CN103013967A - Trehalose synthase from marine microorganisms and coding gene and application thereof - Google Patents
Trehalose synthase from marine microorganisms and coding gene and application thereof Download PDFInfo
- Publication number
- CN103013967A CN103013967A CN2012105854095A CN201210585409A CN103013967A CN 103013967 A CN103013967 A CN 103013967A CN 2012105854095 A CN2012105854095 A CN 2012105854095A CN 201210585409 A CN201210585409 A CN 201210585409A CN 103013967 A CN103013967 A CN 103013967A
- Authority
- CN
- China
- Prior art keywords
- trep
- trehalose
- seq
- expression vector
- encoding gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention relates to the technical field of marine organisms, and aims at searching a trehalose synthase from marine microorganisms. Trehalose produced by using the trehalose synthase is high in conversion rate and low in production cost. The invention provides a trehalose synthase from the marine microorganisms, which is derived from marine pseudomonadaceae P8005(CCTCC (China Center For Type Culture Collection) No:M2010298) stored in CCTCC by the applicant, is named P8005-TreS, and has an amino acid sequence shown in SEQ ID NO:2. The invention also provides a coding gene and application of the trehalose synthase.
Description
Technical field
The present invention relates to the marine biotechnology field, be specifically related to a kind of TreP and encoding gene and application of made from ocean microorganism.
Background technology
Trehalose is a kind of stable non-reducing disaccharide, extensively is present in bacterium, fungi, yeast, insect and the various plants body.With α-1, the 1-glycosidic link links by two pyranoid ring glucose, and trehalose has 3 kinds of optical isomers, and wherein α α type trehalose is modal trehalose.α β and β β type seldom exist at occurring in nature, and α α type trehalose structure formula is suc as formula shown in (I).
The stable chemical nature of trehalose.Mouthfeel is sweet taste slightly.Its physico-chemical property is stable, can not make the fehling reagent reduction, can not be hydrolyzed by alpha-glycosidase, but can be hydrolyzed to two glucose molecules by trehalase.Trehalose has provide protection in vivo, and it can protect biomacromolecule to avoid infringement under the extreme conditions such as low temperature, dehydration, high temperature, oxidative stress.Trehalose has wide practical use at biological medicine, food, cosmetic industry owing to its special character.
Early stage trehalose preparation method comprises that chemical synthesis and microorganism extraction process, particularly yeast extraction method once were the staple modes of production of trehalose.But too high, expensive by these methods production trehalose manufacturing costs, oneself is through progressively being eliminated in recent years.
The Production by Enzymes trehalose progressively becomes the major way that trehalose is produced.Finding altogether in vivo at present has five trehalose biosynthetic pathways, wherein has three approach to be studied in great detail.Article one, approach is the TPS-TPP approach, is the most a kind of approach of trehalose synthesis that distributes in the organism.But because substrate has the energy-rich phosphate material: G-6-P and UDPG, expensive, be not suitable for suitability for industrialized production (Pan YT et al.Trehalose-phosphate synthase of Mycobacterium tuberculosis.Cloning, expression and properties of the recombinant enzyme.Eur J Biochem2002,269:6091-6100).Second approach (TreY-TreZ) is to utilize starch or Fructus Hordei Germinatus oligosaccharide to be substrate, at first under the effect of malt oligosaccharide based mycose synthetase (TreY), generate Fructus Hordei Germinatus oligomerization trehalose, then regeneration trehalose under the effect of malt oligosaccharide based mycose base hydrolysis of trehalose enzyme (TreZ).The former biochemical institute of Japanese woods had invented the method for producing trehalose by these two kinds of enzymes first in 1994, and the method is take starch as substrate, in the synergy of TreY and TreZ, by starch direct production trehalose.Cooperate other amylolytic enzyme, the trehalose transformation efficiency can reach 70%.At present, existing several companies grasp method (the Nakada T et al.Purification and properties of a novel enzyme that this approach is produced trehalose in the world, maltooligosyl trehalose synthase, from Arthrobacter sp.Q36.Biosci Biotechnol Biochem1995,59:2210-2214).Article three, approach is the TreS approach, by transglycosylation in the molecule by the TreP of TreS genes encoding, mutual conversion (Nishimoto T between single step reaction catalysis maltose and trehalose, et al.Purification and properties of a novel enzyme, trehalose synthase, from Pimelobacter sp.R48.Biosci Biotechnol Biochem1996,60:640-644).
