CN102993289B - Scolopendra mutilans polypeptide toxin kappa-SLPTX-Ssm4a and gene and application thereof - Google Patents

Abstract

The invention relates to scolopendra mutilans polypeptide toxin kappa-SLPTX-Ssm4a and gene and application thereof, belonging to the technical field of biomedicine. The scolopendra mutilans polypeptide toxin kappa-SLPTX-Ssm4a consists of amino acid sequence of SEQ ID NO:1; gene of encoded scolopendra mutilans polypeptide toxin kappa-SLPTX-Ssm4a consists of nucleotide sequence of SEQ ID NO:1; and the scolopendra mutilans polypeptide toxin kappa-SLPTX-Ssm4a selectively restrains potassium channel subtype Kv1.3 on T cell, thus being a specific potassium channel inhibitor. The scolopendra mutilans polypeptide toxin kappa-SLPTX-Ssm4a is applied in medicine for preparing and curing or preventing self immunological diseases related to T cell.

Description

Few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a and gene and application

Technical field:

The present invention relates to a kind of few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a and gene and application, belong to field of biomedicine technology.

Background technology:

Potassium channel is a kind of important transmembrane protein on cytolemma, has very important physiological significance.Potassium channel is distributed in the cells such as skeletal muscle, nerve, heart, blood vessel, body of gland widely.To find at present most species, a kind of ionic channel that effect is the most complicated.Potassium ion distribution of a great variety is also very extensive, and wherein potassium-channel hypotype Kv1.3 is mainly distributed in the surface of T cell, is the key of effector T cell continuous activation.

T cell is to be formed by intrathymic lymphoid stem cell differentiation, is that in lymphocyte, quantity is maximum, the class cell that function is the most complicated.T cell is lymphocytic main ingredient, it has various biological function, and as direct killing target cell, auxiliary or inhibition B cell produces antibody, to specific antigens and former responsing reaction and the generation cytokine of mitogenesis, resist disease in health and infect and tumour formation.It is a kind of and the closely-related autoimmune disorder of T cell that psoriatic is commonly called as " psoriasis ", and improving autoimmunity is the psoriatic a kind of important method for the treatment of.Kv1.3, as an important factor of T cell persistence activation, plays the part of vital role in the physiological function of T cell, has confirmed that at present Kv1.3 and numerous disease are closely related, and Kv1.3 has also become the popular target spot of drug development.Autoimmune disease for example rheumatoid arthritis, psoriatic, hepatitis, multiple sclerosis, obesity, transplant rejection and the inflammatory neuropathy of Kv1.3 mediation are closely related.In the inhibitor of Kv1.3, flavonoid can be used for treating lupus erythematosus, relevant rheumatism; Shk toxin analogue is for prevention of obesity and type ii diabetes.

Centipede is a kind of traditional Chinese medicine, warm in nature, and taste is pungent, poisonous.The function of there is breath wind antispastic, dispersing pathogen accumulation, removing obstruction in channels to relieve pain.In centipede poison gland, contain abundant polypeptide composition, verified at present these polypeptide compositions mostly are neurotoxin.Polypeptide can optionally suppress sodium channel, potassium channel or calcium channel, and therefore the composition in centipede venom has a wide range of applications future, as exploitation becomes analgesic and treatment autoimmune disease medicine.

Summary of the invention:

The object of the present invention is to provide a kind of few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a and gene and application.

Few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a provided by the invention, by molecular sieve and reverse high performance liquid chromatography separation and purification, to obtain from the thick poison of few sour jujube centipede, its aminoacid sequence (SEQ ID NO:1) is TDDESSNKCAKTKRRENVCRVCGNRSGNDEYYSECCESDYRYERCLDLLR N, this polypeptide comprises that 51 amino-acid residue molecular weight are 6042.57Da, iso-electric point is 5.3, it is 1-5 that molecule contains three pairs of its matching methods of disulfide linkage, 2-4,3-6.

