-phosphoramidate, phosphorothioate And/or phosphorodithioate, bridging or non-bridged methyl phosphonate and 5 '-thiol portion.Referring still to Beaucage and Iyer, 1993, Tetrahedron 49,1925；Its content is incorporated herein by reference herein.

In one preferred embodiment, the cap of the nucleotide sequence connecting conjugate of the present invention has below general formula Structure:

M-L1_d-[(A-L2)_a-(B-L3)_b]_c-

Wherein:

M is H, lipid part or targeting group as defined above；

A and B represents monomeric unit, independently selected from monosaccharide and (C₂-C₂₀) alkylene glycol；

L1, L2 and L3 are to connect compound, independently selected from di-phosphate ester, phosphorothioate, carbamate, methylphosphonic acid Ester, guanidine, sulfamate, sulfonamide, dimethoxym ethane (formacetal), sulfur acute pyogenic infection of nails acetal (thioformacetal), sulfone, acyl Amine and mixture thereof；

A and b is the integer of 0-50；

C is the integer of 0-30；

D is the integer of at least 1.

Lipid part used herein refers to the group of organic compound, it has a lipophilic or amphipathic nature, including, But it is not limited to, fat, fatty oil, volatile oil, wax, steroid, sterol, phospholipid, glycolipid, thioester, aminolipid, chromolipid (chromolipid) and fatty acid.Term " lipid " comprises the lipid of both naturally occurring and synthetic production.Lipid part generally increases widow The lipotropy of nucleotide the cellular uptake in promoting oligonucleotide construct body.The lipid being suitable for that can use includes fat Fat acid；Fat；Oil；Wax；Cholesterol；Sterol；Fatsoluble vitamin, such as vitamin A. D. E and K；Monoglyceride；Two glycosyl Diglyceride, and phospholipid.Preferably fatty acid is selected from lauric acid (C12), myristic acid (C14), Palmic acid (C16), tristearin Acid (C18), behenic acid (C22) and the mixture (lithocholic acid-oleyl amine, C43) of lithocholic acid and oleyl amine.Lipid may be by ability The situations such as the path that field technique personnel advance according to consideration target tissue, target cell, route of administration, expection oligonucleotide are selected Select.

Term " monosaccharide " used herein and well known in the art refers to the simple form of sugar, by single sugar unit group Becoming, it can not further decompose into less sugared construction unit or part.The sugar moieties puting together group for this present invention It is preferably selected from furanose, fructose, glucose, galactose, mannose, modified monosaccharide, sialic acid and erythrose and mixture thereof.Single Sugar can be the linear of it or annular form (hemiacetal ring isomerism body).Furanose is any simple sugars comprising 5 yuan of furan nucleuss Class, such as D-ribose or residue of fructose (D-(-)-fructose furanose).The combination of monosaccharide is obtained in that polysaccharide structures.Fructose is few Aggressiveness (FOS) and GOS (GOS) are particularly advantageous combinations, and disaccharide sucrose or lactose；Or polysaccharide inulin, Dextrin, starch or glycogen.

Term used herein " alkylene glycol ", " poly-(alkylene glycol) " and " alkylene oxide " comprise polyether polymer man Race, its total formula-O-[(CH₂)_m-O-]_n-, wherein m represents the number of methylene group present in each alkylene glycol unit Mesh, and the number of n repeateding unit, and the therefore size of representation polymer or length.Term includes, is not limited to, ethylene glycol, Propylene glycol, two alkylene glycols (such as, diethylene glycol), three alkylene glycols (such as, triethylene glycol), and glycol such as foregoing glycols Corresponding single-or di-alkyl ether, wherein alkyl ether be have 1-6 carbon atom lower alkyl ether (such as, methyl, ethyl, Propyl ether and analog).

In another embodiment, the group of formula (I) has (C₂-C₂₀) alkylene glycol monomeric unit, it can be 2- The molecule of the linear or side chain of 20 carbon atoms, or, according toaWithbPrice, have some (C₂-C₂₀) alkylene glycol monomer The ployalkylene glycol polymer of unit.Preferably, alkylene glycol group is selected from C₁₆-C₂₀Alkylene glycol.It is highly preferred that alkylene two Alcohol groups is C₁₈Alkylene glycol.

The blocking group being suitable for conjugate of the present invention includes, is not limited to:

M-L1_d-[(A-L2)_a-(B-L3)_b]_c-

-PEG+ sugar, corresponding to above formula, wherein M is H, and d is 0, and A is PEG, B be sugar, a and b is each 1, and L1 and L2 is phosphodiester bond；

-PEG+ (sugared) 2, corresponding to above formula, wherein A is PEG, and B is sugar, and a is 1, and b is 2, and M is H, and d is 0, and L1 and L2 It it is phosphodiester bond；

-(PEG) 2+ sugar, corresponding to above formula, wherein A is PEG, and B is sugar, and a is 2, and b is 1, and M is H, and d is 0, and L1 and L2 It it is phosphodiester bond；

-(PEG) 3+ sugar, corresponding to above formula, wherein A is PEG, and B is sugar, and a is 3, and b is 1, and M is H, and d is 0, and L1 and L2 It it is phosphodiester bond；

-(PEG) 5+ sugar, corresponding to above formula, wherein A is PEG, and B is sugar, and a is 5, and b is 1, and M is H, and d is 0, and L1 and L2 It it is phosphodiester bond.

Term " PEG " used and " sugared " basically described above, and include that furanose is selected from as sugar and PEG C3, C9 and C18 spacer.

B.The structure of conjugate of the present invention

The different units of conjugate of the present invention may arrange by different way.Thus, selective reagent can be coupled to 5 ' ends of nucleic acid and/or 3 ' ends.Additionally, nucleic acid and selective reagent may be directly connected or may be connected by joint. Similarly, joint may be coupled to 5 ' ends and/or the 3 ' ends of nucleic acid.Thus, wherein the nucleic acid of the present invention comprises single nucleic acid chains, Possible arrangement is:

-comprise the nucleic acid being connected to the 5 ' selective reagents held,

-comprise the nucleic acid being connected to the 3 ' selective reagents held,

-comprise the nucleic acid being connected to the 5 ' selective reagents held He being connected to the 3 ' blocking groups held, and

-comprise and be connected to 5 ' end blocking groups and be connected to the nucleic acid of the 3 ' selective reagents held.

-the nucleic acid modified, it comprises the first and second selective reagents, and described first and second selective reagents are identical Or different, the two ends of the bifunctional linker that two selective reagents are all held be connected to nucleic acid 5 ' are connected,

-the nucleic acid modified, it comprises the first and second selective reagents, and described first and second selective reagents are identical Or different, the two ends of the bifunctional linker that two selective reagents are all held be connected to nucleic acid 3 ' are connected,

-the nucleic acid modified, it comprises 4 selective reagents, and described selective reagent is identical or different, two of which Selective reagent is connected to the two ends of the first bifunctional linker that the 5 ' ends with nucleic acid are connected, and the examination of two of which selectivity Agent is connected to the two ends of the second bifunctional linker that the 3 ' ends with nucleic acid are connected.

Furthermore, the conjugate of the present invention potentially includes more than one nucleic acid chains, the expression of this nucleic acid regulation target molecule.Example As, the construct of the present invention can include at most 5 different nucleic acid, and these nucleic acid are linked together by di-phosphate ester, location Zones of different to given target molecule.

Additionally, in the case of nucleic acid is double-strandednucleic acid, selective reagent can be coupled to justice and/or antisense strand, and And may directly coupling or connected by linking group.

Form the nucleic acid of a part of conjugate of the present invention during the transhipment through organic different liquids and component, They must be protected from the degraded of degradation factor, described degradation factor such as nuclease (inside/outside cuts nuclease).For This target, oligonucleotide is designed to resist enzymic digestion, and improves internal stability and the bioavailability of oligonucleotide 's.Cell exonuclease uses free 5 ' ends as target.Therefore, in the case of single-chain nucleic acid, when the 5 ' ends with nucleic acid During coupling, selective reagent may serve as steady component.But, comprise double-strandednucleic acid or selective reagent connection at conjugate To the 3 ' single-chain nucleic acids held, conjugate may comprise steady component, or cap further, its typically by The activity of exonuclease stops the group of nucleolysis.In the case of double-strandednucleic acid, may arranging of existing is as follows:

[1] selective reagent is attached to 5 ' ends of a chain, and 5 ' at opposite strand hold the additional cap to be in this case Useful.It addition, cap can also be present in 3 ' ends one or two.

[2] selective reagent is attached to 3 ' ends of a chain, and additional cap is held in 5 ' at justice and antisense strand in this case Structure is useful.It addition, cap may reside in 3 ' free ends.

[3] in the case of the conjugate comprising more than one identical or different selective reagent, selective reagent is even It is coupled to 5 ' ends of justice and antisense strand.Can selectively, cap is likely to be present in one or two in 3 ' ends.

In one preferred embodiment, nucleic acid is double-stranded RNA, and wherein selective reagent is connected to the 5 ' of antisense strand Hold, and blocking group is connected to 5 ' ends of positive-sense strand.Also having in a preferred embodiment, blocking group has structure

M-L1_d-[(A-L2)_a-(B-L3)_b]_c-

Wherein, M is H, and d is 0, and A is the polyethylene glycol of C18 spacer, and B is furanose, and a is 2, b and c be 1 and L2 and L3 is phosphodiester bond.

In one preferred embodiment, the conjugate of the present invention comprises

I () at least one selective reagent, it is specifically bound to one or more neurotransmitter transporters, Qi Zhongxuan Selecting property reagent is selected from comprising serotonin reuptake inhibitor (SRI), selective serotonin reuptake inhibitor (SSRI), 5- The reagent set of hydroxytryptamine-NRI (SNRI), and

(ii) nucleic acid, it can specifically be bound to target molecule, and its target is selected from comprising 5-hydroxytryptamine receptor 1A Type (5-HT_1A), coding 5-hydroxytryptamine receptor 1A type (5-HT_1A) mRNA, serotonin transporter and coding 5-hydroxy tryptamine turn The mRNA of fortune body.

In a preferred embodiment, it is possible to be specifically bound to encode 5-hydroxytryptamine receptor 1A type (5- HT_1A) the nucleic acid of mRNA comprise selected from SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3 and the sequence of SEQ ID NO:4 One sequence of group.

Also having in a preferred embodiment, the conjugate of the present invention has structure (I)

Wherein

R¹、R²、R³、R⁴And R⁵Independently selected from hydrogen and C₁-C₆Alkyl；

X and Y is independently selected from hydrogen, halogen, C₁-C₃Alkyl, C₁-C₃Haloalkyl, OR^aAnd SR^b, wherein R^aAnd R^bIt is only On the spot selected from C₁-C₃Alkyl and C₆-C₁₀Aryl；

W is selected from hydrogen, halogen, CN, NO₂、C₁-C₃Alkyl, C₁-C₃Alkylhalide group, NR^cR^d、SO₂NR^eR^f、NR^gSO₂R^h、CO₂Rⁱ, Wherein R^c、R^d、R^e、R^f、R^g、R^hAnd RⁱIt is independently selected from hydrogen and C₁-C₃Alkyl；

M, n and p are selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13, wherein m+n+p's and be selected from 7,8,9,10, 11,12,13,14,15,16,17 and 18 integer and

Wherein oligonucleotide comprises selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 Sequence set in sequence.

In another embodiment, the conjugate of the present invention has a structure:

Also having in preferred embodiment, the conjugate of the present invention has structure (XIV)

Wherein,

R¹、R²、R³、R⁴And R⁵It is independently selected from hydrogen and C₁-C₆Alkyl；

W is selected from hydrogen, halogen, CN, NO₂、C₁-C₃Alkyl, C₁-C₃Haloalkyl, NR^cR^d、SO₂NR^eR^f、NR^gSO₂R^h、CO₂Rⁱ, Wherein R^c、R^d、R^e、R^f、R^g、R^hAnd RⁱIt is independently selected from hydrogen and C₁-C₃Alkyl；

M and p is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13, wherein m+p's and be selected from 7,8,9,10, 11, the integer of 12,13,14,15,16,17 and 18, and

Wherein oligonucleotide comprises selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4 The sequence of sequence set.

In a particular embodiment, conjugate has structure

Also another preferred embodiment in, the conjugate of the present invention comprises double-strandednucleic acid, wherein the 5 ' of positive-sense strand End and blocking group coupling, and 5 ' end and selective reagent couplings of antisense strand.Wherein, blocking group has a structure:

M-L1_d-[(A-L2)_a-(B-L3)_b]_c-

Wherein M is H, and d is 0, and A is the macrogol of C18 spacer, and B is furanose, and a is 2, b and c be 1 and L2 and L3 is phosphodiester bond, and wherein blocking group is Sertraline, and the compound of the present invention has a structure:

C18-di-phosphate ester-C18-di-phosphate ester-furanose-di-phosphate ester-aRNA chain

SRNA chain-peptide connection-Sertraline

Also having in a preferred embodiment, the compound of the present invention has a structure:

Also having in preferred embodiment, the compound of the present invention has a structure:

In another embodiment, conjugate has a following structure:

Wherein,

R₁Represent hydrogen, low alkyl group or benzyl

R₂Represent hydrogen, methyl, the chlorine of fluorine race

R₂' represent hydrogen, methyl, methoxyl group, hydroxyl or halogen atom

R₃And R₄Represent hydrogen, low alkyl group

R₅Represent hydrogen, chlorine or the methoxyl group on 5-or 6-position and

P is 2-6.

Also having in a preferred embodiment, conjugate has following structure

Also having in a preferred embodiment, the oligonucleotide forming a conjugate as defined above part can be special Being bound to target molecule, wherein said target molecule is selected from different in naturely:

-dopamine-β-hydroxylase,

The mRNA of-coding dopamine-β-hydroxylase,

-BAX,

The mRNA of-coding BAX,

-Tau,

The mRNA of-coding Tau,

-Huntington protein and

The mRNA of-encoding huntingtin.

Saying from meaning of the present invention, the blocking group of formula can be by (referring in formula (I) group with connection compound " L ") mode be connected to 5 '-OH or the 3 '-OH group of oligonucleotide, thus obtain conjugate-oligonucleotide.Oligonucleoside The chemical property of acid and formula (I) group can have some embodiments.

For example, it is possible to single oligonucleotide molecules connects in formula (I) on the group of variable number, typically from 2 to 4, under the conditions of formed this of connection by 5 '-OH and/or 3 '-OH, depend on that oligonucleotide is double-strand or strand.Also have Likely the chain of the some groups in formula (I) is connected to oligonucleotide, and the group of described formula (I) is phase by connection compound Connecting, such as, phosphoramidite, it is to produce between molecule and/or oligonucleotide that the molecule of phosphodiester bond is derivative to be obtained. Further, oligonucleotide construct can comprise the chain of some groups of formula (I) and the connection of the one end being connected to oligonucleotide Other groups to the formula (I) of this oligonucleotide other end.

Further, the constructs of the present invention can comprise more than one targeting agent, is distributed in oligonucleotide Two chains 5 '-OH and 3 '-OH end in likely combine or be bound on the group of formula (I).If additionally, had More than one targeting agent, these groups that can be connected in series to formula (I) and/or this oligonucleotide.

If oligonucleotide construct comprises more than one targeting agent, different combinations is possible.Such as, protection Group can be connected to 5 '-OH or the 3 '-OH end group of a chain of oligonucleotide.Alternatively possible combination includes being connected to Article one, the medical compounds of 5 '-OH groups of oligonucleotide chain and a series of aptamers, described aptamers is attached to and another The terminal units aptamers of formula (I) group of bar oligonucleotide chain combination.

C.The pharmaceutical composition of the present invention

Inventor has been found that the conjugate of the present invention has the ability of regulation expression of nucleic acid, and it is to put together by being directed to The nucleotide sequence of thing is carried out.Such as, specific effect is comprised in presynaptic 5-HT at conjugate_1AIn the case of the nucleic acid of R, when When construct is delivered medicine to experimenter, it can induce midbrain enlargement of lymph nodes (that is, the 5-hydroxy tryptamine energy nerve in brain of experimenter effectively Unit body place region) in 5-HT_1AThe specificity of R reduces.

Therefore, it will be appreciated by those skilled in the art that the conjugate of the present invention is appropriate for the treatment of disease, its Being probably from the reduction of gene expression dose benefit, the nucleic acid being present in conjugate of the present invention of described gene is oriented 's.Therefore, another aspect, the present invention relates to the conjugate used in medicine according to the present invention.It addition, the invention still further relates to Pharmaceutical composition, it comprises the conjugate according to the present invention and pharmaceutically acceptable excipient.

Appropriate oligonucleotide construct of the present invention can press formula system with pharmaceutically acceptable excipient and/or carrier Make to obtain pharmaceutical composition.The compositions comprising conjugate of the present invention can give experimenter with number of ways.Exemplary In approach includes striatum, in Intraventricular, sheath, in Thin Film Tissue, (such as, in striatum), intranasal and eye give.Group Compound can give with whole body, such as, by intravenous, subcutaneously or intramuscularly injects, and it is for giving conjugate to periphery god It is useful especially through unit.It addition, the conjugate of the present invention is it is also possible to intranasal administration, its make by Noninvasive to prescription Formula and Formulations for systemic administration.Further, intracerebroventricular administration may also be appropriate.Preferably route of administration is directly to arrive brain, such as, Enter the ventricles of the brain or the hypothalamus of brain, or enter side or the dorsal part region of brain.

The pharmaceutical composition of the present invention may comprise multiple different conjugate, and the most different conjugates comprises and targets The nucleic acid of the zones of different of identical target molecule.Thus, pharmaceutical composition may comprise at least 2, at least 3, at least 4, extremely Few 5, at least 6 and more different conjugate, each different conjugate comprises different nucleic acid.

Known and commercially available data familiar to the person skilled in the art such as " Lei Shi medicine is complete works of " (Remington ' s Pharmaceutical Science) (the 17th edition, Mack Publishing Co., Easton, Pa., 1985) and Gourde(G) graceful and Gill graceful treatment pharmacological basis (Goodman and Gilman ' s ThePharmaceutical Basis of Therapeutic) (the 8th edition., Pergamon Press, Elmsford, N.Y., 1990) discussed in principle and program, its Herein, the two is incorporated herein by reference.

In the preferred embodiment of the present invention, it is configured to be suitable to the mankind and other sucklings by conjugate according to standardization program The pharmaceutical composition that animal is administered.Typically, the compositions of intravenous or intracerebroventricular administration is sterile isotonic aqueous buffer Solution.

If desired, compositions can also include solubilizing agent and for improving the local anesthesia of any pain of injection site Agent.Normally, component is to provide individually or mixedly in unit dosage form, such as, denotes the amount of active component Hermetically sealed container such as ampulla or medicine bag in lyophilized powder or anhydrous concentrating agents (water free concentrate).Work as combination When thing is administered by injecting, it can make up a prescription by comprising the infusion bottle of the other water of sterile pharmaceutical grade or saline.When compositions is led to When crossing drug administration by injection, it is possible to use the ampulla containing sterilized water for injection or saline is so that component can mix before use.

Except the situation of intravenous administration, compositions can comprise less amount of wetting agent or emulsifying agent, or pH buffering Agent.Compositions can be liquid solution, suspension, Emulsion, gel, polymer or slow releasing preparation.Compositions can be with ability Binding agent traditional known to territory is made by formula together with carrier.Preparation can include that standard vector such as pharmaceutical grade is other sweet Dew alcohol, lactose, starch, magnesium stearate, saccharin sodium, cellulose, magnesium carbonate etc., inert carrier has in pharmaceutical preparation produces The function of good determination.Various drug-supplying systems are known, it is possible in the administration of the treatment of the present invention, including lipid Body encapsulating, microgranule, microsome and the like.

Also having another preferred embodiment, the therapeutic preparation including conjugate of the present invention can be with neutral or salt Form is prepared.Pharmaceutically acceptable salt includes those salt formed with free amine group, such as, derive from hydrochloric acid, phosphoric acid, vinegar Acid, oxalic acid, tartaric acid and the like, and with free carboxy formed those, such as derive from sodium, potassium, ammonium, calcium, Hydrated ferric oxide., 2-aminopropane., triethylamine, 2-ethylaminoethanol, histidine, procaine or similar.

For giving the embodiment of compositions through blood brain barrier, compositions includes, such as, liposome, as such as existed U.S. Patent number 6,372, described in 250 (Pardridge), and pharmaceutically acceptable carrier.Lipid described herein Bioactivator can be transmitted by body through blood brain barrier, expresses subsequently in brain.Liposome and nanoparticle are nano-carriers (nanocontainer) canonic form, is commonly used for the encapsulating of medicine.Liposome preferably has less than 200 nanometers Diameter.The liposome of the diameter with 50-150 nanometer is preferred.Particularly preferably there is the fat of about 80 nanometer external diameters Plastid or other nano-carriers.The liposome of suitable type is with neutral phospholipid such as 1-palmityl-2-oleoyl-Xi-sweet Oil-3-phosphocholine (POPC), two phosphatidyl phosphocholines, DSPE (DSPE) or cholesterol, even Make together with the cation lipoid such as didodecyldimethylammbromide bromide (DDAB) of (1%) in a small amount, in order to stable fat DNA in plastid.