Article the second, three, approach extensively exists in natural microorganism, has a plurality of Pseudomonas to contain above-mentioned single enzyme or two enzyme system, but is present in Situation of Microorganism Under Extremity Environment and the archeobacteria more, or induce generation at extreme environment.Research about trehalose generation and metabolic mechanism is the extreme microorganism (hot subject of (Extremophiles) research always.But the coding characteristic of trehalose synthesize enzyme gene is special, be difficult for expressing in the allos biology, or expression amount is on the low side, although therefore a large amount of paper publishings are arranged, seldom has the patent of declaring according to gene engineering expression open, infers that accordingly correlation technique waits research and development.
Through network search, retrieve altogether a plurality of patents about the enzymatic conversion method of trehalose.The disclosed a kind of TreP of Zhongnuo Bioengineering Co., Ltd., Nanning, express in 40L fermentor tank level, maltose take 27.27% is substrate, transformation time 32h, transformation efficiency 70%, it is the main method (denomination of invention is " trehalose synthetase from corynebacterium glutamicum gene and trehalose manufacture method ", and publication number is CN1563371A) of present domestic production trehalose.Guangxi University discloses a kind of TreP that derives from brown happiness hot tearing spore bacterium (Thermobifida fusca), and (denomination of invention is " T.fusca trehalose synthesize enzyme gene and trehalose manufacture method ", publication number is CN1563372A) take malt syrup as substrate, can produce the trehalose of 40-70%.
The basic reason that restricts for a long time the trehalose widespread use is that the production cost of trehalose is higher.Because all by starch two steps transformed the same with maltose of trehalose generates: maltose is transformed by amylase and saccharifying enzyme, trehalose is transformed by malt oligosaccharide based mycose synthetase and malt oligosaccharide based mycose lytic enzyme, in case therefore output, production cost and the efficient of trehalose production enzyme can be produced the same of enzyme with maltose, the price of trehalose just can be the same with maltose, and its product competitiveness and the market share will be very huge.
Summary of the invention
The object of the invention is to seek a kind of TreP of made from ocean microorganism, the trehalose transformation efficiency that utilizes this TreP to produce is high, production cost is low.Another object of the present invention provides encoding gene and the application thereof of this TreP.
The invention provides a kind of TreP of made from ocean microorganism, derive from before the applicant the marine pseudomonas P8005 at preservation Chinese Typical Representative culture collection center (Pseudomonas sp.P8005), preserving number is CCTCC No:M2010298); Relevant this strain marine pseudomonas bacterial strain P8005 and the application in the preparation trehalose thereof, the applicant has applied for that on November 24th, 2010 Chinese patent, application number are CN201010560023.X, application publication number is CN102477405A.
The present invention further studies the sequence of this marine pseudomonas P8005 bacterial strain, by design of primers and pcr amplification, obtains a kind of TreP, called after P8005-TreS.
A kind of TreP provided by the invention has following (a) or (b) or protein (c):
(a) protein that is formed by the aminoacid sequence shown in the SEQ ID NO:2;
(b) with the aminoacid sequence of SEQ ID NO:2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with the TreP protein that is derived by SEQ ID NO:2;
(c) aminoacid sequence among the SEQ ID NO:2 is added the preceding paragraph sequence (such as the affinity purification label) at N end or C end, and relevant with the TreP protein that is derived by SEQ ID NO:2.
SEQ ID NO:2 in the sequence table is comprised of 1122 amino-acid residues.
Described one or the number replacement of several amino-acid residues and/or disappearance and/or interpolation refer to be no more than replacement and/or disappearance and/or the interpolation of 10 amino-acid residues.
In order to make the P8005-TreS in (a) be convenient to purifying, adopt the pET-32a carrier to carry out amalgamation and expression.The amalgamation and expression protein sequence is compared with former sequence on the basis of the aminoacid sequence shown in the SEQ ID NO:2 in by sequence table and is added sulphur hydrogen reduction albumen label (TrxTag) at the N of former sequence end, adds poly histidine-tagged (HisTag) at the C end.