The gene clone of few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a comprises:

The total RNA of few sour jujube centipede poison gland extracts, mRNA purifying, and mRNA reverse transcription and cDNA library build, and design primer utilizes the few sour jujube centipede calcium channel activator polypeptide gene of PCR method screening.Amplimer length is 17 Nucleotide, its sequence is 5 '-GCGAAAAATGGAAATCT-3 ', another amplimer of PCR is 3 ' PCR Primer primer in the SMART TM cDNA Library Construction Kit of CLONTECH company, and its sequence is 5 ＇ ATTCTACAGGCCGAGGCGGCCGACATG 3 ＇.The positive monoclonal that obtains carries out gene nucleotide series mensuration.

Gene sequencing result show the to encode gene (SEQ ID NO:2) of few sour jujube centipede calcium channel activator is comprised of 563 Nucleotide, from 5 ' end to 3 ' terminal sequence gene order, comprised signal peptide, precursor peptide and mature peptide, wherein underscore part is mature peptide.

Few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a of the present invention is in the application of preparing in the Immunological diseases medicine relevant to T cell.

Few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a of the present invention, potassium-channel on rat dorsal root ganglion is had to obvious restraining effect, this toxin can optionally act on potassium channel hypotype Kv1.3, the psoriatic of mouse and hepatitis B model show that this polypeptide has good result for the treatment of, can be in the application for the treatment of in psoriatic and hepatitis B medicine.

Accompanying drawing explanation:

Fig. 1-A to Fig. 1-D is the separation and purification of polypeptide toxin kappa-SLPTX-Ssm4a.Wherein: Fig. 1-A toxin is through the separation graph of G50 molecular sieve, and wherein arrow is depicted as object peak.Fig. 1-B object toxin reverse hplc collection of illustrative plates for the first time, wherein arrow is desired polypeptides.Fig. 1-C molecules of interest reverse hplc for the second time.The Mass Spectrometric Identification figure of Fig. 1-D molecules of interest.

Fig. 2-A to Fig. 2-C is that polypeptide toxin kappa-SLPTX-Ssm4a is to potassium channel action effect.Wherein: Fig. 2-A 5 μ M toxin kappa-SLPTX-Ssm4a suppress the potassium current on rat dorsal root ganglion completely.Fig. 2-B 1 μ M toxin kappa-SLPTX-Ssm4a can selectivity suppress potassium channel hypotype Kv1.3 electric current.Fig. 2-C detoxifying function is in the dense effect curve of potassium channel hypotype Kv1.3.Potassium current in the complete suppressor T cell of Fig. 2-D 100 nM kappa-SLPTX-Ssm4a.Fig. 2-E toxin kappa-SLPTX-Ssm4a acts on the dense effect curve of potassium current on T cell.

Fig. 3-A to Fig. 3-F is that polypeptide toxin is to the therapeutic action of mouse psoriasis model.Wherein: Fig. 3-A 1,10,100 nM kappa-SLPTX-Ssm4a reduce the amount of TNF-α significantly.Fig. 3-B 1,10,100 nM kappa-SLPTX-Ssm4a reduce the amount of IFN-γ significantly.Fig. 3-C 1,10,100 nM kappa-SLPTX-Ssm4a reduce the amount of IL-2 significantly.Fig. 3-D 1,10,100 nM kappa-SLPTX-Ssm4a reduce the amount of IL-8 significantly.Fig. 3-E 1,10,100 nM kappa-SLPTX-Ssm4a reduce the amount of IL-17 significantly.Fig. 3-F 1,10,100 nM kappa-SLPTX-Ssm4a reduce the amount of IL-22 significantly.