Liposome can substitute by the molecule nano carrier less than 200nm with nanoparticle or any other diameter, works as preparation The most in blood or when the cellular compartment of blood transportation to target cell, its can encapsulate DNA and protect nucleic acid from Nuclease decomposes.Further, instead of using conjugation reagents such as PEG chain, and the material of one or more other polymerizations is used such as Sphingomyelins, it can be connected to the surface of liposome or nano-carrier, and reach dual purpose: for sewing of " transportable peptide " Close and support is provided and eliminates from blood for retard formulation and optimize plasma pharmacokinetics character.Further, this Bright emphasis DNA is administered to any part of cell or organ, and it has specific target receptor.Liposome can serve as by DNA to Give to organ, such as liver, lung and spleen.

The carrier of the delivery of other applicable conjugates of the present invention includes dendrimer.Term " dendrimer " is Refer to there is a core and there is the macromole of apparatus derivatorius of the multiple shell launched from core.The shape of arborization carrier It is to change with size.In some cases, the shape of arborization carrier can be substantially spheroid or spherical.And And, arborization carrier can have about 15 angstroms (A) to the diameter in the range of about 250A, and the molecule of respective range Amount, such as, from about 500 dalton to about 2 megadalton.Dendrimer can from various commercial channel (such as, Dendritech, Midland, Michigan) obtain or obtained by the method synthesis that those skilled in the art will know that.Branch Shape molecule can be roughly classified into low-molecular-weight class and high molecular class.The first kind includes dendrimer and dendron (dendron), and Equations of The Second Kind comprises dendron polymer, dissaving polymer and brush polymer (also referred to as bottlebrush (bottle-brushes)).Dendrimer and dendron are to repeat branch, the chemical combination of monodispersed and usual high degree of symmetry Thing.Definition dendrimer and dendron do not has obvious difference.Dendron generally includes addressable base in pure chemistry Group, it is referred to as focus.Due to the shortage of molar mass distribution, high molecular weight dendrimer and dendron be macromole and Non-polymer.The character of dendrimer is to be determined by the functional groups of molecular surface.The dendroid bag of functional molecular Envelope makes avtive spot isolate, and a structure, it simulates the structure of avtive spot in biomaterial, because dendroid support separates Inside and outside function.Such as, when the end group of dendrimer is hydrophilic group, and as carboxyl, dendrimer can Being water miscible.

Dendrimer is generally characterized by following character: (i) nuclei originis (I), and it may have one or more work Property site and be that point-like or significant size are to affect the final topology of dendrimer；(ii) one layer Or the repetitive of branch that multilamellar is connected on nuclei originis；(iii) functional end group, such as anionic group or sun from Subbase group, is connected to the surface of dendrimer, and described connection is at random to be connected by linking group.

The most desired dendrimer may comprise lysine or lysine analogues construction unit.Term " relies Propylhomoserin analog " refer to a molecule, it has single summit carboxylic group for being connected to the construction unit of last layer, and 2 Individual or 3 primary amine groups, it can be connected with construction unit, blocking group, joint or aryl acid group further.Phase herein The example of " lysine analogues " hoped described in the PCT/AU2007/000352, such as glycyl-lysine (glycyl- lys).In some specific examples, dendrimer only comprises lysine or a type of lysine analogues is made For construction unit.

Other dendrimers the most desired include that those comprise polyethyene diamine (PAMAM), poly-(ether azanol) Or polypropylene-base imines construction unit (PEHAM).In its object lesson, dendrimer only has polyethyene diamine (PAMAM), poly-(ether azanol) (PEHAM) or polypropylene-base imines is as construct.

Core part may only include 1 junction point for connecting construction unit or 2,3 or more points may be comprised, it can Can meeting or the possible connection that will not be used for construction unit further.Typically, junction point is free amine group.Core part can Can include, comprise or derived from construction unit or be probably the molecule different from construction unit.Typical core part be Illustrate herein and described in PCT/AU2007/000352.

Liposome and dendrimer may be combined with any applicable pharmaceutical carrier for intravenous administration.Compositions Intravenous administration be preferred approach, owing to this has minimum invasive.Other administration route is possible, if it is desired to If.Suitable pharmaceutically acceptable carrier include saline, Tris buffer, phosphate buffer or any other Aqueous solution.Appropriate dosage can be determined by program well known by persons skilled in the art.

D.The therapeutic use of conjugate of the present invention

It is appreciated that the treatable clinical symptoms of conjugate of the present invention will depend upon which the part forming conjugate The specificity of nucleic acid.Therefore, the conjugate of the present invention may be used for the treatment of any disease, and described disease can be by Suppression cell expresses the gene interested of neurotransmitter transporters and improves.It will be appreciated by those skilled in the art that Conjugate is useful for the treatment of following disease, and described disease is with unconventionality expression (such as, the Louis body of albumen in cell The accumulation of middle alpha-synapse nucleoprotein) for characterize, or to target protein express horizontal abnormality but its can by reduce described target The disease that the expression of albumen improves.

D.1.Comprising the conjugate of nucleic acid, described nucleic acid targeting acts on the 5-HT being positioned on serotoninergic neuron _1A Receptor, 5-hydroxy tryptamine transporter or ion channel

As it has been described above, when giving required experimenter by SSRI, have a negative feedback mechanism to occur, its result makes to be positioned at 5- Hydroxytryptamine serotonergic neuron (presynaptic 5-HT_1AR) 5-HT_1AThe activation of receptor.The effect of SSRI causes high 5-hydroxy tryptamine water Flat, described high 5-hydroxy tryptamine level is by the serotonin reuptake transporter transporter (SERT) being positioned on serotoninergic neuron The blocking-up of serotonin reuptake transporter of mediation and induce.This fact will not only activate postsynaptic 5-hydroxytryptamine receptor, and Also activate presynaptic 5-HT_1AR, it acts as cell feedback transducer.These 5-HT_1AThe activation of R causes 5-hydroxy tryptamine level Reduce, because cell discharge and the suppression of pulse dependent 5-hydroxy tryptamine release, thus limit the administering effect of SSRI.

This effect shows that wherein it shows and comprises Sertraline and 5-in such as embodiments of the invention 2 and 3 HT_1AThe infusion of the conjugate of R-specific siRNA can stop by selectivity 5-HT_1AThe hypothermic response of R agonist induction.This Individual effect makes the conjugate of the present invention application in all that clinical symptoms, wherein it is desirable that the expression of suppressor gene, The complementary nucleic acid of a part for described gene and formation conjugate.

In anti depressant therapy field, this is an important discovery, because the oligonucleotide of the present invention can be useful , to offset the side effect of the SSRI of above-mentioned commercialization, i.e. onset is slowly and offer limited effectiveness.It addition, by the application present invention High selectivity oligonucleotide construct, it is only necessary to the treatment oligonucleotide giving low dosage just can reach desired effect Really.Therefore, the construct of the present invention is useful to treatment disease, the 5-hydroxyl of the abnormal concentrations of described disease and synaptic zones The disease that tryptamines is relevant, particularly not enough to 5-hydroxy tryptamine transmission relevant those diseases (i.e. 5-hydroxy tryptamine concentration water in synapse Flat minimizing), such as depressed relevant disease.

Correspondingly, if the targeting of nucleic acid is the component for presynaptic serotoninergic neuron, conjugate will be suitable for In treatment disease, wherein need the activity reduction of presynaptic serotoninergic neuron.Therefore, in yet another aspect, the present invention Relate to conjugate of the present invention, wherein

I () selective reagent is taken the photograph selected from serotonin reuptake inhibitor (SSRI), 5-hydroxy tryptamine-norepinephrine again Take inhibitor (SNRI) or norepinephrine energy and specificity 5-hydroxy tryptamine energy antidepressant (NASSA) and

(ii) oligonucleotide can specifically be bound to target molecule, and described target molecule is selected from 5-hydroxytryptamine receptor 1A type (5-HT_1A) mRNA, 5-hydroxy tryptamine transporter mRNA, TREK-1mRNA, 5-hydroxytryptamine receptor 1A type (5-HT_1A) polypeptide, 5-hydroxyl color Amine transporter polypeptide and TREK-1 polypeptide

For the depressed associated conditions for the treatment of or prevention.

Alternatively, the present invention relates to a kind for the treatment of or the method for the depressed associated conditions of prevention, it is tested that it comprises to needs Person is administered the conjugate of the present invention, wherein

(ii) oligonucleotide can specifically be bound to target molecule, and described target molecule is selected from 5-hydroxytryptamine receptor 1A type (5-HT_1A) mRNA, 5-hydroxy tryptamine transporter mRNA, TREK-1mRNA, 5-hydroxytryptamine receptor 1A type (5-HT_1A) polypeptide, 5-hydroxyl color Amine transporter polypeptide and TREK-1 polypeptide.

Expression " depressed associated conditions " used herein refers to be characterized with the low-level singularly of 5-hydroxy tryptamine in synapse Those symptoms, and it is at American Psychiatric Association (American PsychiatricAssociation), Washington Psychotic diagnostic and statistical manual fourth edition (the Diagnostic and Statistical Manual of that DC publishes Mental Disorders--Fourth Edition) defined in (DSM-IV), and include, it is not limited to, major depression Disease, long term depression, tolerance to treatment depression, dysthymia, with sadness, despair, setback, " dejected ", melancholy being felt as The mental status of the depressive emotion of feature, low self affirmation sense, compunction and self-accusation, exit human communication, and somatization example If feed is with sleep disordered.Preferably, depressed associated conditions is selected from: major depression, compulsive disorder (OCD), comprehensive Mental development obstacle (PDDs), post-traumatic stress disorder (PTSD), anxiety neurosis, bipolar disorder, eating disorders And chronic pain.

It addition, conjugate of the present invention comprises selective reagent specific to serotoninergic neuron and lowers 5-HT_1A The oligonucleotide of receptor, it is released in the 150-200% of 5-hydroxy tryptamine increase about baseline value in prefrontal cortex, and by individually 50% increase that antidepressant produces compares (see Fig. 8).As it was previously stated, traditional antidepressant is designed to improve 5-hydroxyl color The transmission of amine, but due to presynaptic 5-HT_1AThe activation of receptor and the most limited effect.Therefore, with the oligonucleoside of the present invention Acid con-struct, overcomes the major limitation (onset slowly and offer limited effectiveness) of described antidepressant.Therefore, can reach in a short time To the active response to antidepressant treatment, and relative to only treating with commercialization antidepressant (i.e. SSRI), can improve Adapt to the number of the patient for the treatment of.Therefore, another aspect, the present invention relates to a kind of method treating depressed associated conditions, its Comprise conjugate and the antidepressant being administered the present invention.

The oligonucleotide construct of the present invention can with general antidepressant (SSRIs, NARIs, MAOI, TCA etc.) simultaneously It is administered.The administration of oligonucleotide sequence blocks 5-HT_1AThe expression of autoreceptor, makes the effect of these antidepressant improve, and it is The decay increased by reuptake is blocked the extracellular 5-HT produced carries out what suppression realized

D.2.Comprising the conjugate of nucleic acid, described nucleic acid targets synapse nucleoprotein

Another aspect, the present invention relates to conjugate of the present invention, wherein

I () selective reagent presses down selected from dopamine reuptake inhibitor (DRI) and norepinephrine-dopamine reuptake Preparation (NDRI) and

(ii) oligonucleotide can specifically be bound to target molecule, and it is coding alpha-synapse nucleoprotein or alpha-synapse core egg The mRNA of white polypeptide

For the disease that treatment or prevention are relevant with Louis body deposition.

Term " disease relevant with Louis body deposition " refers to the symptom being characterized with the disorder of alpha-synapse nucleoprotein metabolism, It causes the formation of abnormal neuron alpha-synapse nucleoprotein inclusion body.More specifically lewy body disease includes parkinson disease (PD), road Easily body dull-witted (DLB), Parkinsonism dementia (PDD) and multiple system atrophy.

Preferably, conjugate of the present invention may be administered together with commercialization antidepressant such as SSRI, is used for treating depression And/or depression associated conditions.

D.3.Comprising the conjugate of nucleic acid, described nucleic acid targets norepinephrine transporter

The most as explained in the background section, the increase of the DA conveying of middle Cerebral cortex may be to have to schizoid treatment ?.Because to NA with DA, NA transporter (NAT) shows that similar affinity, NAT inhibitor preferentially increase at inner side PFC (mPFC) EC of DA in, compared with caudatum and nucleus accumbens septi (NAc).Therefore, from the NA of locus coeruleus (LC) neuron Aixs cylinder may facilitate the EC of DA in regulation PFC, by absorbing or common-release.

Another aspect, the present invention relates to the conjugate of the present invention, wherein

I () selective reagent is selected from dopamine reuptake inhibitor, NRI, 5-hydroxyl color Amine-NRI and norepinephrine-dopamine reuptake inhibitor (NDRI) and

(ii) oligonucleotide can specifically be bound to target molecule, and described target molecule is coding noradrenaline transporter Body or the mRNA of norepinephrine polypeptide

For treatment or prevention by norepinephrine reuptake suppression mediation or to norepinephrine reuptake The sensitive disease of suppression.

Such medical symptom includes, by way of example, and pain disorder such as neuropathic pain and chronic pain, press down Strongly fragrant disease such as severe depression, affective disorder such as anxiety neurosis, attention deficit hyperactivity disorder, cognitive disorder is the most dull-witted, and Stress urinary incontinence.

D.4.Comprising the conjugate of nucleic acid, described nucleic acid targets dopamine-β-hydroxylase

The most as explained in the background section, the increase of the DA conveying of middle Cerebral cortex may be to schizoid treatment by Useful.This increase may be realized by the application of norepinephrine transporter inhibitor, or, alternatively, pass through Dopamine-β-hydroxylase is suppressed to realize.This enzyme is responsible for becoming Dopamine Turnover norepinephrine, and therefore, instantly Timing, the raising of dopamine level that will cause in NA neuron.This is comprising the norepinephrine energy of NA by being sequentially generated In vesicle and the DA of higher level.This increases the DA level of NA projection area and improves the cognition of brain and remember relevant function.

Therefore, another aspect, the present invention relates to conjugate of the present invention, wherein

I () selective reagent is selected from norepinephrine transporter inhibitor (SDNRI) and norepinephrine-dopamine Reuptake inhibitor (NDRI) and

(ii) oligonucleotide can specifically be bound to target molecule, its be coding dopamine-β-hydroxylase or dopamine- The mRNA of B-hydroxylase polypeptide

For the relevant disease that treatment or prevention are not enough with the dopamine of norepinephrine energy projection.

Expression used herein " relevant disease not enough with the dopamine of norepinephrine energy projection " refer to dull-witted, The depressed memory relevant with neurodegenerative disease and cognitive process.

D.5.Comprising the conjugate of nucleic acid, described nucleic acid targets BAXIn yet another aspect, the present invention relates to the present invention sew CloseThing, wherein

I () selective reagent is selected from 5-hydroxy tryptamine-dopamine-NRI (SDNRI) and go Methylepinephrine-dopamine reuptake inhibitor (NDRI) and

(ii) oligonucleotide can specifically be bound to target molecule, and it is the mRNA of coding BAX or BAX polypeptide

For the disease that treatment or prevention are relevant to the apoptosis of neuron and cell death.

Terminology used herein " disease relevant to the apoptosis of neuron and cell death " refers to that many people are neural " terminal " of sexual disorders, include but not limited to Alzheimer, parkinson disease and Huntington Chorea, apoplexy/wound, multiple firmly Change and amyotrophic lateral sclerosis.The apoptosis of the neuron with cortex of Hippocampus is the reason of the symptom of Alzheimer； The death using the midbrain neuron of neurotransmitter dopamine is that Parkinsonian basis occurs；Huntington Chorea relates in striatum Control the death of the neuron of health action；And the mortality table of LM reveals amyotrophic lateral sclerosis.It addition, Cerebral ischemia and the necrosis in wound-induced microcephalus region, then it is withered away to bigger by apoptosis diffusion neuronal cell Brain region, due to the neurotoxic substances of non-viable non-apoptotic cell release.The extinction of the neuronal cell of apoptosis is also seen in aging brain Observe, as a physiological process.

D.6.Comprising the conjugate of nucleic acid, described nucleic acid targets tau

In yet another aspect, the present invention relates to conjugate of the present invention, wherein

(ii) oligonucleotide can specifically be bound to target molecule, and it is the mRNA of coding tau or Tau polypeptide

For treating or preventing tau relevant disease.

Terminology used herein " tau relevant disease " refers to relevant disease abnormal to Tau and the disease of " Tau pathological changes " Sick.Tau relevant disease includes, but not limited to the hypotype including frontotemporal dementia and No. 17 parkinson's syndromes that chromosome is relevant (FTDP-17) frontotemporal dementia (frontotemporal dementia), progressive supranuclear plasy, cortical basal ganglionic degeneration, Creutzfeldt jakob disease, argyrophilic grain disease, and parkinson disease, mongolism, postencephalitic parkinsonism, steinert's disease, Buddhist nun Graceful-pik c-type disease, boxer's dementia, Blint disease, prion disease, amyotrophic lateral sclerosis, pass island parkinson's syndrome, many The property sent out hardening, glaucoma, diabetic retinopathy, and traumatic brain injury；And Huntington Chorea, dementia with Lewy body, proper gram- Ma Li-Du Sishi disease, hereditary spastic paraplegia and multiple system atrophy.Defined herein " Tau pathological changes " means and the fibre in brain The neurodegenerative disease that the Tau albumen (entanglement tangles) of dimensionization form is relevant.These diseases include AD；But, other Tau Pathological changes includes, but not limited to the volume temporo of the hypotype including frontotemporal dementia and No. 17 Parkinson's diseases that chromosome is relevant (FTDP-17) Dementia, progressive supranuclear plasy, cortical basal ganglionic degeneration, a creutzfeldt jakob disease and argyrophilic grain disease.

D.7.Comprising the conjugate of nucleic acid, described nucleic acid targets Huntingdon

(ii) oligonucleotide can specifically be bound to target molecule, and it is coding Huntingdon or the mRNA of Huntingdon polypeptide

For treating or preventing Huntingdon relevant disease.

Terminology used herein " Huntingdon relevant disease " refers to the anomalous structure by saltant type Huntington protein or gathering Or express the disease caused, and include, but not limited to Huntington Chorea and mutation thereof.

The therapeutic dose of the present invention, it will be effective in the treatment of particular condition or symptom, will depend upon which obstacle or disease The character of shape, and can be determined by standard clinical techniques, set up well in the dosage regimen for the treatment of.In preparation The exact dose of employing also be will depend upon which the seriousness of route of administration and disease or disease, and should be according to the judgement of doctor Determine with the needs of patient.The suitable dosage range of intracranial administration is typically every microlitre about 103 to 1015 infectious unit Viral vector, with in the single volume injected of 1 to 3000 microlitre be administered.In every microlitre, the addition of the infectious unit of carrier leads to Often will include 10 4,10 5,10 6,10 7,10 8,10 9,10 10,10 11,10 12,10 13,1014 infectious units Viral vector, gives with about 10,50,100,200,500,1000 or 2000 microlitres.Effective dose may from based on external or The dose-response curve of iii vivo test systems deduces.

For the intracerebroventricular administration of conjugate of the present invention, the multiple catheters with access port can be implanted to particular patient body Interior for complete treatment.In a preferred embodiment, every brain or hemisphaerium cerebelli have a mouth and a conduit system, and also Permitted to have multiple.Once being completed to implant by neurosurgeon, the neurologist, nerve specialist doctor of patient can carry out course of therapy, described Course of therapy be repetition bolus injection conjugate within the time of exceedance thoughtful several months, during this period of time treat simultaneously The monitoring of effect.Device can keep the treatment implanting some moons or year for full course for the treatment of.After therapeutic effect confirms, access port can Can selectively remove, and can seal and abandon conduit, or remove equally.Device materials should not disturb magnetic resonance to become Picture, and, certainly, siRNA preparation must be compatible with access port and tube material and any surface coatings.

The synthesis of conjugate the most of the present invention

Typical case's synthesis of the conjugate of the present invention is to use the standardization program in organic synthesis to synthesize.Technical staff will Being understood by, definite synthesis step will depend upon which the precise structure of conjugate to be synthesized.Such as, if conjugate comprises The single nucleic acid chains of selective reagent it is conjugated to, then synthesis is generally by the carrying out of following description, by by amino by 5 ' ends Activation oligonucleotide contacts connection with reaction activation selective reagent to be carried out.

When conjugate comprises double-strandednucleic acid, then justice is separately synthesized with antisense strand and uses standard molecular biology program External annealing.In typical conjugate, the first nucleic acid chains is loaded with selective reagent, and the second nucleic acid chains is loaded with blocking group. Also in a preferred embodiment, selective reagent is coupled to 5 ' ends and/or the blocking group connection of the first nucleic acid chains To the second nucleic acid chains 5 ' end, although the connection of selective reagent or the connection of blocking group can also hold in the 3 ' of nucleic acid chains into OK.