Above-mentioned (b) but or the P8005-TreS synthetic (c), also can synthesize first its encoding gene, carry out again biological expression and obtain.
The encoding gene of P8005-TreS in above-mentioned (b) can by will be in the dna sequence dna shown in the SEQ ID NO:2 in the sequence table codon of one or several amino-acid residue of disappearance, and/or the missense mutation of carrying out one or several base pair obtains.
A second aspect of the present invention provides the encoding gene of above-mentioned TreP (P8005-TreS).
The invention provides the encoding gene of a kind of TreP (P8005-TreS), be following (ⅰ) or dna molecular (ⅱ):
(ⅰ) dna molecular shown in SEQ ID NO:1;
(ⅱ) under stringent condition with the dna sequence dna hybridization that (ⅰ) limits and the dna molecular of the described TreP of encoding.
SEQ ID NO:1 in the sequence table is comprised of 3369 Nucleotide, and wherein last three is terminator codon.
Described stringent condition can be at 0.1 * SSPE (or in the solution of 0.1 * SSC), 0.1%SDS, hybridizes under 65 ℃ and washes film.
The present invention further provides, contained recombinant expression vector or the transgenosis recombinant bacterium of above-mentioned TreP encoding gene.
Described recombinant expression vector is the recombinant expression vector that above-mentioned TreP encoding gene is inserted into the expression TreP that obtains in the coli expression carrier.Described coli expression carrier is preferably the pET-32a carrier.
Described transgenosis recombinant bacterium is that above-mentioned recombinant expression vector is imported in the intestinal bacteria, and screening obtains expressing the transgenosis recombinant bacterium of TreP.Described intestinal bacteria are preferably e. coli bl21 (DE3) pLysS.As contain intestinal bacteria Escherichia coli (E.coli) BL21 (DE3) pLysS of said gene.
The present invention also provides a kind of method of expressing TreP further, and the method is to cultivate the above-mentioned transgenosis recombinant bacterium that contains TreP P8005-TreS encoding gene, obtains TreP.
The molecular weight of TreP P8005-TreS of the present invention is 126kDa, and the pH scope of enzymic activity is 6.0-8.5, and optimal pH is 7.2; The temperature range of enzymic activity is 10-45 ℃, and optimal reactive temperature is 37 ℃.
A third aspect of the present invention, recombinant expression vector, transgenic cell line or the transgenosis recombinant bacterium application in the preparation trehalose that provides above-mentioned TreP and encoding gene thereof and contain the encoding gene of TreP.
Adopt the TreP of the present invention's preparation, have the characteristics such as output is high, transformation efficiency is high, production cost is low.The intestinal bacteria recombinant bacterium that specifically, will contain restructuring pET-32a-P8005-TreS plasmid passes through the recombinase that the every ml of expression and purity can obtain 40-50U.(90mM maltose, 20mM potassium primary phosphate-dipotassium hydrogen phosphate damping fluid pH7.2) in 37 ℃ of lower reaction 10h, can make the transformation efficiency of maltose reach 85% in the enzyme adding 100ml system with this quantity.
Description of drawings
Fig. 1 is SDS-PAGE protein electrophoresis figure
Wherein M is the albumen Marker of standard molecular weight,
1 is the full cell of thalline of intestinal bacteria E.coli BL21 (DE3) PlysS of unconverted pET-32a-P8005-TreS plasmid,
2 for the conversion before inducing has the thalline supernatant of BL21 (DE3) PlysS of pET-32a-P8005-TreS plasmid,
3 for the conversion after inducing has the thalline supernatant of BL21 (DE3) PlysS of pET-32a-P8005-TreS plasmid,
5 is the component of 50mM imidazoles wash-out,
6 is the component of 90mM imidazoles wash-out,
7 is the component of 200mM imidazoles wash-out,
8 is the component of 500mM imidazoles wash-out;
Fig. 2 is the color atlas that HPLC separates trehalose, maltose and glucose;
Fig. 3 is that the enzyme activity of pET-32a-P8005-TreS recombinase is with the pH variation diagram;
Fig. 4 is that the enzyme activity of pET-32a-P8005-TreS recombinase varies with temperature figure;
Fig. 5 is that the metal ion of 1mM or 10mM is on the figure that affects of P8005-TreS enzyme activity;
Fig. 6 is that the pET-32a-P8005-TreS recombinase transforms maltose generation trehalose thin layer point plate figure
Wherein 1: the standard substance of glucose maltose trehalose,
2: the substrate maltose before the reaction,
3: through the reacted product trehalose of pET-32a-P8005-TreS recombinase and substrate maltose.