Fig. 4-A to Fig. 4-E is that polypeptide toxin is to the therapeutic action of mouse hepatitis model.Wherein: Fig. 4-A canavalin(e) makes ALT content significantly increase with respect to control group, and kappa-SLPTX-Ssm4a obviously reduces ALT content, canavalin(e) and kappa-SLPTX-Ssm4a reduce ALT content after combining use equally.Fig. 4-B canavalin(e) makes AST content significantly increase with respect to control group, and kappa-SLPTX-Ssm4a obviously reduces AST content, and canavalin(e) and kappa-SLPTX-Ssm4a reduce AST content after combining use equally.Fig. 4-C canavalin(e) makes TBIL content significantly increase with respect to control group, and kappa-SLPTX-Ssm4a obviously reduces TBIL content, and canavalin(e) and kappa-SLPTX-Ssm4a reduce TBIL content after combining use equally.Fig. 4-D canavalin(e) makes DBIL content significantly increase with respect to control group, and kappa-SLPTX-Ssm4a obviously reduces DBIL content, and canavalin(e) and kappa-SLPTX-Ssm4a reduce DBIL content after combining use equally.Fig. 4-E canavalin(e) makes IBIL content significantly increase with respect to control group, and kappa-SLPTX-Ssm4a obviously reduces IBIL content, and canavalin(e) and kappa-SLPTX-Ssm4a reduce IBIL content after combining use equally.

Embodiment

1, the separation and purification of kappa-SLPTX-Ssm4a

The separation and purification of kappa-SLPTX-Ssm4a is divided into three steps: (1) molecular sieve; Few sour jujube centipede venom (absorption value under 280 nm is 200 OD) of 4mL adopts self-chambering post (filler is Sephadex G-50,2.6 100 cm) to separate.Adopt 0.1 M PBS(PH=6.0) wash-out, flow velocity is 0.3mL/min, within every ten minutes, changes collection tube.Solution after collection is the absorption value at 280 nm with the every pipe solution of UV spectrophotometer measuring, draws elution curve.(2) find out the elution peak at desired polypeptides place, further adopt reverse hplc separation and purification.To after the elution peak freeze-drying of molecular sieve, again be dissolved in the deionized water of 2ml, adopt Phenomenex C18(250 x 4.6 mm) chromatographic column separation.Elute soln is acetonitrile (containing 0.1%TFA), and flow velocity is 3ml/min, and detecting wavelength is 280/215 nm.(3) will after the elution peak freeze-drying of object sample in second step, adopt again reverse hplc separation and purification.Adopt Phenomenex C18(250 x 4.6 mm) chromatographic column separation.Elute soln is acetonitrile (containing 0.1% TFA), and flow velocity is 0.7ml/min, and detecting wavelength is 280/215 nm.

As shown in Fig. 1-A to Fig. 1-C, few thick poisons of sour jujube centipede separate through reverse hplc after crossing molecular sieving, and wherein arrow is denoted as object peak, and this peak produces a single main peak through reverse hplc reverse hplc separation for the second time for the second time.

The evaluation of lps molecule quality is all used U.S. Bruker company to produce ProFLEXTMIII type mass spectrograph, adopts MALDI-TOF to detect: reflective-mode detects lps molecule amount; Laser repetition rate 5.00 Hz; N2 optical maser wavelength 337nm; Ion source acceleration voltage 1 (IS/1) 20 Kv; Control software and Sun workstation that the control of instrument and the processing of data are developed by Brucker company complete.With 0.1%TFA-50% acetonitrile-49.9% deionized water mixed solution, prepare the saturated solution of matrix CCA (α-cyano-4-hydroxyc-innamic acid), then getting 1 μ l sample mixes with the saturated solution of 1 μ l CCA, get again 0.5 μ l mixed solution point sample in mass spectrographic sample disc, detection molecules amount after drying at room temperature.Proofread and correct by external standard method or marker method.

Result is as Fig. 1-D, and the molecular weight of few sour jujube centipede toxin kappa-SLPTX-Ssm4a is in 6042.3 Da molecules, to have to contain three pairs of disulfide linkage.