The synthesis of conjugate can be carried out according to following:

[1] conjugate has following structure

Selective reagent-[oligonucleotide]-3 '

Typically synthesize by following steps:

(i) activation selective reagent.Preferably, the activated group in selective reagent is butanimide group or ammonia Base；

(ii) at 5 ' end activation oligonucleotide.Preferably, the activated group in oligonucleotide is amino (wherein selectivity examination Agent is activated by butanimide group) or carboxyl (wherein selective reagent has passed through amino-reactive) and

(iii) it is being suitable between two activated groups under conditions of reaction, by the widow of the selective reagent of activation with activation Nucleotide contact connects.

[2] there is the conjugate of following structure

Blocking group-[positive-sense strand]-3 '

3 '-[antisense strand]-selective reagent

Following steps are typically used to synthesize:

(i) activation selective reagent.Preferably, the activated group in selective reagent is butanimide group or ammonia Base,

(ii) at 5 ' end activation positive-sense strands of positive-sense strand.Preferably, the activated group in oligonucleotide is that amino (wherein selects Selecting property reagent is activated by butanimide group) or carboxyl (wherein selective reagent has passed through amino-reactive),

(iii) it is being suitable between two activated groups under conditions of reaction, by the selective reagent of activation with activation just Justice chain contact connects,

(iv) blocking group is added to immobilized antisense strand.The step for be preferably used active group and be acetylation Or the oligonucleotide that benzylation (furan group), 2-cyanoethylation (di-phosphate ester connection) and FMOC (exocyclic amino group) close comes Carry out.

V positive-sense strand and antisense strand are annealed by ().

E.1.The synthesis of the conjugate comprising nucleic acid and be connected to the 5 ' SSRI held

The conjugate of the present invention can prepare by technology well known by persons skilled in the art.The synthesis of conjugate can Can relate to selective protection and the deprotection of functional groups.Suitably blocking group is to well known to a person skilled in the art.Example As, by Wuts, P.G.M. and Greene T.W. at " blocking group in organic synthesis " (Protecting Groups in Organic Synthesis) (fourth edition .Wiley-Interscience), and Kocienski P.J. is at " blocking group " Blocking group in the organic chemistry provided in (Protecting Groups) (third edition Georg Thieme Verlag) Summary.

In the context of the present invention, the meaning of following term is described in detail below:

-term " C₁-C₆Alkyl " refer to the linear or alkyl of branch that is made up of carbon and hydrogen atom, it does not include unsaturation Group, has 1 to 6, preferably 1 to 3 (C₁-C₃Alkyl) individual carbon atom, and it is other parts being combined in molecule by singly-bound On.The example of alkyl include but not limited to alkyl such as methyl, ethyl, propyl group, isopropyl, butyl, isobutyl group, the tert-butyl group, penta Base and hexyl.Preferably, alkyl refers to methyl.

-term " halogen " refers to bromine, chlorine, iodine or fluorine.

-term " alkylhalide group " refers to that alkyl as defined above, at least one of which hydrogen atom are replaced by halogen atom. The example of alkylhalide group includes but not limited to CF₃、CCl₃、CHF₂、CF₂CF₃.Preferably, alkylhalide group refers to CF₃。

-term " C₆-C₁₀Aryl " refer to the aromatic group with 6-10 carbon atom, comprise 1 or 2 aromatic proton, by Carbon-carbon bond or condense combines, including such as phenyl, naphthyl and diphenyl.Preferably, " aryl " refers to phenyl.

-term " heterocyclic radical " refers to stable 3-to 10-unit ring group, preferably 5-or 6-ring, its by carbon atom and 1-5 the hetero atom composition selected from nitrogen, oxygen and sulfur, and it can the most saturated or (" heteroaryl of fragrance Base ").For the purposes of the present invention, heterocycle can make monocycle base, bicyclic group or three ring group modes, and it can include fused rings Mode.In a specific embodiment, heterocyclic group is butanimide.

The compound of the present invention represented by formula (I) potentially includes stereoisomer as described above, and it depends on hands The existence at property center.Single isomer, enantiomer or non-corresponding isomer and mixture thereof each fall within protection scope of the present invention.

Except as otherwise noted, the compound used by the present invention is intended to cover in the existence of one or more isotope enrichment atom Lower and the most different compounds.Such as, except substituting hydrogen with deuterium or tritium, or with 13C-or¹⁴C-enrichment carbon or¹⁵N- It is within the scope of the invention that enriched in nitrogen substitutes the compound with present configuration outside carbon.

i.The Sertraline derivant synthesis of the nucleic acid derivative with amino and activation

In first embodiment, the conjugate of the present invention can be by being coupled to Sertraline by the nucleic acid that amino is derivative Or the activated derivatives form of its analog and obtain, wherein the activated derivatives of selective reagent is formula (II) compound:

Wherein

X and Y is independently selected from hydrogen, halogen, C₁-C₃Alkyl, C₁-C₃Alkylhalide group, OR^aAnd SR^b, wherein R^aAnd R^bIt is independent Ground is selected from C₁-C₃Alkyl and C₆-C₁₀Aryl；

R⁶It it is carbonyl-activating base；

W is selected from hydrogen, halogen, CN, NO₂、C₁-C₃Alkyl, C₁-C₃Alkylhalide group, NR^cR^d、SO₂NR^eR^f、NR^gSO₂R^h、CO₂Rⁱ, its Middle R^c、R^d、R^e、R^f、R^g、R^hAnd RⁱIt is independently selected from hydrogen and C₁-C₃Alkyl；

N and p is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13.

Term " carbonyl-activating base " refers to the substituent group of carbonyl, and it makes carbonyl that nucleophilic addition easily to occur.At a tool In the embodiment of body, it forms anhydride, carboxylic acid halides or ester group together with carbonyl.In one preferred embodiment, carbonyl is lived Change base be selected from halogen ,-OC (O) R ,-OR ' ,-SR "；Wherein R, R ' and R " it is independently selected from C₁-C₆Alkyl, alkylhalide group, heterocycle Base, aryl and heteroaryl.

In a specific embodiment, R⁶It it is succinimido.Therefore, in another embodiment, this Bright conjugate can be by being coupled to the activated derivatives form of Sertraline or its analog, wherein by the nucleic acid that amino is derivative The activated derivatives of selective reagent is formula (III) compound:

Wherein

R¹, R², R³, R⁴And R⁵It is independently selected from hydrogen and C₁-C₆Alkyl；

N and p is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13.

According to specific embodiment, the activating compounds of formula (III) is compound (1):

According to an embodiment, formula (I) compound can be prepared by following sequence, including:

A) formula (IV) compound

With formula (V) acylation reaction:

Wherein p is as defined above, and Z is halogen or OH and PG is that amido protecting group is to obtain formula (VI) compound

The blocking group being generally used for amino includes carbamates, the such as tert-butyl group, benzyl, 2,2,2-tri-chloroethenes Base, 2-trimethylsilyl ethyl, 9H-fluorenylmethyloxycarbonyl (Fmoc), pi-allyl or nitrophenylcarbamate；Amide Class, such as benzamide type, ethanamide, trifluoroacetyl amine, sulfonamides, trifluoromethyl sulfonyl amide-type or the tert-butyl group Sulfonyl amide-type；With aryl or aralkyl amine, such as p-methoxyphenyl, benzyl, p-methoxy-benzyl, 3,4-diformazan Oxy-benzyl, dimethoxytrityl or monomethoxytrityl amine.In a specific embodiment, formula (V) acylating agent is 9H-fluorenylmethyloxycarbonyl-6-aminocaprolc acid.

Formula (IV) compound such as can be sequentially prepared according to the method described in US6455736 and obtain.Specifically, formula is worked as (IV), during Formula Sertraline, it can process with suitable alkali from its corresponding hydrochlorate (can commercial buy) Arrive, including the organic or carbonate of inorganic basis such as alkali or alkaline-earth metal or hydroxide, ammonium salt or amine such as trimethylamine, Triethylamine, diisopropylethylamine, pyridine, piperidines, morpholine and the like.

B) the amido protecting group deprotection in formula (IV) compound is to generate formula (VII) compound:

Suitably deprotection condition is known to the skilled person, such as " blocking group in organic synthesis " (Protecting Groups in Organic Synthesis) (Wuts, P.G.M.andGreene T.W., fourth edition And " blocking group " (ProtectingGroups () Kocienski P.J., third edition .Wiley-Interscience) .Georg Thieme Verlag).In a specific embodiment, blocking group is to remove in the case of there is amine , such as piperidines, morpholine, hexanamine, diisopropylethylamine or dimethylamino naphthyridine, preferably in the presence of piperidines.

C) formula (VII) compound and formula (VIII) or (IX) acylation reaction:

Wherein n is as defined above, and Z is halogen or OH, generation formula (X) compound:

In a specific embodiment, formula (VII) acylating agent is succinic anhydride,

D) formula (X) compound is processed with carbonyl-activating base.

Term " carbonyl-activating base " refers to a compound, and the carbonyl of hydroxy-acid group is converted into and is easier to nucleophilic addition by it The compound of reaction, such as anhydride, carboxylic acid halide, carbodiimides, halogenating agent, disulphide etc..Concrete at one In embodiment, carbonyl-activating base is selected from halogenating agent, R (O) COC (O) R, RC (O) halogen, R ' OH, R " SH, R " SSR "；Wherein R, R ' and R " it is independently selected from C₁-C₆Alkyl, alkylhalide group, heterocyclic radical, aryl and heteroaryl.

In a specific embodiment, carbonyl-activating base is N-hydroxy-succinimide.In that case, instead Should preferably carry out under there is other carbonyl-activating base.

Therefore, in a specific embodiment, step d) comprises and is used in the situation that there is other carbonyl-activating base Lower N hydroxyl butanimide processes formula (X) compound.

The carbonyl-activating base being suitable for this method includes carbodiimide class, such as dicyclohexylcarbodiimide (DCC) and two Diisopropylcarbodiimide (DIC) and triazole alcohols (triazolols), such as 1-hydroxy-benzotriazole (HOBt) and 1-hydroxyl Base-7-azepine-benzotriazole (HOAt).In a specific embodiment, formula (VI) compound is sub-at diisopropyl carbon two React with N-hydroxy-succinamide in the presence of amine to provide the activated derivatives of formula (II).

According to another aspect, present invention is generally directed to the intermediate shown in formula (VI),

Wherein R¹-R⁵, X, Y, W, p and PG as defined above.In one preferred embodiment, R¹It is methyl, R²-R⁵It is Hydrogen, X and Y is chlorine, and W is hydrogen, and p is 5 and PG to be 9H-fluorenylmethyloxycarbonyl.It is highly preferred that formula (VI) compound is compound (2)

According to another aspect, present invention is generally directed to the intermediate shown in formula (VII),

Wherein R¹-R⁵, X, Y, W and p as defined above.In one preferred embodiment, R¹It is methyl, R²-R⁵It is hydrogen, X and Y is chloride, and W is hydrogen, and p is 5.It is highly preferred that formula (V) compound is compound (3)

According to another aspect, present invention is generally directed to the intermediate shown in formula (X)

Wherein R¹-R⁵, X, Y, W, p and n as defined above.In one preferred embodiment, R¹It is methyl, R²-R⁵It is Hydrogen, X and Y is chloride, and W is hydrogen, and p is 5 and n to be 2.It is highly preferred that formula (VIII) compound is compound (4)

According to another aspect, present invention is generally directed to the intermediate shown in formula (II),

Wherein R¹-R⁶, X, Y, W, p and n as defined above.

According to another aspect, present invention is generally directed to the intermediate shown in formula (III)

Wherein R¹-R⁵, X, Y, W, p and n as defined above.In one preferred embodiment, R¹It is methyl, R²-R⁵It is Hydrogen, X and Y is chloride, and W is hydrogen, and p is 5 and n to be 2.It is highly preferred that formula (II) compound is compound (1)

The siRNA chain that will be connected to selective reagent is formed by progressively solid phase synthesis on a solid support, The method of described formation edits printing in 1985 " synthesis of oligonucleotide, practical method according to M.J.Gait.IRL (Oligonucleotide synthesis, a practical approach). method disclosed in ".

In order to put together selective ligands, oligonucleotide needs by amino derivatization.This can be carried out at 5 ' or 3 ' ends.One Individual preferred embodiment in, selective ligands be connected to 5 ' end.

According to an embodiment, the preparation of the conjugate of formula (I) can be by by formula described above (II) or (III) The amido modified oligonucleotide of compound and formula (XII) carries out reaction and obtains:

Use the general procedure of amino linker dressing agent activation oligonucleotide typically by below scheme:

Formula (XII) compound can be by the amido modified dose of reaction by 5 '-OH groups of oligonucleotide Yu formula (XIII) And prepare:

Wherein m is as defined above, and PG is amine protecting group group.The blocking group being generally used for amine includes amino first Esters of gallic acid, the such as tert-butyl group, benzyl, 2,2,2-trichloroethyl, 2-trimethylsilyl ethyl, 9H-fluorenylmethyloxycarbonyl (Fmoc), Pi-allyl or nitrophenylcarbamate；Amide-type, such as Methanamide, acetamide, trifluoroacetamide, sulfonamide, fluoroform Base sulfonyl amide or tert-butylsulfonyl amides；And aryl or aralkyl amine, such as p-methoxyphenyl, benzyl, right Methoxy-benzyl, 3,4-dimethoxy-benzyl, dimethoxytrityl or monomethoxytrityl amine.In concrete enforcement In mode, the amino linker of formula (XIII) be 6-(trifluoroacetyl amido) hexyl-[(2-cyanoethyl)-(N, N-diisopropyl)]- Phosphoramidite (amido modified dose of-CEP of 5 '-TFA-C6-) or 6-(4-mono methoxy triphenylmethylamino) hexyl-[(2-cyanogen second Base)-(N, N-diisopropyl)]-phosphoramidite (amido modified dose of-CEP of 5 '-MMT-C6-).

By oligonucleotide 5 '-OH group be coupled to amino linker after, amine protecting group group under the conditions of known remove. Such as, the aminoderivative of TFA-protection can be with ammonia treatment and deprotection；And the aminoderivative of MMT-protection can use vinegar Acid, monoxone, dichloroacetic acid or trifluoroacetic acid process and deprotection.

The general synthetic method of amido modified oligonucleotide:

I () prepares joint/dressing agent molecular solution (commercially available aminoderivative of most of business in anhydrous acetonitrile (amidite) 0.1M solution is used) and place it in the extra groove of synthesizer (Y)

(ii) when the synthesis of required oligonucleotide sequence starts, Y base is added at 5 ' ends.This by make joint from Y-slot/ Dressing agent molecule is coupled to the end of oligonucleotide sequence.

(iii) appropriate coupling cycle is used to start synthesis.Identical coupling cycle will be used to realize joint/dressing agent Molecule coupling.

(iv) when oligonucleotide end of synthesis, wash vehicle also finally uses gas drying carrier

V () takes off solid carrier from post, and it be transferred in screw-cap vial, and completes 2 step deprotections.

Amido modified oligonucleotide should be puted together for selective reagent further by deprotection.In order to following this Individual purpose, all residue blocking groups on oligonucleotide are removed as follows.500 μ l are comprised 20%v/v methylamine (aqueous solution 40%w/v) mixed liquor with 80%v/v saturated ammonia solution (comprises 30-32%w/v NH₃) join and (weigh containing oligonucleotide The amount of 200nmole) Eppendorf tube in.By the seal of tube and heat 45 minutes be 65 DEG C to temperature.This process removes nucleoside Blocking group (the 2-cyanoethylation that the acetylation of furanose or henzylate and di-phosphate ester connect) on the phosphorus atoms of acid, Yi Jihuan The blocking group (Bz, Ac, IBu) of outer amino.Then, mixture cools down and filters, and is dried by supernatant.Residual lamellar is sunk Thing 1M triethylamine-HF in shallow lake reacts blocking group (2 '-fert-butyidimethylsilyl that 3 hours with the 2 ' of separately nucleotide at 65 DEG C Silicyl-TBDMS).Finally, the desalination in sephadex column of gained solution, leave amido modified-5 '-oligonucleotide.

In the case of 3 ' OH ends combine amido modified dose of joint；Should use corresponding polymer support (CPG ball) and And synthetic schemes is carried out according to following sketch accordingly:

(ammonium hydroxide or Beckman reagent can be used to be hydrolyzed) (methylamine: ammonium hydroxide)

In both cases, deprotection steps will be identical, and conjugation methods is also identical in this case, But there is efficiency in various degree.In most of the cases, more preferable result is reached by 5 '-amino derivatization.

In a preferred embodiment, oligonucleotide can comprise the sequence selected from SEQ ID NO:5 to 12.

Then, the oligonucleotide of amino-reactive derives with the activation of formula defined above (II) or (III) selective reagent Thing reacts.Obtain and there is the conjugate of following structure:

Wherein R¹-R⁵, X, Y, W, p and n be as defined above, and m is 2-10.

In one preferred embodiment, conjugate has a following structure:

In a particular embodiment, oligonucleotide is first to react with bivalence or three valent phosphors amide.In this manner it is possible to achieve Compound with 2 or 3 coupling positions, in order to 2 or 3 selective reagent molecules can be coupled to oligonucleotide.Described 2 Individual or 3 selective reagents can be similar or different.

In a particular embodiment, 2 or 3 identical selective reagent molecules are coupled to oligonucleotide.Separately In one embodiment, 2 or 3 different selective reagents are coupled to oligonucleotide.

In embodiments, oligonucleotide and bivalence or trivalent phosphoramidite react production (XX) or (XXI) compound:

Wherein

PG, PG " and PG " ' it is independently selected from H and hydroxy-protective group；

R, r ', r ", s, s ', s ", t and u be independently selected from 0,1,2,3,4,5,6,7,8,9,10,11,12 and 13；

V is independently selected from 0 and 1；And

X ¹ 、X ² And X ³It is independently selected from CH₂, O, S, NH, CO, C (O) O and C (O) NH.

Hydroxy-protective group, and suitably protection and deprotection condition, be known to the skilled person, such as " organic Blocking group in chemistry " (Protecting Groups in Organic Synthesis) (Wuts, P.G.M.and Greene T.W., fourth edition .Wiley-Interscience) and " blocking group " (Protecting Groups) In (Kocienski P.J., third edition .Georg Thieme Verlag).

In a specific embodiment, hydroxy-protective group is selected from ethers, silicyl ethers, esters, sulfonic acid esters, secondary sulphur Esters of gallic acid, sulfinic acid esters, carbonates and carbamates.In preferred embodiment, hydroxy-protective group is Selected from acetyl group, benzoyl, benzyl, methoxyl group ethoxymethyl ether (MEM), dimethoxytrityl (DMT), methoxy methyl Base ether (MOM), Methoxytrityl (MMT), p-methoxy-benzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), four Hydrogenation pyranose (THP), trityl (Tr), 9H-fluorenes methoxy carbonyl (Fmoc), trimethyl silyl (TMS), tert-butyl group diformazan Base silicyl (TBDMS), t-butyldimethylsilyloxy ylmethyl (TOM) and triisopropylsilyl (TIPS) ether. Preferably, PG, PG ' and PG " it is independently selected from H, DMT and Fmoc.

In a particular embodiment, the hydroxy-protective group in formula (XX) or (XXI) compound is different, so it Can optionally deprotection and coupling if desired, can carry out with different molecules.

One specific embodiment is directed to formula (XX) compound, and wherein r and r ' is 4, s and s ' is 1, t and v is 0, X¹ And X²Represent C (O) NH and PG¹And PG²It is independently selected from H, DMT and Fmoc.Another embodiment relates to formula (XX) chemical combination Thing, wherein r is 2, r ' it is 0, s is 1, s ' it is 0, t and v is 0, X¹And X²Represent CH₂And PG¹And PG²Be independently selected from H and DMT。

One embodiment is directed to formula (XXI) compound, wherein r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and v is 0, X¹、X²And X³Represent O and PG¹、PG²And PG³It is independently selected from H and DMT.Another embodiment relates to formula (XXI) and changes Compound, wherein r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1, X¹、X²And X³Represent O and PG¹、PG²And PG³ It is independently selected from H and DMT.

Then, formula (XX) and (XXI) compound are by deprotection, if necessary, and amido modified with formula (XIII) Agent is reacted:

Wherein m and PG is as defined above and obtain formula (XXII) or (XXIII) compound respectively:

Wherein

m、m’、m”、r、r’、r”、s、s’、s”、t、u、v、X¹、X²And X³It is as previously defined.

Formula (XXII) and (XXIII) compound can react with formula (II) compound further, preferred with Formula (III) compound reacts, and generates conjugate (XXIV) and (XXV) respectively:

Wherein

m、m’、m”、n、n’、n”、p、p’、p”、r、r’、r”、s、s’、s”、t、u、v、X¹、X²、X³、R¹-R⁵, W, X, Y and Z be As described earlier.

Specific embodiment points to formula as defined above (XXIV) compound.