Embodiment
Describe the present invention below in conjunction with embodiment and accompanying drawing.But the following example should not regarded limitation of the scope of the invention as.
Experimental technique among the following embodiment if no special instructions, is ordinary method.
The main agents of following embodiment: the pET-32a expression plasmid is available from Novagen company.ExTaq archaeal dna polymerase, restriction enzyme, T4-DNA ligase enzyme, pMD-18T carrier, standard molecular weight DNA marker are available from TaKaRa company.Genome extraction agent box, plasmid extraction test kit gel reclaim test kit available from the biochemical company limited of sky root.Thin-layer chromatography (TLC) precoated plate is available from Merck company; The glycan analysis post is available from Agilent company.Agarose (electrophoresis level), penbritin, IPTG give birth to worker's biotechnology company limited available from Shanghai.Other reagent is the analytical pure chemical reagent of domestic or import.
Embodiment 1: the extraction of marine pseudomonas (Pseudomonas sp.) P8005 genomic dna
Marine pseudomonas (Pseudomonas sp.) P8005 is that the inventor separates a strain bacterium that obtains from the ooze in China East Sea.This bacterial strain is preserved in Chinese Typical Representative microbial preservation center preservation for the patent application purpose on November 12nd, 2010, preserving number is CCTCC No:M2010298.
The culture condition of this bacterial strain is Zobell2216E substratum (peptone 5g, yeast extract paste 1g, high ferric phosphate 0.1g, artificial seawater 1L, pH7.4), and 28 ℃, 130rpm cultivates 48-72h.Get the 100mL medium centrifugal and collect thalline, adopt genome extraction agent box extracting genomic dna.With the genomic dna of extracting with TE damping fluid or distilled water wash-out ,-20 ℃ of preservations, and with 1% agarose gel electrophoresis analysis.
Embodiment 2: the acquisition of TreP encoding gene
The genomic dna of the pseudomonas P8005 that extracts take embodiment 1 is as template, with primer P8005-TreSF and P8005-TreSR for carrying out pcr amplification.Wherein, upstream primer P8005-TreSF sequence: CCC
GAATTCATGTATTTTCAGGAGTTTGC(SEQ ID NO:3, underscore partly represent EcoR I recognition site);
Downstream primer P8005-TreSR:AAATTT
CTCGAGTGACGTCTCCCCACC (underscore partly represents Xho I recognition site).
The PCR condition is: 94 ℃ of 4min; (94 ℃ of 30sec, 55 ℃ of 30sec, 72 ℃ of 3min) 30cycles; 72 ℃ of 5min; 4 ℃ of preservations.
The pcr amplification product that obtains is carried out electrophoresis detection, and the result shows that the PCR product size that obtains is about 3.3kb.Utilize gel to reclaim test kit and reclaim this PCR product, and be connected the rear e.colistraindh5α that transforms with the pMD-18T carrier.Positive colony is delivered company's order-checking, and sequencing result shows that this PCR product has the dna sequence dna (P8005-TreS) shown in SEQ ID NO:1 in the sequence table, illustrates the nucleotide sequence of the P8005-TreS that successfully increases.Adopt PCR glue to reclaim test kit and reclaim the target dna fragment, put-20 ℃ of preservations.