2, kappa-SLPTX-Ssm4a aminoacid sequence and gene order

2.1 reach 99.9% kappa-SLPTX-Ssm4a employing Edman degradation principles through Mass Spectrometric Identification purity, utilize full-automatic Protein Sequencer to record partial sequence, more finally determine complete aminoacid sequence according to the gene order of kappa-SLPTX-Ssm4a.

The purifying of 2.2 few sour jujube centipede poison gland mRNA:

Few sour jujube centipede poison gland mRNA separation and purification adopts the PolyATtract mRNA Isolation Systems test kit of U.S. PROMEGA company.

A. get the total RNA 500 μ g of few sour jujube centipede poison gland and be dissolved in 500 μ l DEPC water, put into 65 ℃ of water-baths 10 minutes, add Oligo (dT) probe and the 13 μ l 20 × SSC solution of people 3 μ l, mix, placement room temperature is cooling, is called A liquid.

B. the washing of magnetic bead (SA-PMP): magnetic bead is flicked and mixed, to magnetic frame absorption 30 seconds, abandon supernatant, add 0. 5 × SSC, 0. 3m1, to magnetic frame absorption 30 seconds, finally add 0.1 ml 0. 5 × SSC and suspend, be referred to as B liquid.

C. A liquid is added in B liquid, room temperature was placed 10 minutes, to magnetic frame absorption 30 seconds, abandon supernatant, with 0. 1 × SSC washing 4 times, finally abandon supernatant, add 0. l ml DEPC aqueous suspension, to magnetic frame, adsorb 30 seconds, supernatant is moved to new test tube, then add 0. 15 m1 DEPC water Eddy diffusions, to magnetic frame absorption 30 seconds, moving supernatant to above-mentioned test tube, is the south China tree toad skin mRNA of purifying in supernatant.

D. add 1/10 volume 3 M sodium acetates, pH 5. 2, equal-volume Virahol, in-70 ℃ of placements 30 minutes, 4 ℃, centrifugal 10 minutes of 12000rpm, abandoned supernatant, is precipitated and dissolved in 10 μ l DEPC water.

3.3 few sour jujube centipede venom gland cDNA libraries build

Adopt the CreatorTM SMART TM cDNA Library Construction Kit of CLONTECH company Construction of Plasmid cDNA Library test kit.

A. cDNA the first chain synthetic (mRNA reverse transcription):

1. at the aseptic centrifuge tube of 0.5ml, add the few sour jujube centipede poison gland mRNA of 1 μ l, 1 μ l SMART IV oligonucleotide, 1 μ l CDS III/3 ' PCR primer, add 2 μ l deionized waters and make cumulative volume reach 5 μ l.

2. mix reagent in centrifuge tube of short duration centrifugal, 72 ℃ of insulations 2 minutes.

3. centrifuge tube is hatched on ice 2 minutes.

4. in centrifuge tube, add following reagent 2.0 μ l 5 × the first chain bufferings, 1.0 μ l 20 mM dithiothreitol (DTT), 1.0 μ l 10 mM dNTP mixtures, 1.0 μ l PowerScript ThermoScript II.

5. reagent of short duration centrifugal in mixing centrifuge tube, 42 ℃ of insulations 1 hour.

6. centrifuge tube is placed in and ends the synthetic of the first chain on ice.

7. from centrifuge tube, get cDNA first chain of 2 μ l synthesizeds standby.

B. adopt long end polymerase chain reaction (LD-PCR) method second chain that increases

1.95 ℃ of preheating PCR instrument.

2. 2 μ l cDNA the first chains (mRNA reverse transcription), 80 μ l deionized waters, 10 μ l 10 × Advantage 2 PCR bufferings, 2 μ l 50 × dNTP mixtures, 2 μ l 5 ' PCR primers, 2 μ l CDS III/3 ' PCR primers and 2 μ l Escherichia coli polymerase centrifuge tubes are reacted.