Another embodiment is directed to formula (XXIV) compound, and wherein, selective reagent is Sertraline, p and p ' is 5, n With n ' is 2, m and m ' is 6, r and r ' is 4, s and s ' is 1, t and v is 0 and X and X ' expression C (O) NH.Another embodiment Relating to formula (XXIV) compound, wherein selective reagent is Sertraline, p and p ' is 5, n and n ' is 2, m and m ' is 6, and r is 2, r ' Being 0, s is 1, s ' it is 0, t and v is 0 and X and X ' expression CH₂。

Specific embodiment is directed to formula defined above (XXV) compound.

One specific embodiment is directed to formula (XXV) compound, and wherein selective reagent is Sertraline, p, p ' and p " Be 5, n, n ' and n " be 2, m, m ' and m " be 6, r, r ' and r " be 3, s, s ' and s " be 1, t is 1, v be 0 and X, X ' and X " represent O.Another embodiment relates to formula (XXV) compound, and wherein selective reagent is Sertraline, p, p ' and p " it is 5, n, n ' and n " It is 2, m, m ' and m " it is 6, r, r ' and r " it is 3, s, s ' and s " it is 1, t is 1, and u is 3, and v is 1 and X, X ' and X " represent O.

ii.The derivative nucleic acid of carboxyl and the derivative Sertraline of amino is used to synthesize

In another embodiment, conjugate of the present invention be the selective reagent derivative by amino and carboxyl derivative Puting together of oligonucleotide acts on and obtains.

In a specific embodiment, the activated derivatives of selective reagent is formula (VII) compound:

Wherein

R₁、R₂、R₃、R₄And R₅It is independently selected from hydrogen and C₁-C₆Alkyl；

P is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13.

According to specific embodiment, formula as above (II) activating compounds is compound (3):

Formula (VII) compound can be prepared by the step of following sequence as described above, including:

(i) formula (IV) compound

With formula (V) acylation reaction:

Wherein p is as defined above, and Z is halogen or OH and PG is that amine protecting group group is to generate formula (VI) compound

The blocking group being generally used for amine includes carbamates, the such as tert-butyl group, benzyl, 2,2,2-trichloroethyl, 2-trimethylsilyl ethyl, 9H-fluorenylmethyloxycarbonyl (Fmoc), pi-allyl or nitrophenylcarbamate；Amide-type, such as Benzamide type, ethanamide, trifluoroacetyl amine, sulfonamides, trifluoromethyl sulfonyl amide-type or tert. butylsulfonyl acyl Amine；And aryl or aralkyl amine, such as p-methoxyphenyl, benzyl, p-methoxy-benzyl, 3,4-dimethoxy benzyl The amine of base, dimethoxytrityl or monomethoxytrityl.In a specific embodiment, formula (VII) is acylated Agent is 9H-fluorenylmethyloxycarbonyl-6-aminocaprolc acid.

Formula (III) compound is sequentially prepared the most as above and obtains.

(ii) the amido protecting group deprotection in formula (VI) compound, generation formula (VII) compound:

Suitably deprotection condition is known to the skilled person, such as " blocking group in organic synthesis " (Protecting Groups in Organic Synthesis) (Wuts, P.G.M.andGreene T.W., fourth edition And " blocking group " (ProtectingGroups) (Kocienski P.J., third edition ..Wiley-Interscience) Georg Thieme Verlag).In a particular embodiment, blocking group removes in the case of there is amine, such as Piperidines, morpholine, dicyclohexylamine, diisopropylethylamine or dimethylamino naphthyridine, there is preferably piperidines.

In one preferred embodiment, amido modified selective reagent corresponds to formula (3) compound.

The siRNA chain that will be connected to selective reagent is formed by progressively solid phase synthesis on a solid support, The method of described formation edits printing in 1985 " " oligonucleotide synthesizes, practical approach " according to M.J.Gait.IRL (Oligonucleotide synthesis, a practical approach). method disclosed in ".

In order to put together selective ligands, oligonucleotide needs by carboxyl derivatization.This can be carried out at 5 ' or 3 ' ends.Excellent In the embodiment of choosing, selective ligands is connected to 5 ' ends.

According to an embodiment, formula (XIV) conjugate can be by by formula described above (VII) compound and formula (XV) the oligonucleotide reaction of carboxyl modified prepares:

The general procedure using carboxyl joint dressing agent activation oligonucleotide is to carry out typically via below scheme:

The conventional method of the synthesis of the oligonucleotide of carboxyl modified:

(i) prepare in anhydrous acetonitrile dressing agent molecular solution and place it into synthesizer extra groove in (Y)

The oligonucleotide of carboxyl modified should be puted together for selective reagent further by deprotection.Under in order to This purpose of face, all residue blocking groups on oligonucleotide are removed as follows.By 500 μ l to comprise 20%v/v methylamine (water-soluble Liquid 40%w/v) and the mixed liquor of 80%v/v saturated ammonia solution (comprise 30-32%w/v NH₃) join containing oligonucleotide (title Weight 200nmole amount) Eppendorf tube pipe in.By the seal of tube and heat 45 minutes be 65 DEG C to temperature.This process removes Blocking group (the 2-cyanoethyl that the acetylation of furanose or benzoylation and di-phosphate ester connect on the phosphorus atoms of nucleotide Change), and the blocking group (Bz, Ac, IBu) of exocyclic amino group.Then, mixture cools down and filters, and is dried by supernatant. Residual pellet 1M triethylamine-HF reacts blocking group (2 '-uncle that 3 hours with the 2 ' of separately nucleotide at 65 DEG C Butyldimethylsilyl-TBDMS).Finally, the desalination in sephadex column of gained solution, stay carboxyl modified- 5 '-oligonucleotide.

Then, the oligonucleotide of activated carboxylic reacts with the activated derivatives of formula defined above (VII) selective reagent, The compound formula obtained is as follows:

In a particular embodiment, conjugate has structure

In another particular embodiment of the invention, conjugate has structure

In embodiments, first oligonucleotide reacts with bivalence or trivalent phosphoramidite, generates previously defined formula Or (XXI) compound (XX).Then, formula (XX) and (XXI) compound are by deprotection, if necessary, and and carboxyl modified Agent is reacted, and respectively obtains formula (XXVI) or (XXVII) compound:

Wherein

m、m’、m”、r、r’、r”、s、s’、s”、t、u、v、X ¹ 、X ² And X ³It is as defined above.

Formula (XXVI) and (XXVII) compound can react with formula (VII) compound further, generate conjugate respectively And (XXIX) (XXVIII):

Wherein

m、m’、m”、p、p’、p”、r、r’、r”、s、s’、s”、t、u、v、X¹、X²、X³、R¹-R⁵, W, X, Y and Z be to retouch as front State.

Detailed description of the invention is directed to the compound of formula defined above (XXVIII).

Detailed description of the invention is directed to formula (XXVIII) compound, and wherein selective reagent is Sertraline, p and p ' is 5, m With m ' is 6, r and r ' is 4, s and s ' is 1, t and v is 0 and X and X ' expression C (O) NH.Another relates to formula (XXVIII) chemical combination The embodiment of thing, wherein selective reagent is Sertraline, p and p ' is 5, m and m ' is 6, and r is 2, r ' it is 0, s is 1, s ' it is 0, t It is 0 and X and X ' expression CH with v₂.

Specific embodiment is directed to formula (XXVIII) compound, and wherein selective reagent is Sertraline, p and p ' is 5, M and m ' is 9, r and r ' is 4, s and s ' is 1, t and v is 0 and X and X ' expression C (O) NH.Another relates to formula (XXVIII) and changes The embodiment of compound, wherein selective reagent is Sertraline, p and p ' is 5, m and m ' is 9, and r is 2, r ' it is 0, s is 1, s ' be 0, t and v is 0 and X and X ' expression CH₂。

One specific embodiment is directed to formula as defined above (XXIX) compound.

One specific embodiment is directed to formula (XXIX) compound, and wherein selective reagent is Sertraline, p, p ' and P " be 5, m, m ' and m " be 6, r, r ' and r " be 3, s, s ' and s " be 1, t is 1, v be 0 and X, X ' and X " represent O.Another relates to And formula (XXIX) compound embodiment, wherein selective reagent is Sertraline, p, p ' and p " it is 5, m, m ' and m " it is 6, r, r ' And r " be 3, s, s ' and s " be 1, t is 1, and u is 3, v be 1 and X, X ' and X " represent O.

One specific embodiment is directed to formula (XXIX) compound, and wherein selective reagent is Sertraline, p, p ' and P " be 5, m, m ' and m " be 9, r, r ' and r " be 3, s, s ' and s " be 1, t is 1, v be 0 and X, X ' and X " represent O.Another relates to And the embodiment of formula (XXIX) compound, wherein selective reagent is Sertraline, p, p ' and p " it is 5, m, m ' and m " it is 9, r, R ' and r " be 3, s, s ' and s " be 1, t is 1, and u is 3, v be 1 and X, X ' and X " represent O.

iii.The derivative nucleic acid of carboxyl and the derivative nomifensine of amino is used to synthesize

Nomifensine and the like comprises amino, its oligonucleotide that may be used in principle being coupled to carboxyl modified. But, amino is directly coupled on aromatic ring, causes its reactive reduction with sterically hindered.Therefore, amido modified Nuo meter Fen Pungent or its variant is made with the compound of formula (XVI):

Wherein R₁Represent hydrogen, alkyl C₁-C₆Base or benzyl

R₂Represent hydrogen, methyl, chlorine or fluorin radical

R₂' represent hydrogen, methyl, methoxyl group, hydroxyl or halogen atom

R₃And R₄Represent hydrogen, alkyl C₁-C₆Group

R₅Represent hydrogen, chlorine or methoxyl group in 5-or 6-position and

P is 2-6

In a specific embodiment, the activated derivatives of selective reagent is compound (5), wherein R₁、R₂、 R₂’、R₃And R₅It is H and R₄It it is methyl.

According to an embodiment, formula (XVI) compound can be prepared by following sequence, including:

A) formula (XVII) compound

With formula (V) acylation reaction:

Wherein p is as defined above, and Z is halogen or OH and PG is amido protecting group, and production (XVIII) is changed Compound

The blocking group being generally used for amino includes carbamates, the such as tert-butyl group, benzyl, 2,2,2-tri-chloroethenes Base, 2-trimethylsilyl ethyl, 9H-fluorenylmethyloxycarbonyl (Fmoc), pi-allyl or nitrophenylcarbamate；Amide Class, such as benzamide type, ethanamide, trifluoroacetyl amine, sulfonamides, fluoroform sulfonamides, tert-butyl group sulfonamide, and Aromatic yl alkyl amine such as p-methoxyphenyl, benzyl, p-methoxy-benzyl, 3,4-dimethoxy-benzyl, dimethoxy triphen first Base or the amine of monomethoxytrityl.In a specific embodiment, formula (V) acylating agent be 9H-fluorenylmethyloxycarbonyl- 6-aminocaprolc acid.

Correspondingly, formula (XVII) compound can such as be described in the method described in US4185105 and prepares.Specifically For, when formula (III) compound is nomifensine, it can be from its corresponding hydrochlorate (commercially available) with being suitable for Alkali process and obtain, including organic inorganic basis is the most alkali-metal or the carbonate of alkaline-earth metal or hydroxide, ammonium or Person's amine such as trimethylamine, triethylamine, diisopropylethylamine, pyridine, piperidines, morpholine and the like.

B) the amido protecting group deprotection in formula (XVIII) compound, production (XIX) compound:

Suitably deprotection condition is known to the skilled person, such as " blocking group in organic synthesis " (Protecting Groups in Organic Synthesis) (Wuts, P.G.M. and GreeneT.W., fourth edition And " blocking group " (ProtectingGroups) (Kocienski P.J., third edition ..Wiley-Interscience) .Georg Thieme Verlag).In a specific embodiment, blocking group is to remove in the case of there is amine , such as piperidines, morpholine, hexanamine, diisopropylethylamine or dimethylamino naphthyridine, preferably remove in the presence of piperidines.

According to another aspect, the present invention is directed to the intermediate shown in formula (XVIII),

Wherein R¹-R⁵, X, Y, W, p and PG be as defined above.In one preferred embodiment, R¹Be methyl, R²-R⁵Being hydrogen, X and Y is chloride, and W is hydrogen, and p is 5 and PG to be 9H-fluorenylmethyloxycarbonyl.It is highly preferred that formula (XVIII) chemical combination Thing is compound (8)

The core (nucleic) that will be connected to selective reagent is to be formed by progressively solid phase synthesis on a solid support , the method for described formation edits printing in 1985 " synthesis of oligonucleotide, practical method according to M.J.Gait.IRL (Oligonucleotide synthesis, a practical approach). method disclosed in ".

In order to be conjugated to selective ligands, oligonucleotide needs by carboxyl derivatization.This can be carried out at 5 ' or 3 ' ends. In one preferred embodiment, selective ligands is connected to 5 ' ends.

According to an embodiment, formula (XVI) conjugate can be by formula described above (XIX) compound and formula (XV) Amido modified oligonucleotide reaction and prepare:

Wherein m is 2 to 6

Using activated carboxylic oligonucleotide is according to stated above carrying out.

In one preferred embodiment, the oligonucleotide being coupled to nomifensine or derivatives thereof is to be selected from:

I () nucleic acid, it is complementary with alpha-synapse nucleoprotein, it is preferable that nucleic acid is to comprise selected from any sequence SEQ ID Sequence in NO:16-36.

(ii) nucleic acid, it is complementary with BAX, preferably comprises the nucleic acid of sequence SEQ IDNO:38.

(iii) nucleic acid, it is complementary with Tau

(iv) nucleic acid, it is complementary with NET, and

V () nucleic acid, it is complementary with Huntingdon, it is preferable that nucleic acid is to comprise selected from any sequence SEQ ID NO:39- Sequence in 55.

Then, the oligonucleotide of activated carboxylic is anti-with the activated derivatives of formula as defined above (XVI) selective reagent Should, obtain following general formula compound:

In one preferred embodiment, conjugate has structure

Another preferred embodiment in, conjugate has structure

In a specific embodiment, formula (XVI) compound reacts with formula (XXVI) or (XXVII) compound, Generate conjugate (XXX) and (XXXI) respectively:

Wherein

m、m’、m”、p、p’、p”、r、r’、r”、s、s’、s”、t、u、v、X¹、X²、X³And R¹-R⁵It is as previously described.

One specific embodiment is directed to formula as defined above (XXX) compound.

One specific embodiment is directed to formula (XXX) compound, and wherein selective reagent is nomifensine, p and p ' Being 5, m and m ' is 6, r and r ' is 4, s and s ' is 1, t and v is 0 and X and X ' expression C (O) NH.Another relates to formula (XXVIII) embodiment of compound, wherein selective reagent is nomifensine, p and p ' is 5, m and m ' is 6, and r is 2, r ' be 0, s is 1, s ' it is 0, t and v is 0 and X and X ' expression CH₂。

One specific embodiment is directed to formula (XXX) compound, and wherein selective reagent is nomifensine, p and p ' Being 5, m and m ' is 9, r and r ' is 4, s and s ' is 1, t and v is 0 and X and X ' expression C (O) NH.Another relates to formula (XXVIII) embodiment of compound, wherein selective reagent is nomifensine, p and p ' is 5, m and m ' is 9, and r is 2, r ' be 0, s is 1, s ' it is 0, t and v is 0 and X and X ' expression CH₂。

One specific embodiment is directed to formula as defined above (XXXI) compound.

One specific embodiment is directed to formula (XXXI) compound, and wherein selective reagent is nomifensine, p, p ' And p " be 5, m, m ' and m " be 6, r, r ' and r " be 3, s, s ' and s " be 1, t is 1, v be 0 and X, X ' and X " represent O.Another Relating to the embodiment of formula (XXXI) compound, wherein selective reagent is nomifensine, p, p ' and p " it is 5, m, m ' and m " be 6, r, r ' and r " be 3, s, s ' and s " be 1, t is 1, and u is 3, v be 1 and X, X ' and X " represent O.One specific embodiment Being directed to formula (XXXI) compound, wherein selective reagent is nomifensine, p, p ' and p " it is 5, m, m ' and m " it is 9, r, r ' and R " be 3, s, s ' and s " be 1, t is 1, v be 0 and X, X ' and X " represent O.Another embodiment relates to formula (XXXI) chemical combination Thing, wherein selective reagent is nomifensine, p, p ' and p " it is 5, m, m ' and m " it is 9, r, r ' and r " it is 3, s, s ' and s " it is 1, t Being 1, u is 3, v be 1 and X, X ' and X " represent O.

iv.Use the derivative nomifensine of the derivative nucleic acid of carboxyl, bifunctional linker, amino and the derivative Sertraline of amino The oligonucleotide of synthesis double derivative

Formula (XX) and hydroxy-protective group PG, PG in (XXI) compound ' and PG " can be similar or different.

In a specific embodiment, PG and PG ' in formula (XX) compound is different, and so they can be only On the spot deprotection, and if necessary, the selective reagent coupling of the activation that formula (XX) compound can be different from 2.

In a specific embodiment, formula (XX) compounds different for PG and PG ' be continuously with carboxyl modified agent Then reaction, and react with formula (VII) compound, and other coupling positions are to react with carboxyl modified agent, and then with Formula (XVI) compound reacts, production (XXXII) conjugate

Wherein m, m ', p, p ', r, r ', s, s ', t, u, v, X¹、X²and R¹-R⁵, X, Y and Z be foregoing.

In one preferred embodiment, different for PG and PG ' formula (XX) compounds be continuously with carboxyl modified agent Then reaction, and react with formula (10) compound, and other coupling positions are to react with carboxyl modified agent, and then with formula (11) compound reaction, production (XXXIIa) conjugate.

Wherein r, r ', s, s ', t, u, v, X¹And X²It is foregoing.

In a specific embodiment, in formula (XXXII) or (XXXIIa) compound, r and r ' is 4, s and s ' is 1, t and v is 0 and X and X ' expression C (O) NH.

In a specific embodiment of the present invention, formula (XX) compounds different for PG and PG ' is formula (XXa) chemical combination Thing

In one preferred embodiment, formula (XXXIIa) compound has a following structural formula:

In a specific embodiment, the present invention is directed to formula (XXXII) and compound (XXXIIa), wherein m, m’、p、p’、r、r’、s、s’、t、u、v、X¹、X²And R¹-R⁵, X, Y and Z be foregoing.

In one preferred embodiment, the present invention relates to compound as defined above (12).

E.2.The synthesis of the conjugate comprising nucleic acid and be connected to the 5 ' blocking groups held.

Synthesis is from the beginning of blocking group joins Article 1 chain.Wherein blocking group is formed by some, is formed The different piece of the part of blocking group is added in nucleic acid, described Adding Way use similar nucleotide is joined pre- Method used during one-tenth nucleic acid, i.e. in order to increase the reactivity of free hydroxyl group, first the group being added into is activated.It is suitable for Activating reagent include, but not limited to phosphorothioate compound, carbamate compounds, methyl-phosphonate ester compounds, guanidine, Sulfamate compounds thing, sulfonamide compounds, formyl acetal compound, sulfur acute pyogenic infection of nails acyl acetal compound, sulphones, Phosphoramidate compounds.In one preferred embodiment, the group of blocking group be with phosphoramidite compound and Mixture activation.

The typical phosphamide being suitable for activating free OH group is, such as,

(2-cyanoethyl) N of following formula, N, N ', N '-four (diisopropyl) phosphorus diamides:

With (2-cyanoethyl) N-diisopropyl of following formula, N '-alkylamine phosphoramidite:

Wherein n is 6-12

Typical reaction comprises the following steps:

A) furanose unit (appropriate stoichiometry is known to those skilled in the art) is only being conducive to With 4 under conditions of primary hydroxyl group position response, 4 '-dimethoxy trityl chloride (DMTr-Cl) reacts.Then, remaining hydroxyl Base reacts with acetylation or benzoylation blocking group.Typically, the furanose of activation has a structure:

B) chain (it can be justice (s) chain or antisense (a) chain) of siRNA interested is by carrying in solid phase On body, solid phase synthesis gradually forms, wherein 5 '-OH groups of the end subunit in growing chain, and it is by two under normal circumstances Methoxytrityl (DMT) is protected, and places it under acid condition, in order to remove 5 '-OH DMT blocking groups, and purine Still protected by (fluorenes-9-base) methoxycarbonyl group (FMOC) with pyrimidine bases.Other blocking groups being suitable for are to have to be bound to ammonia The 6-unit morpholine ring of base phosphate compound, phosphorothioate compound and O-methyl (oxygen methyl) and O-ethyl (oxygen ethyl) group Compound.

C) the deprotection 5 '-OH group of siRNA chain and step A) furanose react, thus obtain the widow of primary-put together Nucleotide.Finally, in acid condition, the DMT blocking group of the primary hydroxyl group of furanose leaves 5 '-OH groups and removes.

D) there is active C18 unit joint (the hereinafter referred to as C of 6 ethylene glycol monomers (12 carbon atoms and 6 oxygen atoms)₁₈) Alkylene glycol monomer is to be formed by addition to the phosphoramidite compound of end OH under the conditions of phosphitylation, such as above (2-cyanoethyl) N, the N '-diisopropylphosphoramidite described.