Embodiment 3: the acquisition of recombinant plasmid pET-32a-P8005-TreS and conversion
The PCR glue recovery product that adopts restriction enzyme EcoR I and Xho I that embodiment 2 previous steps are obtained carries out enzyme to be cut, and is connected with the pET-32a carrier that passes through same enzyme double digestion.Transform intestinal bacteria E.coli DH5 α, the picking positive colony extracts plasmid and the evaluation of checking order.Be the recombinant vectors called after pET32a-P8005-TreS of the dna sequence dna of sequence 1 in the sequence table with sequencing result, and transform and express intestinal bacteria E.coli BL21 (DE3) pLysS (available from Novagen company).Step of converting is as follows:
1) Host Strains BL21 (DE3) the pLysS competent cell of-70 ℃ of preservations of thawing on ice;
2) 100 μ l competent cells add the above-mentioned pET-32a-P8005-TreS plasmid of 1 μ l, rotate gently mixing, and ice bath is placed 30min;
3) centrifuge tube is put into the water-bath of pre-heating to 42 ℃, left standstill 90s;
4) fast centrifuge tube is transferred in the ice bath cooling 2-3min;
5) add the fresh LB of 800 μ l and cultivate based in the transformant, 37 ℃ of soft vibration 45min;
6) centrifugal collection bacterium, and add the resuspended thalline of LB substratum that 200 μ l contain penbritin;
7) the resuspended thalline of 100 μ l is joined the LB agarose plate that contains penbritin, with aseptic spreading rod coating evenly;
8) flat board is placed room temperature until liquid is absorbed, be inverted flat board, cultivate 12-16h for 37 ℃.
Embodiment 4: the abduction delivering of recombinant bacterium and the purifying of alginate synthase
Positive colony on picking embodiment 3 flat boards, single colony inoculation contain the LB liquid nutrient medium of penbritin 100 μ g/mL and paraxin 34 μ g/mL to 4ml, at 37 ℃ of activation culture 12h.Subsequently, be forwarded to the LB liquid nutrient medium that 100mL contains penbritin 100 μ g/mL and paraxin 34 μ g/mL, 37 ℃ of shaking culture 3 ~ 4h to OD with activating the inoculum size of bacterium liquid according to 1:100
600Be 0.6, add again inductor IPTG to final concentration 0.2mmol/L, behind 20 ℃ of inducing culture 20h, centrifugal collection thalline.With the potassium primary phosphate of 20mmol/LpH7.4-resuspended thalline of dipotassium hydrogen phosphate damping fluid, 4 ℃ of lower ultrasonication thalline (power 100W, working hour 2s, intermittent time 5s, total time 10min) behind 4 ℃ of centrifugal 20min of 12000rpm, are got supernatant liquor.Transform the recombinant bacterium of E.coli BL21 (DE3) pLysS of pET-32a-P8005-TreS, in the centrifugal supernatant liquor of ultrasonication, contain the enzyme activity of 45-50U at every ml bacterium liquid under above-mentioned cultivation and the inductive condition.The supernatant liquor that reclaims adopts the affine filler of Ni Sepharose (available from GE Healthcare company) purifying.Purification result is analyzed with the SDS-PAGE protein electrophoresis.
The result as shown in Figure 1, swimming lane M is the albumen Marker of standard molecular weight among the figure, swimming lane 1 is the full cell of thalline of intestinal bacteria E.coli BL21 (DE3) pLysS of unconverted pET-32a-P8005-TreS plasmid, swimming lane 2 has the thalline supernatant of BL21 (DE3) pLysS of pET-32a-P8005-TreS plasmid for the conversion before inducing, swimming lane 3 has the thalline supernatant of BL21 (DE3) pLysS of pET-32a-P8005-TreS plasmid for the conversion after inducing, swimming lane 5-8 is respectively component (the swimming lane 5:50mM that adopts different concns imidazoles wash-out; Swimming lane 6:90mM; Swimming lane 7:200mM; Swimming lane 8:500mM).Wherein the eluted protein in the swimming lane 7 and 8 is the TreP P8005-TreS of purifying.