3. in PCR instrument, by following program, increase:

1. 95 ℃ of 20 second

2. 22 circulations:

95 ℃ of 5 second

68 ℃ 6 minutes

4. after loop ends, cDNA two strands synthetic in centrifuge tube is carried out to extracting.

C. the Wizard of PROMEGA company for PCR product sV Gel and PCR Clean-Up System test kit carries out extracting and reclaiming, and step is as follows:

1. add isopyknic film binding buffer to put upside down the cDNA two strands obtaining by PCR and mix, then will mix liquid and proceed to centrifugal purification post, standing 5 minutes of room temperature, is fully combined DNA with pellosil.Centrifugal 1 minute of 16,000 g, outwell the waste liquid in collection tube.

2., in centrifugal purification post, centrifugal 1 minute of 16,000 g, outwell the waste liquid in collection tube to add the elutriant (containing ethanol) of 700 μ l.

3. repeating step 2.

4. centrifugal 5 minutes of 16,000 g.

5. centrifugal purification post is placed in to new centrifuge tube.

6. add 30 μ l ultrapure waters, at room temperature standing 5 minutes.

7. centrifugal 1 minute of 16,000 g, pipe end solution is the cDNA two strands of purified mistake.

D. the preparation of bacillus coli DH 5 alpha competent cell:

1. the single DH5 α of picking bacterium colony, is inoculated in 3m1 containing in the LB substratum of penbritin, 37 ℃ of overnight incubation, get next day above-mentioned bacterium liquid in proportion 1:100 be inoculated in 50 m1 LB nutrient solutions, 37 ℃ of vibrations 2 hours.Work as OD ₆₀₀value reaches at 0.35 o'clock, results bacterial cultures.

2. bacterium is transferred in aseptic, disposable, ice-cold 50 m1 polypropylene tube, on ice, 10 min put in side, make culture be cooled to 0 ℃.

3. in 4 ℃ with centrifugal 10 min of 4100 r/min, to reclaim cell.

4. pour out nutrient solution, pipe is inverted to l min so that last trace nutrient solution flows to end.

5. the 0.1mol/L CaCl of every 50ml initial incubation liquid and 30 ml precoolings ₂-MgCl ₂solution (80 mmol/L MgCl ₂, 20 mmol/L CaCl ₂) resuspended every part of cell precipitation.

6. in 4 ℃ with the centrifugal 10min of 4100r/min, to reclaim cell.

7. pour out nutrient solution, pipe is inverted to l min so that last trace nutrient solution flows to end.

8. every 50 m1 initial incubation things ice-cold 0.1 mol/L CaCl of 2m1 ₂resuspended every part of cell precipitation, standby after packing.

2.4. enzyme is cut, is connected and connects the conversion of product:

1. in Eppendorf tube, add 1 μ l Takara pMD19-T carrier, the double-stranded solution of the few sour jujube centipede poison gland cDNA of 4 μ l, full dose is 5 μ l.

2. add 5 μ l(equivalent) ligase enzyme buffer mixture.

3. 16 ℃ are reacted 2 hours.

4. (10 μ l) are added in 100 μ l DH5 α competent cells full dose, place 30 minutes in ice.

5. 42 ℃ were heated after 90 seconds, then in ice, placed 1 minute.

6. add 37 ℃ of LB substratum 890 μ l of bathing of temperature, 37 ℃ of slow shaking culture 60 minutes.

7. get 200 μ l and coat on the LB substratum that contains X-Gal, IPTG, Amp 37 ℃ and cultivate 16 hours, form single bacterium colony.

8. 5 m1 LB liquid nutrient medium washing bacterium colonies for each LB plate, add 30% glycerine frozen.The cDNA building is approximately containing 1 × 10 ⁶individual independent clone.