The product that phosphoramidite compound those di-phosphate esters to being present in polynucleotide or oligonucleotide backbone connect Life is to be particularly useful.It is to have to be bound to phosphoramidate chemical combination for manufacturing other compounds being suitable for of reactive polyethylene glycol The compound of the 6-unit morpholine ring of thing, phosphorothioate compound and O-methyl (oxygen methyl) and O-ethyl (oxygen ethyl) group.

Typically, there is the activity (C of 6 ethylene glycol₁₈) alkylene glycol monomer has structure

E) 5 '-OH groups of the deprotection of furanose-siRNA chain and step D) activity (C₁₈) alkylene glycol monomer carries out Reaction, thus obtain have following formula second-put together oligonucleotide:

DMT-(C₁₈) alkylene glycol-di-phosphate ester-furanose-di-phosphate ester-RNA chain.

F)(C₁₈) the DMT blocking group of primary hydroxyl group of alkylene glycol is to leave 5 '-OH groups at acid condition and remove 's.

G)(C₁₈) the 5 '-OH groups of deprotection of alkylene glycol-di-phosphate ester-furanose-di-phosphate ester-RNA chain be with As step D) with second activity (C₁₈) alkylene glycol monomer reaction, thus obtain have following formula the 3rd-put together oligonucleoside Acid:

DMT-(C₁₈) alkylene glycol-di-phosphate ester-(C₁₈) alkylene glycol-di-phosphate ester-furanose-di-phosphate ester-RNA Chain.

H)(C₁₈) the DMT blocking group of primary hydroxyl group of alkylene glycol end be to leave 5 '-OH groups in acid condition and Remove, for processing further.

When blocking group includes lipid part, it is included in the method for the oligonucleotide construct obtaining the present invention Step H) and (I) between extra step, wherein lipid part, preferably with active ester, amine, mercaptan or the acid of fatty acid Form, be to be bound to end group (furanose or C18 alkylene glycol, depend on the circumstances).Those skilled in the art are permissible Select appropriate condition, reagent etc. to carry out described step, according to lipid and the character of described group.Preferably condition is to use The fatty acid derivitization of phosphoramidite chemistry produces anakmetomeres, and it can pass through phosphorus by 5 '-OH or 3 ' OH free-end Acid diesters key is condensed to oligonucleotide construct.

E.3.By annealing conjugate synthesis siRNA, described conjugate is to comprise the first nucleic acid and be connected to the 5 ' guarantors held The conjugate protecting radical protection and the conjugate of the conjugate comprising complementary nucleic acid chain and the SSRI being connected to 5 '

The complementary strand of the siRNA being conjugated to SSRI of the acquisition as described in the most E.1 is to obtain with as defined in E.2 The siRNA chain of modification anneal together.For this purpose, all residue blocking groups in RNA chain be first removed as Under.The mixed liquor 30 comprising 20%v/v methylamine (aqueous solution 40%w/v) and 80%v/v saturated ammonia solution of 500 μ l (is comprised 30-32%w/v NH₃) join in the Eppendorf tube containing oligonucleotide (amount of the 200nmole that weighs).By the seal of tube and add Hot 45 minutes is 65 DEG C to temperature.This process remove blocking group on the phosphorus atoms of nucleotide (acetylation of furanose or The 2-cyanoethylation that Benzylation and di-phosphate ester connects), and the blocking group (FMOC) of exocyclic amino group.Then, by mixture Cool down and filter, and supernatant is dried.Residual pellet 1M triethylamine-HF reacts 3 hours to remove at 65 DEG C Go nucleotide 2 ' blocking group (2 '-t-butyldimethylsilyl-TBDMS).Finally, gained solution coagulates at glucosan Desalination in glue post.

The Nucleic acids anneal condition being applicable to be formed such duplex structure is by (" molecules gram such as Joseph Sambrook Grand, laboratory manual " cold spring harbor laboratory's publication, Cold SpringHarbor, New York, 2001 (Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001)) and (" nucleic acid hybridization practical approach ", IRL publishes, Washington, 1985, (Nucleic Acid for Haymes, B.D. etc. Hybridization, A PracticalApproach, IRL Press, Washington, D.C., 1985)) described by.

The effect of the oligonucleotide construct of the present invention is exemplified below.Embodiment 2 indicates the siRNA oligonucleoside of the present invention Acid sequence, compared with the siRNA of corresponding naked form, has largely blocked target presynaptic 5-HT_1AThe expression of R, institute The siRNA oligonucleotide sequence of the present invention stated, is the furanose with the chain being connected to siRNA and a double C₁₈Alkylene Glycol and be connected to the Sertraline of other chains by linking arm.

F. diagnosis conjugate and application thereof

Can also be applied by the probability using selective reagent that therapeutic compound is specifically delivered to target cell In the delivery of the compound that can be used as diagnostic purpose, described selective reagent is can be bound to neurotransmitter turn high-affinity Fortune body.Therefore, in another embodiment, the conjugate that the present invention provides, comprise

(i) at least one selective reagent, it is specifically bound to one or more neurotransmitter transporters, and

(ii) developer.

Term " selective reagent " and " neurotransmitter transporters " describe with having been detailed above, and examining in the present invention Disconnected conjugate can do and similarly understand.

Term " developer " and " contrast agent " can exchange use herein, and refer to biocompatible compound, it Use contribute to the differentiation of image different piece, it is by increasing " contrast " between those zoness of different of image. Therefore, term " contrast agent " comprises the reagent of the quality for strengthening image, but image may be under not having such reagent Producing (this situation, such as MRI), also having reagent is the necessary condition (this situation, such as nuclear imaging) producing image.It is suitable for Contrast agent include, be not limited to, for radionuclide imaging, computer control layer radiography, Raman spectrum, nuclear magnetic resonance And the contrast agent of optical imagery (MRI).

Contrast agent for radionuclide imaging includes with positron emitter the most such as¹¹C、¹³N、¹⁵O、¹⁸F、⁸²Rb、⁶²Cu and⁶⁸The radiopharmaceutical of Ga labelling.SPECT radiopharmaceutical is with positron emitter the most such as⁹⁴mTc、²⁰¹Tl and⁶⁷Ga carrys out labelling.Radionuclide image pattern (positron emission computerized tomography, (PET)；Single photon emission calculates body Layer scanning (SPECT)) it is the cross-sectional imaging technology diagnosed, it maps the radioactive indicator of radionuclide-labelling Position and concentration.PET and SPECT may be used for being positioned by measurement metabolic activity and being characterized radionuclide.PET and SPECT provides the viablity that the information about cellular level, such as cell are lived.In PET, patient is oral or injection is a small amount of launches The radioactive substance of positron, it is possible to monitor its movement in the body, in a common application, such as, suffer from Person connects the glucose of positron emitter, and monitors their brain when they perform various task.Owing to brain exists It work when use glucose, PET imaging show brain where activity is active.Some enforcement in the present invention In mode, cell is used for the in-vivo imaging of PET or SPECT by labeled in vitro.With PET be closely related be single photon emission calculate Body layer scans, or SPECT.Main difference is that it instead of positron emission material between Zhe Liangzhe, SPECT uses transmitting The radioactive indicator of lower energy photon.

Contrast agent for CT imaging includes, such as, iodate or the contrast agent of bromination.The example of this kind of reagent includes Iothalamate, iohexol, cardiografin, iopamidol, ethiodized Oil and iopanoate.Also have been reported that gadolinium reagent is used as CT contrast agent (see, e.g., Henson et al., 2004).Such as, gadopentetic acid reagent has been used as contrast agent (at Strunk and Schild In be discussed, 2004).In the context of the present invention, calculate body layer scanning (CT) to be thought over as imaging pattern.Pass through Capturing a series of X-rays from different angles, sometimes more than 1,000, and then they are used computer combined, CT makes to build The 3-D view at the vertical any position of health is possibly realized.Computer according to program with display from all angles and each degree of depth Two-dimensional slice.In CT, intravenous injection radiopaque contrast medium the most described herein those can help the knowledge of soft mass Not and describe, when initial CT scan is not diagnosis when.

Contrast agent for optical imagery includes, such as, fluorescein, fluorescein derivative, indocyanine green, Oregon are green (Oregon green), the green derivative derivant in Oregon, rhodamine green (rhodamine green), green the deriving of rhodamine The red derivant of thing, eosin, erythrosine, texas Red, Texas, peacock green, nanogold sulfosuccinimidyl ester (nanogoldsulfosuccinimidyl ester), cascade blue (Cascade blue), coumarin derivative, naphthalene, pyridine radicals Zole derivatives, cascade yellow dye (Cascade yellow dye), Dapoxyl dyestuff and disclosed herein various other are glimmering Optical compounds.

In one preferred embodiment, contrast agent is can be by the compound of nuclear magnetic resonance instrument imaging.Energy Enough is different by the contrast agent of nuclear magnetic resonance instrument imaging from those being used in other imaging techniques.Their purpose is In order to help the identification having between the tissue elements of identical signal characteristic, and (it will add at T1-in order to shorten slack time The spin echo MR image of power produces higher signal and in T2-weighting image, produces the signal of less intensity).MRI The example of contrast agent includes gadolinium chelate compound, manganic chelates, chromium complex and ferrum granule.In a specific embodiment, MRI Contrast agent is¹⁹F.CT and MRI provides information anatomically, is adapted to assist in the border distinguishing tissue.Compared with CT, MRI Shortcoming include the low toleration of relatively low patient, taboo in pacemaker and some other metal devices of implanting, Yi Jiyu The artifact that many reasons is relevant, is not only wherein motion.Another aspect, CT is quick, good toleration with And be readily available, but there is the contrast resolution lower than MRI and need iodinated contrast and ionizing radiation.CT and MRI Some shortcomings are the function informations that two kinds of imaging patterns are not providing on cellular level.Such as, both of which is not providing pass Information in cell viability.Nuclear magnetic resonance (MRI) is a kind of imaging pattern newer than CT, and it uses the Magnet of high intensity and penetrates Frequently signal is in order to produce image.Molecular species the abundantest in biological tissue is water.It is exactly quantum mechanics " oneself of water quality daughter nucleus Rotation " and finally make to produce signal in imaging experiment.In mri, the sample for imaging is placed on strong electromagnetostatic field (1-12 Tesla) and with the pulse excitation rotation of radio frequency (RF) to produce clean magnetic field in the sample.Then, various magnetic field gradients and its His RF impulse action is in rotation, to be become in tracer signal by spatial information coding.By collecting and analyzing these signals, having can Can calculate 3-D view, it, such as CT image, be normally to show on two-dimensional slice.

MRI contrast agent includes the complex of metal, described metal selected from chromium (III), manganese (II), ferrum (III), ferrum (II), Cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), Holmium (III) and erbium (III).In a preferred embodiment, it is possible to be gadolinio by the compound of nuclear magnetic resonance instrument imaging Compound.

Terminology used herein " gadolinio compound " mean that, in imaging aspect, can deliver medicine to any of experimenter Containing gadolinium material, it causes endovascular potentiation.In another embodiment, the contrast agent containing gadolinium is selected from gadolinium, gadolinium second amber Erythromycin (gadolinium pentate) and gadodiamide.

Dosage containing gadolinium contrast agent is the amount change at every kg body weight about 10mg.In another embodiment, Secondary nuclear magnetic resonance is carried out after administration contains gadolinium contrast agent about 45 minutes.The present invention also provides for said method, and it is further Comprise the step to experimenter's Intraperitoneal medication saline solution (such as, Ringers solution), its then step (c) or step (d) Administration.

The present invention also provides for the conjugate as defined above purposes as diagnosis reagent, and at surface expression The detection method of the cell of neurotransmitter transporters.

According to the cell type that will be imaged, conjugate will be in conjunction with one or more selective reagents.Following table describes root According to the selective reagent that cell type to be imaged can be used.

The present invention also provides for multi-modal imaging method.Certain embodiment of the present invention is about experimenter or experimenter The method of interior position imaging, uses the multiple imaging pattern including measuring multiple signal.In some embodiments, multiple letter Number by cell or interior single marking causes.As described above, any imaging pattern well known by persons skilled in the art can To be applied in these embodiments of this formation method.

The imaging pattern any time during the administration of marking composition such as labeled cell or after administration is carried out. Such as, imaging research can be carried out any time during the labeled cell of the present invention is administered or behind, i.e. to help It is directed to be administered to specific part.

Extra imaging pattern can be carried out with the first imaging pattern simultaneously, or during any after the first imaging pattern Between carry out.Such as, extra imaging pattern can about 1 second after the first imaging pattern completes, about 1 hour, about 1 day Or the longer time is carried out, or any time between these any preset times is carried out.At certain of the present invention In embodiment, multiple imaging pattern is carried out simultaneously, when so making they identical after labeled cell or agent administration Between start.Those skilled in the art should be familiar with the various imaging patterns that the present invention pays close attention to.

In some embodiments of this formation method, the first imaging pattern and the second imaging pattern are by identical imaging Instrument performs.In other embodiments, different imaging patterns is performed by different Image-forming instruments.Those skilled in the art should When being familiar with can be used for the Image-forming instrument of imaging pattern described herein.

The present invention provides the method for the imaging cells using one or more imaging patterns.In some embodiments, carefully Born of the same parents are with multiple imaging reagent labelling, and in other respects, cell is with single labelled reagent labelling.In certain embodiment, Single labelled reagent is that multi-mode can test agent.

Following example and accompanying drawing are to provide by way of illustration, and are not intended to be limiting the present invention.

Embodiment

Embodiment 1

Comprise the synthesis of the conjugate of the present invention of Sertraline and oligonucleotide

The synthesis of the Sertraline (4) of activation

The Sertraline scheme as described below of activation is prepared.

A.1. the synthesis of compound (1)

Sertraline hydrochloride (commercial, 34mg), 9H-fluorenylmethyloxycarbonyl-6-aminocaprolc acid a (Fmoc-ACA, 49mg), DMF (2ml), N-Methyl-morpholine (22l) and O-(BTA-1-base)-N, N, N ', N '-tetramethylurea Tetrafluoroboric acid (TBTU, Mixture 68mg) is stirred at room temperature overnight.By TLC (10%CH₃OH/CHCl₃) follow the tracks of reaction.Evaporating mixture obtains Thick oil, it washs with the Pet-ether of 3 × 5ml further.2ml water is joined in oily mixture, gained precipitate Again wash with the water of 2 × 10ml.With the dichloromethane (DCM) of 20ml precipitate dissolved and use 20ml NaCl solution to wash, Then Na is used₂SO₄It is dried.Solution evaporation, to being dried, is then dried to obtain solid (129mg crude product) in mechanical pump.Use silicagel column This crude product of chromatography purification, with 1% methanol/DCM, 2% methanol/DCM, then 5% methanol/DCM eluting.Merge fraction and evaporate To being dried.Product is vacuum dried 6 hours and produces 90mg pure compound (1).

A.2. the synthesis of compound (2)

Compound (1) (90mg) is dissolved 1 hour in the DCM containing 20% piperidines of 3ml.By TLC (10% methanol/ CHCl₃) follow the tracks of reaction.Evaporation reactant mixture is to obtaining oil, and it washs with 3 × 10ml Pet-ether.Gained crude Compound (54mg) sufficiently pure may be used for next step reaction and need not purification further.

A.3. the synthesis of compound (3)

Compound (2) (54mg), pyridine (3ml), succinic anhydride (16mg) and N's, N-dimethylamino naphthyridine (DMAP, 18mg) Mixture is stirred at room temperature overnight.Reaction is followed the tracks of by TLC (85: 10: 5=DCM: methanol: acetic acid).10ml water adds reaction In.Reactant mixture is condensed into jelly, then with the DCM suspendible of 10ml.Organic facies 2 × 10ml NaHCO₃Solution, The citric acid solution of 10ml 5% and the washing of 10ml saline.The solution sodium sulfate obtained is dried and evaporates and obtains white foam Compound (3) (46mg).

A.4. the synthesis of compound (4)

Compound (3) (46mg), hydroxyl butanimide (13mg), N, N '-DIC (DIC, 60l) and The mixture of DCM (4ml) is stirred at room temperature overnight, and follows the tracks of reaction with TLC (10% methanol/CHCl3).Solution evaporation is to dry Dry to obtain the crude solid of 150mg.Thick developing solvent is the 7% methanol/CHCl comprising 1% acetic acid₃System.Cut appropriate Band is also placed in filter funnel.With 15% methanol/CHCl₃After eluting, solution evaporation is to being dried to obtain the chemical combination of 35mg Thing (4) (HPLC purity is 98%).

The most amido modified oligonucleotide (5) and the synthesis of (6)

Synthesis is to carry out in automatic synthesizer, uses commercial amino linker 6-(4-mono methoxy triphenyl first respectively Amino) hexyl-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoramidite (amido modified dose of-CEP of 5 '-MMT-C6-) and 6- (trifluoroacetyl amido) hexyl-[(2-cyanoethyl)-(N, N-diisopropyl)]-phosphoramidite (amido modified dose of 5 '-TFA-C6-- CEP)。

Subsequent step is as follows:

1.-amino-linker-CEP is dissolved in anhydrous acetonitrile (in 1ml 100 μMs) in inert atmosphere (argon or nitrogen).Solution is put Enter in a clean extra groove (the position 5-9 of Expedite 8900 synthesizer or any other synthesizer standby Hole).Circuit is started, in order to conveying pipe is full of reagent by hands operation several seconds or use startup program.

2.-writes desired sequence；5 '-end have standby base positions (5-9), in order to by instrument synthesis last Step adds the reagent modified.

3.-verifies sequence, and it has the DMT option for synthesis program, because oligonucleotide needs HPLC purification.

4.-uses the matcher of proper size (0.2-1.0 μM) in instrument to start synthesis.

Post, at the end of synthesis, is separated and uses syringe ethanol (3 × 1mL) to rinse from instrument and prop up by 5.- Frame is to remove acid (from detritylation step) and the iodine (from oxidation step) of residual.

C. oligonucleotide deprotection removing from support

Carry out the following step:

Drying bracket from abovementioned steps is transferred in screw-cap vial (1.5-2mL) by 1.-.

2.-adds the NH of the concentration of 500 μ L (amount of 0.2 μM)₄OH (30%) solution.

3.-covers tightly medicated cap, and hangs at 55 DEG C and hatch 8h and (should give longer to obtain being rich in G-sequence to overnight Time).

4.-supernatant is cooled to 0 DEG C, and transfers to another micro tube.

5.-rinses support with same amount of d-water, and eluate joins in ammonia supernatant.Gained ammonia solution comprises entirely Long oligonucleotide, and non-nucleoside material is together with short sequence, described full length rna oligonucleotide is that 5 '-end has free amine group The oligonucleotide of hexyl (situation adding N-TFA-aminohexane base phosphoramidite), or it is own to have shielded amino The oligonucleotide that alkyl connects,

The purification of the oligonucleotide with free amine group hexyl joint can pass through anion exchange HPLC, ethanol precipitation Or polyacrylate hydrogel electrophoresis (PAGE) realizes.

D. activation Sertraline is incorporated on free primary amine

Connect with the 5 '-Amino End Group obtained in N-hydroxyl succinimidyl ester derivative markers step B obtained in step A and C The oligonucleotide of head, solution mutually in carry out according to the following step:

A.-labelling is incorporated to

1.-from the part or all of purification of abovementioned steps amino connect oligonucleotide (20-25ODU A260～ 700 μ g) it is dissolved in the 1.0M NaHCO of 250 μ L₃/Na₂CO₃In the mixture of (pH 9.0).The pH of verification gained solution is to guarantee It is alkaline.

2.-500 μ L joins 1.0MNaHCO from the solution (5-6mg) of the reactive derivative of stage A₃/Na₂CO₃Buffering In the mixture of the DMF of liquid pH=9.0: water (5: 2: 3v/v).

3.-mixture vortex, and Eppendorf tube aluminium foil encases to avoid the irradiation of light.

After 4.-incubated at room temperature 20h, mixture 1M TEAA solution cancellation.

The removing of B.-excess marker thing uses Shephadex G-25 post

The derivant sample of activation is moved on on pillar by 1.-.

2.-washes pillar with water, and collects Eppendorf tube with 1.0ml effluent.After void volume, it is desirable to product Product start to be eluted, and most of desired product is eluted in the effluent of 3-9 part and obtains.

3.-merges and concentrates the effluent comprising most of material.

4.-generally obtains 12-15ODU A260 (70%), and it does not has the dyestuff/labelling molecule of excess.If it is required, produce Product can be purified by the electrophoresis (20%PAGE) of RP HPLC further.

Embodiment 2

The synthesis of siRNA, described siRNA comprises and puts together the sense oligonucleotides of Sertraline and contained C18-L3-C18- The antisense oligonucleotide of the blocking group of L2-furanose-L1-[oligonucleotide]-3 ', wherein L1, L2 and L3 are that di-phosphate ester connects Connect

The following step is used to carry out this reaction:

A () RNA oligonucleotide is to be gradually formed, wherein in growing chain by solid phase synthesis on a solid support 5 '-OH groups of end subunit, it is protected by dimethoxytrityl (DMT) under normal circumstances, places it in acid Under the conditions of property, in order to remove 5 '-OHDMT blocking groups, and purine and pyrimidine bases are still by (fluorenes-9-base) methoxycarbonyl group (FMOC) protection.