Embodiment 5: the determining of the optimal pH of TreP P8005-TreS
Prepare respectively following damping fluid: acetic acid-sodium-acetate buffer (pH4.5,5.0,5.5); Potassium primary phosphate-dipotassium hydrogen phosphate damping fluid (pH6.0,6.5,7.0,7.5,8.0); Boric acid-sodium borate buffer liquid (pH8.5,9.0,9.5), concentration is 0.1mol/L.The maltose that comprises following component: 90mM in 100 μ l reaction systems, the pET-32a-P8005-TreS of 0.1U purifying, the above-mentioned different damping fluids of 20mM.In addition, the extra KCl that adds 20mM in take acetic acid and boric acid as the reaction solution of damping fluid, 37 ℃ of reaction 30min, boiling water bath 5min termination reaction.
Detect the content of trehalose in the product with efficient liquid-phase chromatography method.Chromatographic condition is: glycan analysis post (5 μ m, 4.6mm * 250mm, Agilent company), moving phase is acetonitrile: water (82:18, v/v) 1.4ml/min, the ELSD detector detects, 115 ℃ of vaporization temperatures, 90 ℃ of atomization temperatures, gas flow rate 1.15SLM.Definition calculates enzyme activity according to enzyme activity.Enzyme activity with vertex is defined as enzyme activity 100%.Obtain the optimal pH curve according to enzyme activity and pH value in reaction mapping.
The result as shown in Figure 2, as seen from the figure, pET-32a-P8005-TreS has the vigor of TreP in the scope of pH5.5-9.5, activity is higher in the scope of pH6.0-8.0, its optimal pH is approximately 7.2.
Embodiment 6: the determining of the optimal reactive temperature of TreP pET-32a-P8005-TreS
The maltose that comprises following component: 90mM in 100 μ l reaction systems, the P8005-TreS of 0.1U purifying, 20mM potassium primary phosphate-dipotassium hydrogen phosphate damping fluid.In 10-50 ℃ of scope, respectively react 30min under several different temperature condition, boiling water bath 5min termination reaction.Detect the content of trehalose in the product with efficient liquid-phase chromatography method as described in Example 5, calculate enzyme and live.Enzyme activity with vertex is defined as enzyme activity 100%.Relative activity according to enzyme is mapped to temperature of reaction, obtains the optimal reactive temperature curve of enzyme.
The result as shown in Figure 3.The result shows, the optimal reactive temperature of enzyme is about 37 ℃.
Embodiment 7: metal ion is on the impact of enzyme activity
Select following metal ion to study: Ca
2+, Mg
2+, Mn
2+, Cu
2+, Co
2+And Zn
2+, comprise the maltose of following component: 90mM in 100 μ l reaction systems, the P8005-TreS of 0.1U purifying, 20mM potassium primary phosphate-dipotassium hydrogen phosphate damping fluid (pH7.2) and above-mentioned 1mM or metal ion and the inhibitor of 10mM.Simultaneously with the above-mentioned reaction solution that do not add above-mentioned any metal ion in contrast.37 ℃ of reaction 30min detect the content of trehalose in the product with efficient liquid-phase chromatography method as described in Example 5, calculate enzyme and live.The enzyme activity that records with the control group reaction solution is defined as enzyme activity 100%.
Fig. 4 is seen in the impact of various different metal ion pair enzyme activities.By the result as seen under 1mM concentration, Ca
2+, Mg
2+Work has faint promoter action, Ba to enzyme
2+, Mn
2+, Co
2+, Zn
2+Enzyme activity is had certain restraining effect, and along with the concentration of metal ion is increased to 10mM, all metal ions is lived to enzyme all in various degree restraining effect.Cu
2+Enzyme activity is had a great impact, and also inhibitory enzyme is alive fully under the lower concentration.
Embodiment 8: produce trehalose and detection with TreP of the present invention
(enzyme that pH7.2) adds the 40U purifying is in 37 ℃ of lower reaction 10h for 90mM maltose, 20mM potassium primary phosphate-dipotassium hydrogen phosphate damping fluid, and boiling water bath 10min termination reaction makes enzyme deactivation in the 100ml system.Get 10 μ l supernatant liquors detect trehalose in the product with high performance liquid chromatography and thin-layer chromatography method content.