2.5, few sour jujube centipede toxin kappa-SLPTX-Ssm4a gene clone screening:

Amplimer length is that 17 its sequences of Nucleotide are 5 '-GCGAAAAATGGAAATCT-3 ', and another amplimer of PCR is the SMART of CLONTECH company ^tM3 ' PCR Primer primer in cDNA Library Construction Kit, its sequence is 5 ＇ ATTCTACAGGCCGAGGCGGCCGACATG 3 ＇.

PCR reaction is carried out under the following conditions: 94 ℃ of 30 second, 56 ℃ of 30 second and 72 ℃ of 45 second, 30 circulations.

Amplified production is detected with 1% agarose gel electrophoresis, cut object band, carry out purifying with DNA purification kit.The object fragment of purifying is connected in pMD19-T carrier, obtains connection product.By connecting product, transform previously prepared good bacillus coli DH 5 alpha competent cell.Finally, get appropriate converted product and be applied on the LB flat board containing Amp, through 37 ℃ of single bacterium colonies of cultivating 16 H-shapeds one-tenth, be the positive colony containing object fragment.

Picking list bacterium colony detects the size of Insert Fragment with M13 primer.Select containing the positive colony of object fragment and send the order-checking of DNA sequencing company.

The aminoacid sequence of few sour jujube centipede toxin kappa-SLPTX-Ssm4a and gene order are respectively as shown in SEQ ID NO:1 and SEQ ID NO:2.

3. the activity of few sour jujube centipede toxin kappa-SLPTX-Ssm4a to potassium channel on DRG neurone

Select the SD rat that birth ± 4 week, body weight are about 140～200 g, after anesthesia, disconnected neck is put to death, and chooses rapidly vertebra and is cut into 2～4 sections, and canalis spinalis is cut off along the direction vertical with rib, then in the beaker that fills a small amount of nutrient solution, soaks canalis spinalis; Carefully tear the colourless mucous membrane being attached on canalis spinalis inwall, expose the Dorsal root nerve fiber of canalis spinalis and rib intersection.In thoracic vertebrae and lumbar portion, select 10～15 good dorsal root ganglion and put into the culture dish that the interim nutrient solution of 2 mL is housed.Isolate after neuroganglion and nerve fiber, with floss and axon outside Wei Nasi shearing deganglionate, put into the culture dish that fills the interim nutrient solution of approximately 0.5 mL.Remove interim nutrient solution, with Wei Nasi, cut the neuroganglion of separation is shredded.Then by shredding rear neurocyte, proceed in the vial that contains 15 mL Digestive systems, at 34 ℃, in the environment of 110 rpm with Digestive system enzymolysis 20～30 min.During enzymolysis, every 8～10 min, take out vial piping and druming cell agglomerating to prevent cell; Enzymolysis stops in backward Digestive system, adding trypsin inhibitor, enzymolysis reaction.Solution after enzymolysis is proceeded to centrifugal in centrifuge tube (1000 rpm, 2-5 min), remove supernatant.With containing the nutrient solution re-suspended cell of 10% calf serum, the cell after resuspended is divided into 3～4 wares, and every ware adds 2 mL nutrient solutions, puts into 37 ℃ of constant incubator (5% CO ₂, 95% air) in, cultivate after 3～4 hours for record current.

Before experiment, extracellular fluid must be placed under room temperature and after balance, change again the nutrient solution in culture dish, to prevent the acute variation of solution temperature.While changing solution, to prevent that cell from coming off from culture dish bottom.Under inverted microscope, select that cytolemma is comparatively smooth, the uniform cell of tenuigenin, under 20～25 ℃ of conditions of room temperature, carry out patch clamp experiments.Selecting 100 μ l borosilicate glass capillary tube is glass electrode material, glass electrode is drawing instrument (PC-10, Narishige) above through two steps, draw and form, the very hot polishing rear electrode of vitreous electricity tip aperture is 1.5～3.0 μ m, fills with intracellular fluid after having drawn in glass electrode.Glass electrode initial resistance is that 1.5～2.5 M Ω are relatively good.After forming giga ohm (G Ω) sealing-in of high resistance between electrode and cytolemma, mend the fast electric capacity of electrode.Then by cell clamp built in-60 mV, give a short and strong negative pressure, the cytolemma of clamping down in electrode is broken rapidly, then is compensated the slow electric capacity of cell.After forming full cell record pattern, cell clamp is made as to-80 mV, cytotostatic 4～6 min start record current.System resistance (Rs) remains within the scope of 5～10 M Ω and preferably can remain unchanged in experimentation, and Cascade System resnstance transformer is generally between 30～60%.