(b) furanose unit, such as D-ribose or D-(-)-fructofuranose and 4,4 '-dimethoxytrityl chlorine (DMTr-CI) only react under conditions of reaction on beneficially primary hydroxyl group radical position.Then, residual hydroxyl group and acetyl Change or the reaction of henzylate blocking group.Finally, in acid condition, the DMT blocking group of primary hydroxyl group is removed.The institute of furanose State deprotection oh group and step (a) and obtain the deprotection 5 '-OH radical reaction of siRNA chain, thus obtain primary-put together few core Thuja acid.

C () has the Polyethylene Glycol (PEG) of 6 monomers and provides the spacer (C18 spacer) of 18 covalent bond unit Reactive polyethylene glycol be formed by phosphitylation condition phosphoramidate compounds, (the 2-cyanoethyl) of such as formula (II) Join what terminal OH groups was carried out under N, N '-diisopropylphosphoramidite.

D the deprotection 5 '-OH group of () furanose reacts with the reactive polyethylene glycol of step (c), thus obtain following knot The siRNA chain of structure:

OH-C18-L2-furanose-L1-[oligonucleotide]-3 '

Wherein L1 and L2 is phosphodiester bond.

E () has the Polyethylene Glycol (PEG) of 6 monomers and provides the spacer (C18 spacer) of 18 covalent bond unit Second reactive polyethylene glycol be formed by phosphitylation condition phosphoramidate compounds, such as (the 2-cyanogen of formula (II) Ethyl) join terminal OH groups under N, N '-diisopropylphosphoramidite and carry out.

F the deprotection 5 '-OH group of () C18 reacts with the second activity C18 Polyethylene Glycol from step (e), thus obtain The siRNA chain of following structure:

C18-L3-C18-L2-furanose-L1-[oligonucleotide]-3 '

Wherein L1, L2 and L3 are phosphodiester bonds.

The siRNA chain of g modification that () puts together the complementary strand step f) of the siRNA of Sertraline as described in Example 1 moves back Fire.For this purpose, all of residue blocking group in RNA chain removes the most in advance.500 μ l comprise 20%v/v's Methylamine (aqueous solution 40%w/v) and the saturated ammonia solution of 80%v/v, 30 (comprise the NH of 30-32%v/v₃) mixture add In the Eppendorf tube containing siRNA (200nmole scale).By the seal of tube and heat 45 minutes be 65 DEG C to temperature.This step Remove (the 2-cyanoethyl that the acetylation of furanose or henzylate and di-phosphate ester connect of the blocking group on the phosphorus atoms of nucleotide Change), and the blocking group (FMOC) of exocyclic amino group.Then, by combination cooling and filter, and supernatant is dried.Residual Pellet 1M triethylamine-HF reacts the blocking group (2 '-uncle on remove nucleotide 2 ' under 65 degrees Celsius 3 hours Butyldimethylsilyl-TBDMS).Finally, produced solution desalination in sephadex column (Sephadex post).

Embodiment 3

It is conjugated to group and the 5-HT of a targeting agent of formula (I) _1A R-targeting siRNA (hereinafter referred to as NLF-siRNA) And naked 5-HT _1A The efficiency analysis of R-targeting siRNA (the most naked siRNA), is locally implanted mice by internal Dorsal raphe nucleus (DRN)

The present embodiment display NLF-siRNA and naked siRNA is to lowering presynaptic 5-HT_1AR shows similar effect, according to Its protein level declines and its function is measured, when the dorsal raphe nucleus being applied topically to serotoninergic neuron place Time.This demonstrate the group of the formula (I) in the structure of the present invention and targeting agent does not disturb effect of oligonucleotide.

The compound of one group of structure with embodiment 1 and 2 is synthesized as mentioned above and has following structure.

SiRNAs is designed to the targeting 5-hydroxy tryptamine from house mouse (mice, GenBank accession number: NM_008308) Receptor 5-HT type 1A (5-HT_1AR) the following region of sequence: 633-651,852-870,1889-1907 and 2167-2185.Each The antisense strand of siRNA and positive-sense strand are chemosynthesis (SEQ ID NO:5-10, tables 1), and at isotonic RNA annealing buffer Annealing in (100mM potassium acetate, 30mM HEPES-KOH pH:7.4,2mM magnesium acetate), by combining 50 μMs of solution of each chain. Then, this solution is cultivated 1 minute at 90 DEG C, centrifugal 15 seconds, and then cultivates 1 hour at 37 DEG C.The annealing of HPLC purification is molten Liquid, and lyophilizing is chosen for siRNA fragment.The stock solution of siRNA is made by again suspending freeze-drying prods in without the water of RNase Standby obtain, and until using at being saved in-20 DEG C.Before use, all siRNA stock solutions are at aCSF (125mM NaCl, 2.5mM KCl、1.26mM CaCl₂、1.18mM MgCl₂With 5% glucose) and suitable carrier in be diluted to ultimate density, for brain Portion's application (local and intracerebral ventricle injection are applied).

Table 2

All these siRNA sequences include and 5-HT_1AThe antisense sequences that the mRNA of receptor is complementary, it is thus possible to capture is described MRNA also blocks its expression.All tests all use the equimolar mixture of these sequences.

As comparison, inject nonsense siRNA sequence (ns siRNA).When turning with the complete of mice in Blast alignment algorithm During the contrast of record group, this ns siRNA is not complementary with any murine genes.Ns siRNA has a following sequence:

Ns siRNA-s AGUACUGCUUACGAUACGG SEQ ID NO:56

Ns siRNA-a CCGUAUCGUAAGCAGUACU SEQ ID NO:57

All sequences all has the end DNA dimer of nucleotide, comprises at least one unshowned thymus pyrimidine (T), In order to avoid the mRNA of interference regulation and control normal procedure enters the albumen of cell.This technology is to well known to a person skilled in the art.Right In these end dimers, oligonucleotide has 21-23 base pair, facilitates effective RNAi mechanism.

The siRNA sequence of table 1, is conjugated to formula (I) group and targeting agent as above (NLF-siRNA), sews It is bonded to the group of formula (I) and the nonsense siRNA (ns NLF-siRNA) of a targeting agent and the naked oligonucleotide do not modified (the naked siRNA of naked siRNA or ns of table 1) is used in experiment.

For the injection of siRNA, use standard stereo orientation method implantable miniature intubation system as described in the prior art. Flow into microcannula to be inserted by No. 25 pipes of fused silica capillary tube of 110 μm OD and 40 μm ID.Microcannula pre- If length is the degree of depth based on the brain district being targeted (that is, be 1mm for dorsal raphe nucleus) and determines.

Male C 57 BL/6 J mouse (21-29g, 9-12 week big, male) is implanted one at dorsal raphe nucleus (DRN) and miniature is inserted Pipe.Stereotaxis coordinate (in terms of mm) is AP:-4.5, L:-1.0, the DV:-4.4 at the bregma from skull and top, has outside 20 ° Side angle (according to Franklin and Paxinos (1997)).This microcannula is safe to skull, have dental cement and 2mm length, the screw of 0.95mm diameter.Micro-injection experiments is to carry out for 20-24 hour after conscious mouse surgery.Inject micro- Type is intubated and is connected with syringe by polyethylene tube, and syringe is operated by the precision pump of the 0.5 μ speed of L/ minute.

In order to test presynaptic 5-HT_1AThe functional measurement of R activity, a collection of naked siRNA or NLF-siRNA is being injected by we To dorsal raphe nucleus (DRN, 0.3 μ g (0.02nmoles)/1 μ l/2 days) post-evaluation in 24 hours by (R)-(+)-8-hydroxyl-2- (two-n-Propylaminos) naphthane hydrobromate (8-OH-DPAT, a kind of selectivity 5-HT_1AR agonist) hypothermia induced rings Should.Matched group accepts same amount of carrier (aCSF:125mM NaCl, 2.5mM KCl, 1.26mM CaCl₂、1.18mM MgCl₂ With 5% glucose), ns naked si RNA and ns NLF-siRNA.Testing first 1 hour, mice is in the experiment of the equilibrium temperature of 22 DEG C Single cage in room is raised.All experiments are at 10:00 and carrying out between 14:00 afternoon in the morning.By before reading temperature 5 Minute the probe of lubrication is inserted rectum and measure body temperature, and mice is loose-jointed.Reading is obtained with digital thermometer. Basic value records for 5 minutes and 15,30,60 and 120 minutes afterwards before giving 8-OH-DPAT.8-OH-DPAT is dissolved in In saline solution, and with 1mg/kg lumbar injection (i.p.) in 5mg/kg volume.8-OH-DPAT induced low temperature selected dosage It is based on former work.Body temperature is at 5-HT_1A-targeting siRNA finally applies to the mice of difference group and each of which The DRN of comparison was evaluated after 24 hours.It is at 5-HT that per rectum measures the additional experiments of body temperature_1AR KO mice is (without 5- HT_1AR mice) in carry out assessing the lacking of low temperature of 8-OH-DPAT-induction.

As in Fig. 1 it can be seen that, siRNA is locally implanted the 5-HT caused_1AThe downward of R shows and lacks by 8-OH- The hypothermia response of DPAT induction, is similar to 5-HT_1AR KO mice.

After this is analyzed, by decapitation by sacrifice, and brain quickly removes, freezing and be stored on dry ice- At 20 DEG C.Tissue slice, 14 μ m-thick, cut with freezing microtome, at the load glass scribbling APTS (3-aminopropyl three ethoxy silane) Melting on sheet to mount also preserves at-20 DEG C until using.

In order to analyze 5-HT_1AThe density of R albumen, we use [³H] 8-OH-DPAT is for 5-HT_1AThe radiation of acceptor site Autography visualizes.For [³H] the experiment condition of culture of 8-OH-DPAT is described the most in the prior art.In brief, cold The tissue slice frozen thaws and is dried, at 170mMTris-HCl pH 7.6,4mM CaCl under room temperature₂With 0.01% ascorbic acid Middle preculture 30 minutes, then under room temperature include 1nM [³H]-OH-DPAT (234.0Ci/mmol) and 10^-5The phase of M pargyline Same buffer is cultivated 60 minutes.Non-specific binding is defined below: 10^-5Retain in the presence of M 5-HT.Cultivate and washing Afterwards, tissue slice is immersed in the frozen water of distillation, and rapid draing under cold airflow.Tissue and plastic cement³H-standard substance one Rise at 4 DEG C, be exposed to tritium susceptible film upper 60 day.

In mice Midbrain Raphe from bregma 3 different antero posterior axis (AP) coordinate systems (about AP-4.84 ,-4.60 and- Tissue DRN section (Franklin and the western Northey of Parker, 1997) in 4.24mm) is used for the quantitative of acceptor site, and They are to process under identical experiment condition simultaneously.The quantitative analysis AIS of autoradiograph^RComputerization image divides Analysis system is carried out.

The most as seen, 5-HT in naked siRNA and NLF-siRNA group_1AR protein density has and about compares The decline of group (carrier, ns naked siRNA and ns NLF-siRNA) 40-50%,.This change is and the hypothermia described in Fig. 1 The suppression of response is parallel.

These experiments show that on two chains, the chemical modification of NLF-siRNA does not reduce the ability of siRNA downward target gene, When comparing with naked siRNA.Additionally, 5-HT_1AReceptor-specific siRNA is applied topically to DRN by injection and causes target The downward of mRNA, no matter whether siRNA is exposed or matches with targeting moiety.This can be not construed as because applying The medication applied by physical pressure in journey causes siRNA to be directly transferred to neuron corpusculum, and therefore, there is no need to through The transfer of neuronal cell film.

In the examples below, display is applied naked 5-HT by intracerebral ventricle injection (i.c.v) or intranasal_1AReceptor Specific siRNA all can not lower target mRNA, and the existence being attached to the targeted molecular of siRNA allows having of target mRNA Effect is lowered.

Embodiment 4

Difference selectivity and the NLF-siRNA construct of the present invention to the serotoninergic neuron of Midbrain Raphe Efficiency analysis to naked siRNA, injects the dorsal part 3 of mice by internal intracerebral ventricle injection (i.c.v) ^rd The ventricles of the brain (D3V)

The present embodiment shows: NLF-siRNA construct and naked siRNA show that the difference to serotoninergic neuron selects Property and lower 5-HT_1AThe effectiveness of R, when they are applied to dorsal part 3^rdThe ventricles of the brain (D3V) are to enter through cerebrospinal fluid (CSF) During full brain.This is of science by measuring its mrna expression level decline, protein level minimizing, functional change and antidepressants Potentiation is evaluated.

One group of molecule (carrier, ns naked siRNA, ns NLF-siRNA, naked siRNA and NLF-as described in example 3 above SiRNA group) by 30 μ g/2.5 μ l/1 days (2.3 nanomole) be injected into following stereotactic coordinates (in terms of mm: AP:-2.0, L:0, DV:-2.1) dorsal part 3 under^rdThe ventricles of the brain (D3V), use similar mouse species and the injecting systems of embodiment 2.In order to measure 5- HT_1AR mrna expression level, we use 4 oligodeoxynucleotide probes to 5-HT simultaneously_1AR has carried out in situ hybridization and has divided Analysis, with base 82-122,123-171,885-933 and 1341-1389 complementation.Use terminal deoxynucleotidyl transferase, will be every Individual 5-HT_1AReporter oligonucleotides use [³³P]-dATP (＞ 2500Ci/mmol) it 3 '-hold labelling (2pmol) independently, make Remove test kit (QIAquickNucleotide Removal Kit) with the quick nucleotide of QIA and carry out purification by centrifuging.Right The scheme of single marking in situ hybridization is based on preceding method.In brief, frozen tissue section as described in Example 2 is first Post-equalization is to room temperature, at phosphate buffer (1 × PBS:8mM Na at 4 DEG C₂HPO₄、1.4mM KH₂PO₄、136mM NaCl、 2.6mM KCl) 4% paraformaldehyde in fix 20 minutes, under room temperature in 3 × PBS wash 5 minutes, in each comfortable 1 × PBS Wash 2 times each 5 minutes, and ultimate density 24U/ml in 50mMTris-HCl pH 7.5,5mM EDTA pre-at 21 DEG C Digestion pronase solution is cultivated 2 minutes.Enzymatic activity is made to stop by 2mg/ml glycine in 1 × PBS impregnates 30s Only.Tissue is last to be cleaned in 1 × PBS, and by the ethanol dehydration of gradient series.About hybridization, radiolabeled probe exists In solution dilute, described solution comprise 50% Methanamide, 4 × SSC (1 × SSC:150mM NaCl, 15mM sodium citrate), 1 × Denhardt ' s solution (0.02% sugarcane polysaccharide, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin), 10% sulphuric acid Glucosan, 1% sarcosyl, 20mM phosphate buffer pH 7.0,250 μ g/ml yeast tRNA and 500 μ g/ml salmon sperm dnas. Radioactive probe ultimate density in hybridization buffer is in identical scope (1.5nM).Tissue slice is visited by comprising labelling The hybridization solution of pin covers, and covers Nescofilm coverslip, and at 42 DEG C in moist box overnight incubation.Then, cut Sheet washs 4 times (each 15 minutes) at 60 DEG C in 1 × SSC, and at room temperature washs 1 time 30 minutes in 1 × SSC, de- Water is also exposed to film 3-4 week.Film optical density (OD) AIS^RComputer digital image analysis carries out semidefinite quantization.

About for the mice of identical group of in situ hybridization, we use [³H] 8-OH-DPAT is to as described in Example 2 5-HT_1AThe autoradiography of acceptor site analyzes 5-HT_1AThe density of R albumen.

5-HT_1AR albumen is expressed at 5-hydroxy tryptamine neuron (Midbrain Raphe) upper presynaptic height, and dashes forward at neuron Position after touch to 5-HT teleneuron, mainly at cortex-marginal area (that is, hippocampus).

As seen in Fig. 3 A and B, only NLF-siRNA molecule is the most the same 3 of mice Midbrain Raphe Rear coordinate system is induced 5-HT_1AThe specific downregulation of R mRNA level in-site, wherein the corpusculum of serotoninergic neuron is positioned at mice Midbrain Raphe.

As being seen in fig. 3 c, the 5-HT on film in dorsal raphe nucleus_1AIt is close that R mRNA positive particle is measured Degree quantitatively shows that the expression of NLF-siRNA group has the decline of 50%, compared with other test groups.5-HT_1AR mRNA The difference major embodiment expressed is in DRN region.

The most as may be seen from fig. 4, only NLF-siRNA molecule is in presynaptic (dorsal raphe nucleus) rather than postsynaptic Induction of 5-HT in the brain region of (hippocampus or prefrontal cortex)_1AThe decline (about 50%) of R protein level, by using [³H] 8-OH-DPAT is at 5-HT_1ACombination on acceptor site measures.5-HT_1AThe difference master of R mRNA and protein expression DRN region to be embodied in.

These results show that NLF-siRNA selectivity orientation oligonucleotide performs mRNA and is pointed to the spy of dorsal raphe nucleus The interference of opposite sex serotoninergic neuron, thus strengthen the described RNA effectiveness to the interference of targeted neuronal receptor.

In order to check 5-HT_1AWhether the specific downregulation of receptor can affect relevant 5-HT albumen as 5-hydroxy tryptamine transhipment Body (5-HTT or SERT) or 5-HT_1BThe expression of receptor, determines density and the 5-of 5-hydroxy tryptamine transporter albumen in DRN The density of HT1B receptor.

In order to analyze5-hydroxy tryptamine transporterThe density of albumen, we will [³H] citalopram is for the putting of 5-HTT site Penetrate autography.Briefly, frozen tissue section thaws and is dried, and is comprising 120mM NaCl's and 5mM KCl under room temperature Preculture 15mm in 50mM Tris-HCl buffer (pH 7.4 at 25 DEG C).Then, under room temperature comprise 1.5nM [³H] western phthalein The same buffer of Pulan (70.0Ci/mmol) is cultivated 60 minutes.Non-specific binding is defined as: exist at 1 μM of fluoxetine Lower reservation.Cultivating and after washing, tissue slice is immersed in distillation frozen water, and is dried rapidly under cold airflow.Tissue with Plastic cement³H-standard substance expose 40 days together at 4 DEG C in tritium light-sensitive surface.

In 3 different antero posterior axis (AP) coordinate systems of mice Midbrain Raphe (from anterior fontanelle about AP-4.84/-4.96 ,- 4.60/-4.36 and-4.24mm；Franklin and the western Northey of Parker, 1997) tissue DRN section () for 5-HTT site Quantitative, and they process under identical experiment condition simultaneously.Use AIS^RComputer digital image analysis carries out radiation certainly The quantitative analysis of development figure.As being seen in fig. 5, carrier, naked siRNA and NLF-siRNA group do not demonstrate dorsal suture The 5-HTT (5-hydroxy tryptamine transporter, SERT) any minimizing on protein level or change in nucleus.

In order to analyze5-HT _1B Receptor (5-HT _1BR) density of albumen, we will [¹²⁵I] iodine cyanogen pindolol is for 5- HT_1BThe autoradiography in R site.Section is at room temperature comprising the 170mM Tris-HCl buffer (pH of 150mM NaCl 7.4) preculture 10 minutes in, then supplement 100pM [¹²⁵I] iodine cyanogen pindolol ([¹²⁵I] CYP, 2000Ci/mmo) and The same buffer of 100nM 8-OH-DPAT is cultivated 2 hours to block 5-HT_1AR site, and 30-isoproterenol with Block beta-adrenaline site.Non-specific binding measures on contiguous slices, and described contiguous slices is at identical conditions But exist and cultivate under 10 μMs of 5-HT.Section is cleaned twice in identical buffer, is soaked in rapidly in distilled water at 4 DEG C, Under cold air be dried and at 4 DEG C light-sensitive surface (supermembrane-³H(Hyperfilm-³H) exposure one day in).Film optical density AIS^R Computer digital image analysis carrys out semidefinite and quantifies.As being seen in figure 5b, carrier, naked siRNA and NLF-siRNA group are not Demonstrate 5-HT in dorsal raphe nucleus_1BThe receptor any minimizing on protein level or change.

In order to evaluate NLF-siRNA to 5-HT_1AThe effect of the functional character of R, we analyze and are induced by 8-OH-DPAT 5-HT release in hypothermia response and middle prefrontal cortex (mPFC).We by a collection of naked siRNA or NLF-siRNA (as Described in embodiment 2) it is injected into dorsal part 3^rdThe ventricles of the brain (D3V, 30 μ g/2.5 μ l/1 days) post-evaluation in 24 hours is induced by 8-OH-DPAT Hypothermia response.As being seen in figure 6, only by injecting the 5-HT that NLF-siRNA causes_1AR lowers and shows Lack the hypothermia response of 8-OH-DPAT induction, similar 5-HT_1AR KO mice.(carrier, ns are naked for other naked siRNA and comparison SiRNA and ns NLF-siRNA) group do not demonstrate 5-HT_1AThe downward effect (as shown in Figures 4 and 5) of R, and it be with The typical curve of the hypothermia response induced by 8-OH-DPAT is parallel.