Efficient liquid-phase chromatography method: adopt Agilent1100 chromatographic working station (joining the ELSD detector), usefulness glycan analysis post (5 μ m, 4.6 * 250mm, Agilent) analyze.Moving phase is acetonitrile: water (84:16, v:v), flow velocity 1.4ml/min, ELSD detect parameters (vaporization temperature: 115 ℃, atomization temperature: 95 ℃, gas flow rate: 1.15SLM), according to the content of trehalose, maltose and glucose in the standard substance drawing standard curve calculation sample.The retention time of glucose, maltose and trehalose is respectively 7.1min under this condition, 13.7min and 16.4min(Fig. 5).
Through calculating, through the reaction under this condition, the transformation efficiency of maltose reaches 85%.
Adopt in addition thin-layer chromatography method (thin layer chromatography, TLC) that reaction product is analyzed.The TLC condition is as follows: at TLC thin layer plate (Merck) point sample, developping agent is propyl carbinol: pyridine: water=4:6:1. developer is that 20% sulfuric acid is dissolved in methyl alcohol.Oven dry is until show spot in 110 ℃ of baking ovens.The result has trehalose to produce through pET-32a-P8005-TreS catalysis as shown in Figure 6.
Above demonstration and described ultimate principle of the present invention, principal character and advantage of the present invention.The technician of the industry should understand; the present invention is not restricted to the described embodiments; that describes in above-described embodiment and the specification sheets just illustrates principle of the present invention; the present invention also has various changes and modifications without departing from the spirit and scope of the present invention, and these changes and improvements all fall in the claimed scope of the invention.The claimed scope of the present invention is defined by appending claims and equivalent thereof.
Claims (10)
1. TreP has following (a) or (b) or protein (c):
(a) protein that is formed by the aminoacid sequence shown in the SEQ ID NO:2;
(b) with the aminoacid sequence of SEQ ID NO:2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with the TreP protein that is derived by SEQ ID NO:2;
(c) aminoacid sequence among the SEQ ID NO:2 is added the preceding paragraph sequence at N end or C end, and relevant with the TreP protein that is derived by SEQ ID NO:2.
2. the encoding gene of a TreP as claimed in claim 1 is following (ⅰ) or dna molecular (ⅱ):
(ⅰ) dna molecular shown in SEQ ID NO:1;
(ⅱ) under stringent condition with the dna sequence dna hybridization that (ⅰ) limits and the dna molecular of the described TreP of encoding.
3. recombinant expression vector, transgenic cell line or transgenosis recombinant bacterium that contains the encoding gene of TreP as claimed in claim 2.
4. a kind of recombinant expression vector, transgenic cell line or transgenosis recombinant bacterium that contains the encoding gene of TreP according to claim 3, it is characterized in that, recombinant expression vector is the recombinant expression vector that the dna molecular shown in SEQ ID NO:1 is inserted into the expression TreP that obtains in the coli expression carrier.
5. a kind of recombinant expression vector, transgenic cell line or transgenosis recombinant bacterium that contains the encoding gene of TreP according to claim 4 is characterized in that, described coli expression carrier is the pET-32a carrier.
6. a kind of recombinant expression vector, transgenic cell line or transgenosis recombinant bacterium that contains the encoding gene of TreP according to claim 4, it is characterized in that, described transgenosis recombinant bacterium is that described recombinant expression vector is imported in the intestinal bacteria, and screening obtains expressing the transgenosis recombinant bacterium of TreP.
7. a kind of recombinant expression vector, transgenic cell line or transgenosis recombinant bacterium that contains the encoding gene of TreP according to claim 6 is characterized in that, described intestinal bacteria are e. coli bl21 (DE3) pLysS.
8. the application of TreP as claimed in claim 1 in the preparation trehalose.
9. the application of the encoding gene of a TreP as claimed in claim 2 in the preparation trehalose.