As it has been described above, be positioned at the 5-HT of serotoninergic neuron_1AThe activation of R, by endogenous agonist 5-HT (god Through mediator 5-hydroxy tryptamine) or selective agonist (that is, 8-OH-DPAT) suppression Midbrain Raphe and middle prefrontal cortex, hippocampus Deng end projection brain region in cell discharge and pulse-dependences 5-HT discharge, cause relatively low 5-HT level (8-OH- DPAT effect).In order to evaluate 5-HT release, use the brain microdialysis program having been described in prior art.Briefly, visit The axle of pin is made up of 15-mm length, 25-bore (501 μm OD, 300 μm ID) stainless steel tube.Inlet pipe and go out pipe by by 110 μm OD and 25 bore pipes of 40 μm ID fusion silica capillary composition.The upper exposed junction of silica tube is inserted into 7-mm length, 27 bores In the stainless steel tube of (410 μm OD, 220 μm ID).Mice pentobarbital sodium (40mg/kg, lumbar injection) is anaesthetized and is placed On stereotaxic frame.Every mice middle prefrontal cortex (mPFC) (in terms of mm, from AP+2.2, L-0.2, DV-3.4 of bregma, According to the internal anatomy of Franklin and Paxinos, 1997) implant a dialysis probe equipped with cuprophan membrane (2-mm length, 5000Da molecular weight cut-off value).

Microdialysis Experiments is within 48-72 hour, to pass through with connecting overhead liquid in rotation in loose-jointed mice after surgery The WPI model sp220i syringe pump of body with the 2.0 μ speed of l/ minute continuously to probe conveying aCSF (125mM NaCl, 2.5mM KCl、1.26mM CaCl₂、1.18mM MgCl₂) carry out.Every 30 minutes collect 60 μ l dialysis samples in trace from In heart pipe.

After 60-minute initial stable phase, 4 baseline sample at 8-OH-DPAT Formulations for systemic administration, (note by 0.5mg/kg abdominal cavity Penetrate) collect before, then collect continuous print dialysis sample.Dialysis experiment is when completing, and kills mice, and brain extract immediately also- Freezing at 70 DEG C.Then, cryostat cuts the coronalplane (50 μm) of brain, and, according to standard method cresol-purple Dyeing is for irrigating the location at position.The data only obtained from the animal that histologically correct probe is placed be used for After statistical analysis.

In dialysis sample, concentration HPLC of 5-HT measures, and wherein HPLC uses 3-μm octadecylsilica (ODS) post (7.5cm × 0.46cm), enters by Hewlett-Packard (Hewlett-Packard) the 1049 detector group of oxidizing potential 0.6V Row current detecting.Flowing is by 0.15M NaH₂PO₄.H₂(pH 2.8, uses phosphoric acid for O, 1.8mM sodium octyl sulfate, 0.2mM EDTA Adjust) and 30% methanol composition, and pumped into 0.7ml/ minute.The retention time of 5-HT is 3.5-4 minute, and detection limit is 2fmol/ sample.

As being seen in the figure 7, compared with ns NLF-siRNA group mice, in NLF-siRNA processes mice group There is not the impact that prefrontal 5-hydroxy tryptamine is discharged by 8-OH-DPAT.This is 5-HT in serotoninergic neuron_1AR Downward evidence can by agonist 8-OH-DPAT in tip brain region 5-HT measure impact minimizing come functional Ground is evaluated.

Embodiment 5

Free selective ligands (Sertraline) and the competitive assay of the NLF-siRNA construct according to the present invention, pass through Measure the 5-hydroxy tryptamine energy in the mice with the acute pretreatment of part the most internal intracerebral ventricle injection (i.c.v.) NLF-siRNA The functional parameter of neuron

Whether it is to dorsal raphe nucleus cell to measure the selective ligands being conjugated to siRNA in NLF-siRNAs Key component in the delivery of (mainly serotoninergic neuron), has carried out some competitive tests.At D3V (30 μ g/ 2.5 μ l/1 day, intracerebral ventricle injection) in inject siRNA first 3 hours, mice accepts acute injection selectivity free ligand, 5- HTT inhibitor Sertraline (20mg/kg lumbar injection).Additionally, one group of mice received vehicle lumbar injection and carrier inject D3V In.

Microdialysis Experiments is carried out after intracerebral ventricle injection carrier or siRNA are administered 24 hours.As seeing in fig. 8 a, Acute Sertraline injection (20mg/kg lumbar injection) is by being conjugated to 5-HT_1AR-NLF-siRNA avoids 5-HT_1AAutologous recipient Silence, and acute 8-OHDPAT administration (selectivity 5-HT_1AR agonist, 0.5mg/kg lumbar injection) decrease skin before middle volume 5-HT level in matter, such as matched group.

With selectivity 5-HTT inhibitor, in the NLF-siRNA mice of Sertraline (20mg/kg lumbar injection) pretreatment, Also it is similar on those used by the impact of body temperature and Fig. 8 A that the 8-OH-DPAT that have rated in mice is administered (1mg/kg i.p.). Fig. 8 B show Sertraline effectively with 5-HT_1AR-NLF-siRNAs competes, and the hypothermia thus resulting in similar matched group rings Should, indicate shortage and the 5-HT of transfection_1AThe downward of R mRNA.

These results demonstrate the acute administration of free selective ligands (Sertraline) and block or compete what Sertraline was puted together SiRNA (NLF-siRNA), by the identical inlet point of target neuron (that is, 5-HTT, 5-hydroxy tryptamine transporter).First, house Qu Lin has high specificity and affinity (in nanomolar range), to 5-HT transporter, and as in NLF-siRNA infix Being bonded to siRNA, new conjugate keeps the affinity to this 5-HT transporter.On the other hand, 5-HT transporter is only 5-HT god Express in unit, and by the combination of the high-affinity of transporter with cellular type is specific expressed determines NLF-siRNA's Selectivity essence, it has Sertraline or SSRI part is puted together.

Embodiment 6

Comparing with matched group, intracerebral ventricle injection (i.c.v.) NLF-siRNA is to dorsal part 3 in vivo ^rd The ventricles of the brain (D3V) mice In, after acute antidepressant (that is, fluoxetine) application, the potentiation of the increment of the 5-HT level in prefrontal cortex

In physiological conditions, SSRI (that is, fluoxetine) causes the extracellular of the 5-hydroxy tryptamine in Midbrain Raphe and forebrain Dramatically increasing of concentration.The increase being blocked the extracellular 5-HT caused by the reuptake of 5-hydroxy tryptamine transporter (SERT) have activated 5-HT in Midbrain Raphe_1AAutologous recipient, suppression cell discharge and tip release, a kind of weakening is blocked generation by reuptake The effect that extracellular 5-HT increases.Thus, undertake the activation of postsynaptic 5-hydroxytryptamine receptor of therapeutical effect less than intended.According to Understand, use 5-HT_1ABlocking of these negative feedback mechanisms of receptor antagonist (that is, i.e pindolol) increases the 5-that SSRI causes HT, and therefore it is likely to be suited for promoting the clinical effectiveness of SSRI.

As can be seen in Figure 9, systemic applications fluorine in nonsense NLF-siRNA (ns NLF-siRNA) mice group In after Xi Ting, the dialysis solution 5-hydroxy tryptamine concentration in prefrontal cortex is higher by about 50% than baseline, wherein 5-HT_1AReceptor expection becomes As previously shown Full Featured.At NLF-siRNA mice group, presynaptic 5-HT_1AThe downward of receptor makes systemic applications fluorine The effect of Xi Ting reaches 150% of the baseline tip 5-HT level in middle prefrontal cortex.

These results clearly demonstrate that the oligonucleotide sequence (NLF-siRNA) of the present invention, is combined with Sertraline molecule, 5-HT is blocked by lowering mRNA transcript to be translated_1AThe expression of receptor.The oligonucleotide sequence of the present invention (NLF-siRNA) in leading indicator, described expression is lowered than the correspondingly siRNA in naked form (naked siRNA).Therefore, originally The oligonucleotide of invention is more more efficient than the siRNA of the identical sequence of equivalent, and it does not carries out modifying (naked siRNA).

These observations allow to reason out: the group of formula (I) does not disturb the downward of expression of receptor.Additionally, extra conjugated molecules Existence enhance the effectiveness of the inhibitory action performed by RNAi mechanism.

Embodiment 7

At response internal intracerebral ventricle injection (i.c.v.) NLF-siRNA and comparison 5-HT _1A R knocks out in (KO) mice, resists and presses down Strongly fragrant and anxiety behavioral study

In order to analyze presynaptic 5-HT_1AThe potential antidepressant effect of the downward of receptor, in the adult mice that 9 to 12 weeks are big Carry out behavior analysis.They are carried out in the following order, and test between at least one day: Elevated plus-maze and outstanding tail test.High Frame plus maze is to use in darkroom (50 lux) frame in the plus maze of the wide arm of the 30cm length of overhead 31cm and 5cm Carry out.Animal is brought to the central area in labyrinth, in the face of open arms, and allows freely to reconnoitre 5 minutes.Use video frequency following system Measure the cost time on open and closed arm and action distance.Instrument is with 70% ethanol and allows between mice dry Dry.All tests are at 11:00 and carrying out between 4:00 afternoon in the morning.In test day, it is real that animal is transported to faint illumination behavior Test room and keep at least 1 hour without disturbance before testing.In outstanding tail is tested, the afterbody of mice is hung, and we use Belt has been tied up to guarantee that they are in level.Animal suspended 6 minutes, and use automatic video frequency to follow the tracks of software kit to assess this phase Between static.

The most as seen in Fig. 10, do not observe the change of anxiety-like behavior, but at 5-HT_1AUnder autoreceptor Turn down in Mus stress/depressed correlation test in the reaction that changes.The potential antidepressant ability of NLF-siRNA is positioned KO Between mice and wild type control mice.This has pointed out 5-HT_1AReceptor can become the new target drone of depressed treatment.Have about 40% Depressed patient to traditional SSRI treatment not reaction, and they can become the preferential of the new therapeutic scheme of this disease Candidate.

Embodiment 8

In the measurement of functional 5-hydroxy tryptamine energy, 5-HT _1A R NLF-siRNA causes downward relative to nonsense NLF-siRNA Difference effectiveness, by intranasal (i.n) internal in mice apply

In order to verify that intranasal is applied as a kind of potential therapeutic administratp mode, analyze carrier and NLF-siRNA with inspection The mRNA level in-site in temperature drop low-response, dorsal raphe nucleus of having a medical check-up and the 5-HT dialysis solution in prefrontal cortex.

Mice pentobarbital 40mg/kg intraperitoneal injection of anesthesia, and facing away from lower placement.Add with the trace of point meters such as 5-ul PBS or NLF-siRNA slowly and is instilled nostril alternately by sample device suction nozzle lightly.

The most as seen in Figure 11, the intranasal application of NLF-siRNA or carrier causes mRNA 5-HT_1ASubtracting of receptor Few, as measured by by situ hybridization, and 5-HT_1AThe minimizing of receptor, as measured by by ligand binding assays, Its result observed after applying with intracerebral ventricle injection is similar.Specifically, the presynaptic lowers is 30% (when with NLF-siRNA brain When 50% downward during indoor administration is compared) (seeing Figure 11).Additionally, the intranasal application of NLF-siRNA causes being administered 8-OH- 5-HT prefrontal cortex after the decline (seeing Figure 12 A) of the hypothermia response after DPAT and acute application 8-OH-DPAT is saturating The decline (Figure 12 B) that analysis liquid level reduces.

Additionally, 5-HT_1AThe potential antidepressant effect of R-NLF-siRNA uses the most outstanding tail test Evaluate.Further, anxiety-like behavior is evaluated by Elevated plus-maze.As being seen in fig. 13, experiment shows sight Observe anxiety-like behavior not change (Figure 13 A), but stress/depressed correlation test in 5-HT_1ATurn down under autoreceptor The quiescent time (Figure 13 B) eliciting decline in Mus and the quiescent time (Figure 13 C) declined in forced swimming is tested.

Embodiment 9

The siRNA of the 5-HTT-targeting of formula (I) group and a targeting agent it is conjugated to the dosage of 10 or 30 μ g/ mices The efficiency analysis of (5-hydroxy tryptamine transhipment siRNA) (hereinafter referred to as 5-HTT-NLF-siRNA), carrier as a control group, passes through Intranasal administration in Mice Body

The compound of one group of structure with embodiment 1 and 2 synthesizes as above.SiRNA be designed to targeting from The region below of 5-hydroxy tryptamine transporter (5-HTT) sequence of house mouse (mice, GenBank accession number: NM_010484): 1230-1250.The antisense of siRNA and positive-sense strand are chemosynthesis (SEQ ID NO1-2, tables 2), and slow in isotonic RNA annealing Rush annealing in liquid (100mM potassium acetate, 30mMHEPES-KOH pH:7.4,2mM magnesium acetate), molten by combining 50 μMs of each chain Liquid.Then, solution is cultivated 1 minute at 90 DEG C, centrifugal 15 seconds, and then cultivates 1 hour at 37 DEG C.Annealing solution is HPLC Purification, and the selected portion lyophilizing of siRNA.The stock solution of siRNA is by freeze-drying prods system resuspended in without the water of RNase Standby obtain, and until using at being saved in-20 DEG C.Before use, all siRNA stock solutions are at PBS and suitable carrier In be diluted to ultimate density, for intranasal apply.

SiRNA sequence includes the antisense sequences that the mRNA with 5-HT transporter (5-HTT) is complementary, therefore, it is possible to capture is described MRNA also blocks its expression.

All these sequences have the end DNA dimer of nucleotide, comprise at least one unshowned thymus pyrimidine (T), the albumen of cell is entered in order to avoid the mRNA of interference regulation and control normal procedure.This technology is as well known to those skilled in the art 's.For these end dimers, oligonucleotide has 21-23 base pair, facilitates effective RNAi mechanism.

The siRNA sequence of table 2, is conjugated to the group of formula (I) and a targeting agent (5-HTT-NLF-as above SiRNA) it is used in this experiment.

Embodiment 10

The difference effectiveness lowered, applies the 5-of 2 dosage (10 and 30 μ g/ mice) by intranasal in Mice Body (i.n) The functional assays analysis of HTT-NLF-siRNA

Male C 57 BL/6 J mouse (21-29g, 9-to 12-week is big, male) is numb with pentobarbital 40mg/kg lumbar injection Liquor-saturated, and facing away from lower placement.With the micropipette tip of point meters such as 5-ul by slow for PBS or 5-HTT-NLF-siRNA and light Lightly instill in nostril alternately.The evaluation dosage of 5-HTT-NLF-siRNA is: 5 μ g/5ul and 15 μ g/5ul in each nostril (accumulated dose of NLF-siRNA: every day 10 and 30ug/ mice).

Processing latter 24 hours, mice sacrificed by decapitation, brain is extractd rapidly, freezing and at being saved in-20 DEG C in dry ice.Group Knit section, 14 μ m-thick, cut by microtome, melt on the microscope slide scribbling APTS (3-aminopropyl three ethoxy silane) Mount and also preserve at-20 DEG C until using.

In order to measure 5-HTT mrna expression level, situ Analysis uses the oligodeoxynucleotide special to 5-HTT Probe is carried out, complementary with base 820-863 (mice, GenBank accession number: NM_010484).5-HTT oligonucleotide is each Use terminal deoxynucleotidyl transferase it 3 '-end with [³³P]-dATP (＞ 2500Ci/mmol) is marked, by making Test kit centrifugal purification is removed with the quick nucleotide of QIA.Scheme to single marking in situ hybridization is based on preceding method.Simply Ground say that frozen tissue section as described in Example 2, first recovers to room temperature, at 4 DEG C phosphate buffer (1 × PBS:8mM Na₂HPO₄、1.4mM KH₂PO₄, 136mM NaCl, 2.6mM KCl) 4% paraformaldehyde in fix 20 minutes, room Wash 5 minutes in 3 × PBS under temperature, each comfortable 1 × PBS washs 2 times each 5 minutes, and at 50mM Tris-at 21 DEG C The predigestion pronase solution of ultimate density 24U/ml in HCl pH7.5,5mM EDTA is cultivated 2 minutes.By 1 × PBS impregnates 30s in 2mg/ml glycine and makes enzymatic activity stop.Tissue is last to be cleaned in 1 × PBS, and by gradient system The ethanol dehydration of row.About hybridization, radiolabeled probe dilutes in the solution, described solution comprise 50% Methanamide, 4 × SSC (1 × SSC:150mM NaCl, 15mM sodium citrate), 1 × Denhardt ' s solution (0.02% ficoll, 0.02% poly-second Alkene pyrrolidone, 0.02% bovine serum albumin), 10% dextran sulfate, 1% sarcosyl, 20mM phosphate buffer pH 7.0,250 μ g/ml yeast tRNA and 500 μ g/ml salmon sperm DNAs.Radioactive probe ultimate density in hybridization buffer be Identical scope (1.5nM).Tissue slice is covered by the hybridization solution comprising label probe, covers Nescofilm coverslip, and At 42 DEG C in moist box overnight incubation.Then, section at 60 DEG C in 1 × SSC wash 4 times (each 15 points Clock), and at room temperature in 1 × SSC 1 time 30 minutes, it is dehydrated and is exposed to film 1-3 days.Film optical density (OD) AIS^RComputer Image analysis system carries out semidefinite quantization.

As, seen in Figure 14 A, two dosage of 5-HTT-NLF-siRNA molecule are sat at three different antero posterior axis All induction of the specific downregulation of 5-HTT mRNA of dorsal raphe nucleus in mark system.

As seen in Figure 14 B, the 5-HT on film in Midbrain Raphe_1AIt is close that R mRNA positive particle is measured Degree meter quantitatively shows that in NLF-siRNA group, expression has the decline of 30%, compared with vehicle group.

These results show that NLF-siRNA optionally orients oligonucleotide, and it performs mRNA and is pointed to Midbrain Raphe The interference of specificity serotoninergic neuron.

5-hydroxy tryptamine transporterThe density of albumen is to measure as described in Example 4, use [³H] citalopram is used for The autoradiography in 5-HTT site.NLF-siRNA intranasal administration, after 24-48 hour, puts to death mice, and their brain is extractd And in following AP coordinate system, obtain the coronalplane of 14 μ m-thick: in terms of mm, relative to bregma (Franklin and Paxinos, 1997): 2.2 (prefrontal cortex-PFC), 1.1 to 0.6 (veutro is pale for caudate putamen-Cpu, side and middle every core-Sep Ball-VP) ,-1.5 to-1.8 (hippocampus-HPC, hypothalamus-Hip) and-4.24 to-4.96 (dorsal raphe nucleus-DR and centre Rapheal nuclei-MnR).Briefly, freezing tissue slice thaws and is dried, and is comprising 120mM NaCl and 5mM KCl under room temperature 50mM Tris-HCl buffer (pH 7.4 at 25 DEG C) in preculture 15mm.Then, under room temperature comprise 1.5nM [³H] west The same buffer of phthalein Pulan (70.0Ci/mmol) is cultivated 60 minutes.Non-specific binding is defined as: deposit at 1 μM of fluoxetine In lower reservation.Cultivating and after washing, tissue slice is immersed in distillation frozen water, and is dried rapidly under cold airflow.Tissue With plastic cement³H-standard substance expose 40 days together at 4 DEG C in the susceptible film of tritium.The quantitative analysis AIS of autoradiograph Computerization image analysis system is carried out.By using the number of the tissue-calibration of the radioactive standard product from common exposure According to, the OD value of autoradiograph is converted to radioactivity in tissue slice and is bound to the level (nCi/mg in specificity brain region Histone).

As being seen in fig .15, measured by autoradiographic binding analysis, with carrier or NLF-nonsense- The intranasal administration of siRNA is compared, and the intranasal application of 5-HTT-NLF-siRNA is transported induction of the 5-hydroxy tryptamine in territory, Different brain region The minimizing of body level.

Embodiment 11

Compared with matched group, by the 5-HTT-NLF-of internal intranasal application (i.n.) 10 and 30 μ g/ mouse dose SiRNA, the increase of 5-HT level in prefrontal cortex in the mice of process

In order to evaluate the NLF-siRNA effect to the functional characteristic of 5-HTT, have rated selectivity 5-HT transporter inhibitors Neuro chemistry effect to the 5-HT level responding 5-HTT NLF-siRNA in dorsal part striatum.For this purpose, male C57BL/6J mice (21-29g, 9-to 12-week is big, male) is anaesthetized with pentobarbital 40mg/kg i.p, and it is fixed to be placed on solid On the frame of position.Every mice dorsal part striatum (mPFC) (in terms of mm, from bregma AP+0.5, L-1.7, DV-4.5, according to The internal anatomy of Franklin and Paxinos, 1997) implant in a dialysis probe being configured with cuprophan membrane (1.5-mm length, 5000Da molecular weight cut-off value).

Microdialysis Experiments is that Post operation passes through with connecting overhead liquid in rotation body in loose-jointed mice for 24-72 hour WPI model sp220i syringe pump with the 2.0 μ speed of l/ minute continuously to probe carry aCSF (125mM NaCl, 2.5mM KCl、1.26mM CaCl₂、1.18mM MgCl₂) carry out.Within every 30 minutes, collect 60 μ l dialysis samples in microcentrifugal tube.