10. recombinant expression vector, transgenic cell line or transgenosis recombinant bacterium application in the preparation trehalose that contains the encoding gene of TreP as claimed in claim 3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012105854095A CN103013967A (en) | 2012-12-28 | 2012-12-28 | Trehalose synthase from marine microorganisms and coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012105854095A CN103013967A (en) | 2012-12-28 | 2012-12-28 | Trehalose synthase from marine microorganisms and coding gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103013967A true CN103013967A (en) | 2013-04-03 |
Family
ID=47963082
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012105854095A Pending CN103013967A (en) | 2012-12-28 | 2012-12-28 | Trehalose synthase from marine microorganisms and coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103013967A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104911135A (en) * | 2015-07-01 | 2015-09-16 | 江南大学 | Trehalose synthase production strain and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101917872A (en) * | 2008-01-31 | 2010-12-15 | 曼海姆/奥克森福特旭德楚克股份公司 | Method for the production of fermented beverages |
-
2012
- 2012-12-28 CN CN2012105854095A patent/CN103013967A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101917872A (en) * | 2008-01-31 | 2010-12-15 | 曼海姆/奥克森福特旭德楚克股份公司 | Method for the production of fermented beverages |
Non-Patent Citations (2)
| Title |
|---|
| NCBI: "ACCESSION NO：JQ951963", 《GENBANK》, 16 July 2012 (2012-07-16) * |
| 姚林: "Pseudomonas putida S1海藻糖合成酶基因在大肠杆菌中的表达及其条件研究", 《中国优秀硕士学位论文全文数据库基础科学辑》, no. 03, 15 March 2009 (2009-03-15) * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104911135A (en) * | 2015-07-01 | 2015-09-16 | 江南大学 | Trehalose synthase production strain and application thereof |
| CN104911135B (en) * | 2015-07-01 | 2018-04-13 | 湖南汇升生物科技有限公司 | A kind of trehalose synthase production bacterial strain and its application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kim et al. | High temperature and low acid pretreatment and agarase treatment of agarose for the production of sugar and ethanol from red seaweed biomass | |
| TW200914610A (en) | Isopropyl alcohol-producing bacteria and method for producing isopropyl alcohol using the same | |
| CN102796751B (en) | Mutant Pul 324 of pullulanibacillus naganoensis pullulanase and use thereof | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| CN105255849A (en) | Glutamate decarboxylase mutant establishment improving enzyme activity and application thereof | |
| Li et al. | Metabolic control of Clostridium thermocellum via inhibition of hydrogenase activity and the glucose transport rate | |
| CN110452919A (en) | Truncated alginate lyase Aly7B-CDII gene and application thereof | |
| CN101100658B (en) | Trehalose synthetase and application thereof | |
| CN101768581B (en) | Mutant enzyme L20A of L-arabinose isomerase with D-tagatose high-yield capability and mutation method thereof | |
| CN113528553B (en) | Codon-optimized N-acetylglucosamine transferase gene and application thereof | |
| CN104593400A (en) | Method for improving expression level of trehalose synthase gene by molecular chaperone co-expression | |
| CN102154326A (en) | Streptomyces coelicolor trehalose synthase enzyme gene and application thereof | |
| CN102154190B (en) | Engineering escherichia coli capable of efficiently producing hyaluronic acid and preparation method thereof | |
| CN111334488B (en) | Laminarin enzyme OUC-L1, and coding gene and application thereof | |
| CN101372693A (en) | Heat resisting cellulase gene, recombinant engineering bacterium, heat resisting cellulase and use | |
| CN102367448A (en) | Construction method of genetic engineering strain for high expression and easy purification of beta-mannanase | |
| CN106434715B (en) | Malt oligosaccharide based mycose synthetase and its expressing gene and application | |
| CN101503678B (en) | Malt oligosaccharide based mycose synthetase, coding gene and use | |
| CN101519652B (en) | Trehalose synthetase as well as encoding genes and application thereof | |
| CN103013967A (en) | Trehalose synthase from marine microorganisms and coding gene and application thereof | |
| CN107603967A (en) | A kind of chitosan enzyme CSN4 and its encoding gene and application | |
| CN107201373B (en) | A kind of maltogenic amylase and its gene, the engineering bacteria containing the gene and its application | |
| CN106520729B (en) | Malt oligosaccharide based mycose hydrolase and its expressing gene and application | |
| CN102952790B (en) | Multifunctional cellulose as well as expression gene and application thereof | |
| CN107201375A (en) | Produce the construction method and its application of (R, R) 2,3 butanediol engineering strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130403 |