After 60-minute initial stable phase, 4-6 baseline sample at citalopram (1-10-50 μM) topical or Collect before fluoxetine (20mg/kg i.p.) Formulations for systemic administration, then collect continuous print dialysis sample.When dialysis experiment completes, place Dead mice, and brain is extractd also freezing at-70 DEG C immediately.Then, cryostat is cut the coronalplane (50 μm) of brain, and And, according to standardization program cresyl violet stains for irrigating the location at position.Only place from histologically correct probe The data obtained in animal are used for statistical analysis subsequently.

In dialysis sample, concentration HPLC of 5-HT measures, and wherein HPLC uses 3-μm octadecylsilica (ODS) post (7.5cm × 0.46cm), Hewlett-Packard (Hewlett-Packard) 1049 detector being set to 0.6V with oxidizing potential comes Carry out current detecting.Flowing is by 0.15 MNaH₂PO₄.H₂(pH 2.8, uses phosphorus for O, 1.8mM sodium octyl sulfate, 0.2mM EDTA Acid adjusts) and 30% methanol composition, and with 0.7ml/ minute press pump.The retention time of 5-HT is 3.5-4 minute, and detection limit is 2fmol/ sample.

As being seen in figure 16, compared with vehicle group, the dorsal part stricture of vagina of the mice group that 5-HTT-NLF-siRNA processes To selectivity 5-HTT inhibitor in 5-hydroxy tryptamine level in shape body, it is not or to be reduced including fluoxetine and citalopram 5-HTT response.The downward of 5-HTT in this evidence, i.e. serotoninergic neuron, suppresses by reducing selective transport body Agent in end brain region the amount of 5-HT impact and can be by Evaluation of Functional.

These results demonstrate Sertraline (NLF-siRNA) the targeting serotoninergic neuron being conjugated to siRNA, pass through Optionally interact, in addition to the sequence (siRNA) of nucleic acid component with 5-HTT.

Embodiment 3-8 shows 5-HT_1AThe NLF-siRNA of R orientation specifically can be positioned at dorsal raphe nucleus 5-HT neuron is lowered target gene.All it is observed after this acts on intracerebral ventricle injection and after intranasal application.

Embodiment 10 and 11 shows that NLF-siRNA specific to 5-HTT can also lower target gene, in this situation Under, 5-HTT mRNA.The targeting ability of the NLF-siRNA construct of the present invention should at ventriculus tertius (3DV) midbrain erebro ventricular injection With rear and with 0.3 to 1mg/Kg (to mice 10 to 30 μ g siRNA molecule) dosage intranasal apply in be all observed.This is The therapeutic domain that siRNA therapy generally accepts, and there are the potentiality being upgraded to human treatment.The application of noninvasive intranasal also increases Add siRNA molecule and develop into the feasibility of therapeutic agent.

Embodiment 12

The targeting of the siRNA (NLF-NS-siRNA) being conjugated to nomifensine confirms, is injected into the right side by internal Intraventricular Intraventricular

This embodiment shows the NLF-NS-siRNA that Intraventricular injects to arrive brain and be positioned at black substance and locus coeruleus Specific neuron.The dyeing of these cell tyrosine hydroxylases is positive, that is, they are dopaminergic or noradrenaline Element serotonergic neuron.

Sequence used is not have nonsense (ns) siRNA of homology with any mankind, mice or rat gene:

NS siRNA-s AGUACUGCUUACGAUACGG SEQ ID NO:69

NS siRNA-a CCGUAUCGUAAGCAGUACU SEQ ID NO:70

This sequence has the end DNA dimer of nucleotide, comprises at least one unshowned thymus pyrimidine (T), in order to The mRNA avoiding interference regulation and control normal procedure enters the albumen of cell.This technology is to well known to a person skilled in the art.For this A little end dimers, oligonucleotide has 21 base pairs, facilitates effective RNAi mechanism.Antisense (a) sequence also has Cy3 molecule To allow, in Laser Scanning Confocal Microscope, it is visible.

About the injection of siRNA, C57Bl/6Ncrl male mice isoflurane deep anaesthesia, and it is placed on connection band number The mice of the stereotaxic frame (David section husband's instrument (David KopfInstruments), model 940) of word display reading is joined suitable Device (Si Duting company of the U.S. (Stoelting) reference 51625).With 21G × 1.5 inch sterile needle stab on skull a hole it After, syringe (10 μ l Hamilton) delivers 2 μ l siRNA NLF-NS-siRNA-Cy3 solution in distilled water, and (100 μ g are total Dosage) or carrier enter (from bregma AP+0.26, L-0.75DV-2.5) in right ventricle, by syringe pump (U.S.'s KD scientific company (KD Scientific), KDS 310) in the way of the 0.5 μ constant flow rate of l/ minute (each time point n=2).Institute stayed by pin Position 3 minutes to avoid siRNA solution to upstream.

Mice irrigates at two different time point 4%PFA, is administered 1 and 3 hour after siRNA.Cut brain, and 4 In 4%PFA solution, 24h is fixed at DEG C.Then, brain places 48h at 4 DEG C in 30% sucrose solution.Brain is-30 to-40 It is chilled at DEG C in 2-methybutane, and is saved at-80 DEG C.Brain is cut into slices in Lycra (Leica) cryostat CM3050S (30mm).The washing of free floating section is also stored in 0.1M PBS and 0.001% Hydrazoic acid,sodium salt at 4 DEG C.

Section is washed in PBS, blocks with 2% lowlenthal serum and 0.1% trinitrotoluene (Triton), and at 4 DEG C By anti-TH antibody (1: 800 mice) overnight incubation.After washing, cutting into slices by two anti-Alexa Fluor 647 anti-mouses, (hero is public Department) (Invitrogen) at room temperature cultivate 1h.Finally, section is with reaching section's fluorescent mounting medium (Dako Fluorescent Mounting Medium) embedding, and use copolymerization Jiao's spectromicroscope (FV1000 Olympus) (FV1000 Olympus) point Analysis.Picture FV10-ASW 1.7 Viewer generates.

As, seen in Figure 17 and 18, after intracerebral ventricle injection 1h, in substantia nigra compacta and locus coeruleus, some TH are positive Cell is to the Cy3's also positive.Not all TH positive cell is all positive to Cy3, but the major part in them has internal Cy3 Fluorescence, indicating NLF-NS-siRNA-Cy3 molecule is to be merged in some TH-positive neurons.

Embodiment 13

The clearance body of nonsense 2-O '-methyl-modification of the Cy3-labelling of Sertraline it is conjugated to 5-by intracerebroventricular administration The targeting of hydroxytryptamine serotonergic neuron confirms

Conjugate is synthesized, the clearance body of the RNA wing of its 3 nucleotide comprising each self-contained 2-O '-methyl and comprise non- The nonsense gap area of 10 nucleotide length of specificity (nonsense) sequence.This clearance body is to be conjugated to sertraline via its 5 ' ends Woods, and it is conjugated to Cy3 via its 3 ' ends.Mice accepts the single intracerebral ventricle injection (30 μ g) of Cy3 conjugate and enters dorsal part the 3rd The ventricles of the brain, and 24h puts to death (n=2 mice) after injection.Then, the laser confocal microscope that is located through of Cy3 labelling is surveyed Fixed.This experiment shows that (Figure 19) clearance body is specifically to position to serotoninergic neuron.

Claims

1. a conjugate, comprises:

I) at least one selective reagent, it is specific binding to one or more neurotransmitter transporters；Wherein, described special Property be bound to one or more neurotransmitter transporters selective reagent select free selective serotonin reuptake inhibitor (SSRI) and the group that forms of norepinephrine-dopamine reuptake inhibitor (NDRI) and

Ii) at least one nucleic acid, it can be specific binding to target molecule, wherein said target molecule with neurotransmitter transporters Same cell is expressed；

Wherein said SSRI is Sertraline or its analog and has structure (I)

Wherein, independently, R₁、R₂、R₃、R₄、R₅And R₆It is hydrogen or any substituted C1-C6 alkyl；X and Y each be selected from hydrogen, fluorine, Chlorine, bromine, trifluoromethyl, C1-C3 alkoxyl and cyano group；And W is selected from hydrogen, fluorine, chlorine, bromine, trifluoromethyl, nitro and C1-C3 alkane Epoxide；

Or

Wherein said NDRI is nomifensine or its analog, and conjugate has a structure that

Wherein,

R₁Represent hydrogen, low alkyl group or benzyl, R₂Represent hydrogen, methyl, the chlorine of fluorine race, R₂' represent hydrogen, methyl, methoxyl group, hydroxyl Or halogen atom, R₃And R₄Represent hydrogen, low alkyl group, R₅Representing hydrogen, chlorine or the methoxyl group on 5-or 6-position, m is 2-6 and p is 2- 6。

Conjugate the most according to claim 1, wherein can be selected from as follows by the specific binding nucleotide sequence to target molecule The group of sequence composition: double-stranded RNA interference oligonucleotide, antisense oligonucleotide, clearance body, PNA, LNA, ribozyme and aptamers, its Described in target molecule be expressed in neurotransmitter transporters same cell.

Conjugate the most according to claim 1 and 2, the combination of its amplifying nucleic acid to target molecule creates the activity of target molecule and presses down The result of system.

4. the conjugate as described in any one of claim 1-3, wherein selective reagent is conjugated to 5 ' ends of nucleic acid.

5. the conjugate as described in any one of claim 1-4, wherein selective reagent and nucleic acid are to be connected by linking group 's.

6. conjugate as claimed in claim 5, its amplifying nucleic acid is double-strandednucleic acid, and it comprises complementary with the second oligonucleotide sequence The first oligonucleotide sequence.

7. conjugate as claimed in claim 2, wherein RNA interfering is siRNA.

8. conjugate as claimed in claim 7, comprises the blocking group of the 5 ' ends being connected to the second oligonucleotide further.

9. conjugate as claimed in claim 8, the blocking group of the 5 ' ends being wherein connected to the second oligonucleotide has knot Structure

M-L1_d-[(A-L2)_a-(B-L3)_b]_c-

Wherein:

M is H or lipid part；

A and B represents monomeric unit, independently selected from monosaccharide and (C₂-C₂₀) alkylene glycol composition group；

A and b is the integer of 0-50；

C is the integer of 0-30；

L1, L2 and L3 are to connect compound, independently selected from the group of following composition: di-phosphate ester, thiophosphate, carbamic acid Ester, methyl phosphonate, guanidine, sulfamate, sulfonamide, dimethoxym ethane, sulfur acute pyogenic infection of nails acetal, sulfone, amide and their mixture；

D is 0 or 1.

Conjugate the most according to claim 9, wherein monosaccharide is selected from the group of following composition: furanose, fructose, glucose, Galactose, mannose, modified monosaccharide, sialic acid and erythrose.

11. according to the conjugate described in claim 9 or claim 10, wherein (C₂-C₂₀) alkylene glycol selected from ethylene glycol, Propylene glycol and the group of their mixture composition.

12. conjugates according to claim 11, wherein M is H, and A is furanose；B is C18 ethylene glycol；A, b and c are 1, d It is 0 and L2 and L3 to be phosphodiester bond.

13. according to the conjugate described in any one of claim 1-12, and wherein selective reagent is that selectivity 5-hydroxy tryptamine is taken the photograph again Take inhibitor (SSRI).

14. conjugates according to claim 13, wherein selective serotonin reuptake inhibitor (SSRI) is selected from such as The group of lower composition: Sertraline, Sertraline analog, fluoxetine, fluvoxamine, paroxetine, indalpine, zimeldine, west Phthalein Pulan, dapoxetine, escitalopram and their mixture, and oligonucleotide sequence is complementary to target nucleotide, described target Nucleotide is expressed in the cell that amino acid neurotransmitter transporter is identical.

15. conjugates according to claim 14, it has the structure of the group formed selected from structure (I) or (II)

Wherein

X and Y is independently selected from hydrogen, halogen, C₁-C₃Alkyl, C₁-C₃Alkylhalide group, OR^aAnd SR^b, wherein R^aAnd R^bIt is to select independently From C₁-C₃Alkyl and C₆-C₁₀Aryl；

M, n and p are selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13, wherein m+n+p sum be selected from 7,8,9,10, 11, the integer of 12,13,14,15,16,17 and 18.

16. conjugates according to claim 15, have the structure selected from the following group formed

With

17. according to the conjugate described in any one of claim 13-16, and wherein said target molecule is the group selected from following composition: 5-hydroxytryptamine receptor 1A type (5-HT_1A), coding 5-hydroxytryptamine receptor 1A type (5-HT_1A) mRNA, 5-hydroxy tryptamine transporter albumen MRNA with coding 5-hydroxy tryptamine transporter.

18. conjugates according to claim 17, its amplifying nucleic acid can be specific binding to coding 5-hydroxytryptamine receptor 1A Type (5-HT_1A) mRNA, and comprise the sequence of group selected from following composition: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4.

19. conjugates as described in any one of claim 1-12, wherein selective reagent be norepinephrine-dopamine again Uptake inhibitor (NDRI), and target molecule be alpha-synapse nucleoprotein or coding alpha-synapse nucleoprotein mRNA.

20. conjugates as described in any one of claim 1-12, wherein selective reagent be norepinephrine-dopamine again Uptake inhibitor (NDRI), and target molecule be BAX or coding BAX mRNA.

21. conjugates as described in any one of claim 1-12, wherein selective reagent be norepinephrine-dopamine again Uptake inhibitor (NDRI), and target molecule be tau or coding Tau mRNA.

22. conjugates as described in any one of claim 1-12, wherein selective reagent be norepinephrine-dopamine again Uptake inhibitor (NDRI), and target molecule be Huntingdon or coding Huntingdon mRNA.

23. according to the conjugate described in any one of claim 15-18, and wherein conjugate has structure

24. as defined in claim 23 conjugate, wherein conjugate has structure

The application in pharmacy of 25. conjugates as described in any one of claim 1-24.

26. conjugates as described in any one of claim 1-12 for treatment or prevent depressed relevant disease in preparation Application in medicine, wherein

I () selective reagent is serotonin reuptake inhibitor (SSRI), and

(ii) oligonucleotide can specifically be bound to the target molecule selected from following group: encodes 5-hydroxytryptamine receptor 1A type (5- HT_1A) mRNA, the coding mRNA of 5-hydroxy tryptamine transporter, 5-hydroxytryptamine receptor 1A type (5-HT1A) and 5-hydroxy tryptamine transporter.

27. apply as claimed in claim 26, and wherein depressed relevant disease is the group selected from following composition: major depression, Compulsive disorder (OCD), pervasive developmental disorders (PDDs), posttraumatic stress disorder (PTSD), anxiety neurosis, Bipolar essence God's obstacle, eating disorders and chronic pain.

28. conjugates as described in any one of claim 1-12 are relevant with Louis body deposition for treatment or prevention in preparation Disease medicine in application, wherein

I () selective reagent is norepinephrine-dopamine reuptake inhibitor (NDRI), and

(ii) oligonucleotide can be specific binding to target molecule, its target be coding alpha-synapse nucleoprotein mRNA or Alpha-synapse nucleoprotein polypeptide.

29. apply as claimed in claim 28, and wherein relevant with Louis body deposition disease is crazy about selected from parkinson disease, Louis body Stay the group with multiple system atrophy.

30. conjugates as described in any one of claim 1-12 are dead with neuronal apoptosis and cell for treatment in preparation Die the application in the medicine of relevant disease, wherein

(ii) target molecule is BAX or the mRNA of coding BAX.

31. application according to claim 30, the disease relevant to neuronal apoptosis and cell death is selected from such as The group of lower composition: Alzheimer, parkinson disease and Huntington Chorea, apoplexy/wound, multiple sclerosis and amyotrophy funiculus lateralis are hard Change.

32. conjugates as described in any one of claim 1-12 are used for treating or preventing the medicine of tau relevant disease in preparation In application, wherein

(ii) target molecule is tau or the mRNA of coding Tau.

33. apply as claimed in claim 32, and wherein tau relevant disease is sick selected from relevant disease abnormal to Tau and Tau The group become.

34. apply as claimed in claim 33, and wherein Tau relevant disease is the group of choosing following disease composition: volume temporo is crazy about Stay the hypotype of parkinson's syndrome (FTDP-17) relevant with No. 17 chromosomes, progressive supranuclear plasy, cortical basal become Property, a creutzfeldt jakob disease, argyrophilic grain disease, and parkinson disease, mongolism, postencephalitic parkinsonism, dystrophic flesh are strong Directly, Niemann-pik c-type disease, boxer's dementia, Blint disease, prion disease, amyotrophic lateral sclerosis, pass island parkinson are comprehensive Levy, multiple sclerosis, glaucoma, diabetic retinopathy, and traumatic brain injury；And Huntington Chorea, dementia with Lewy body, Just Ke-Ma Li-Du Sishi disease, hereditary spastic paraplegia and multiple system atrophy.

35. conjugates as described in claim 1-12 are used for the application treating in the medicine of Huntingdon disease in preparation, wherein

(ii) target molecule is Huntingdon or the mRNA of coding Huntingdon.

36. apply as claimed in claim 35, and wherein conjugate is intracerebroventricular administration or intranasal administration.

37. 1 kinds for the method preparing formula (II) compound:

Wherein

R⁶It it is carbonyl-activating group

N and p is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13；

The method includes the steps of:

A) formula (III) compound

React with formula (VII) acylating agent:

Wherein p is as defined above, and Z is halogen or OH, and PG is amido protecting group, generation formula (IV) compound:

B) amido protecting group deprotection on formula (IV) compound is made, generation formula V compound:

C) acylating agent of formula (V) compound with formula (VIII) or (IX) is reacted:

Wherein n is as defined above, and Z is halogen or OH, generation formula (VI) compound:

D) compound of formula (VI) is processed with carbonyl-activating base.

38. according to the method described in claim 37, comprises amido modified with following formula (X) of formula (II) compound further Oligonucleotide reacts, generation formula (I) conjugate as defined in claim 23:

Wherein R¹-R⁵, X, Y, W, m, n and p be as defined in claim 37.

39. according to the method described in claim 38, and wherein oligonucleotide comprises the sequence selected from SEQ ID NO:5a12.

40. compounds, selected from the following group constituted:

I () has a compound of formula (II):

Wherein R¹-R⁶, X, Y, W, n and p be as defined in claim 37；

(ii) there is the compound of formula (IV)

Wherein R¹-R⁵, X, Y, W, p and PG be as defined in claim 37；

(iii) formula (V) compound

Wherein R¹-R⁵, X, Y, W and p be as defined in claim 37；

(iv) formula (VI) compound

Wherein R¹-R⁵, X, Y, W, p and n be as defined in claim 37.

41. compounds according to claim 40, are selected from

I () has the compound of following structure

(ii) there is the compound of following structure

(iii) there is the compound of following structure

With

(iv) there is the compound of following structure

42. 1 kinds for synthesizing the method as claimed in claim 1 with following structure conjugate

Wherein

R1, R2, R3, R4 and R5 are independently selected from hydrogen and C₁-C₆Alkyl；

N and p is selected from 1,2,3,4,5,6,7,8,9,10,11,12 and 13；

And the target molecule that wherein oligonucleotide can be expressed in the specific binding cell identical at neurotransmitter transporters, its In neurotransmitter transporters specific binding with selective reagent；Comprise the following steps:

A) following formula: compound

With formula (V) acylation reaction

Wherein p is as defined above, and Z is halogen or OH and PG is amido protecting group, generates formula (VI) compound

B) the amido protecting group deprotection on formula (VI) compound is made, generation formula (VII) compound:

With

C) oligonucleotide of formula (VII) compound with the carboxyl modified of formula (XIV) is reacted:

43. 1 kinds of methods being used for preparing formula as claimed in claim 1 (XIV) compound

Wherein

R₁Represent hydrogen, low alkyl group or benzyl

R₂Represent hydrogen, methyl, the chlorine of fluorine race

R₂' represent hydrogen, methyl, methoxyl group, hydroxyl or halogen atom

R₃And R₄Represent hydrogen, low alkyl group

R₅Represent hydrogen, chlorine or the methoxyl group on 5-or 6-position and

P is 2-6,

And the target molecule that wherein oligonucleotide can be expressed in the specific binding cell identical at neurotransmitter transporters, its In neurotransmitter transporters specific binding with selective reagent；

The method comprises the following steps:

A) by formula (XVI) compound

React with formula (V) acylating agent:

Wherein R₁、R₂、R₂’、R₃、R₄,R₅Being as defined above with p, Z is halogen or OH, and PG is amido protecting group, Production ((XVII) compound

B) the amido protecting group deprotection on formula (XVII) compound is made, production (XVIII) compound:

With

C) the amido modified oligonucleotide of formula as described above (XVIII) compound with formula (X) is reacted:

44. compounds, selected from the following group constituted:

I () has the compound of formula (XVII) structure

With

(ii) there is the compound of formula (XVIII) structure

Wherein, R₁、R₂、R₂’、R₃、R₄、R₅With p as defined in claim 43.

45. compounds according to claim 44, selected from following group:

I () has the compound of following structure

With

(ii) there is the compound of following structure