4, the effect of few sour jujube centipede toxin kappa-SLPTX-Ssm4a to potassium channel hypotype Kv1.3.

Cell transfecting:

(1) transfection the day before yesterday, with not cultivating and change in culture dish containing microbiotic nutrient solution containing antibiotic nutrient solution.

(2) when cell density reaches 80-90%, abandon nutrient solution, PBS rinsing once, adds 2 mL serum-free mediums (Opti-MEM).

(3) configuration A liquid: standing 5 min under 240 ul serum free medium+10 ul lipofectamine 2000 per well (cumulative volume 250 ul) room temperatures.

(4) configuration solution B: add 4 ngDNA in 250 μ L serum-free mediums, the standing 5min of room temperature.

(5) A liquid and B liquid are mixed to standing 20min under room temperature.

(6) by mixed DNA-liposome rear even, be added dropwise to gently in cell.

After (7) 6 hours, change the full substratum that contains serum.

Before experiment, extracellular fluid must be placed under room temperature and after balance, change again the nutrient solution in culture dish, to prevent the acute variation of solution temperature.While changing solution, to prevent that cell from coming off from culture dish bottom.Under inverted microscope, select that cytolemma is comparatively smooth, the uniform cell of tenuigenin, under 20～25 ℃ of conditions of room temperature, carry out patch clamp experiments.Selecting 100 μ l borosilicate glass capillary tube is glass electrode material, glass electrode is drawing instrument (PC-10, Narishige) above through two steps, draw and form, the very hot polishing rear electrode of vitreous electricity tip aperture is 1.5～3.0 μ M, fills with intracellular fluid after having drawn in glass electrode.Glass electrode initial resistance is that 1.5～2.5 M Ω are relatively good.After forming giga ohm (G Ω) sealing-in of high resistance between electrode and cytolemma, mend the fast electric capacity of electrode.Then by cell clamp built in-60 mV, give a short and strong negative pressure, the cytolemma of clamping down in electrode is broken rapidly, then is compensated the slow electric capacity of cell.After forming full cell record pattern, cell clamp is made as to-80 mV, cytotostatic 4～6 min start record current.System resistance (Rs) remains within the scope of 5～10 M Ω and preferably can remain unchanged in experimentation, and Cascade System resistance (Rseries compensation) compensates generally between 30～60%.

5, few sour jujube centipede toxin kappa-SLPTX-Ssm4a is to psoriatic treatment.

Toxin kappa-SLPTX-Ssm4a adopts PBS to be dissolved into 1,10,100 nM concentration, and hatch 1 hour with T cell in advance.Hatch after 1 hour and adopt anti-CD3 ⁺/ CD28 ⁺antibody activated T cell.After t cell activation 16 hours, adopt immunoenzyme connection adsorption method to detect TNF α in T cell, hIL-2, IL-8, IL-17, the content of IL-22 and IFN-γ.

6, few sour jujube centipede toxin kappa-SLPTX-Ssm4a is to hepatitis treatment effect.

At large mouse tail vein injection 15mg/kg canavalin(e) of 6-8 week, mouse forms oxyhepatitis model, injects the kappa-SLPTX-Ssm4a of 5mg/kg before injection scalpel legumin before half an hour.Laboratory animal is divided into 4 groups, is respectively: injection scalpel soybean protein group, control group, injection kappa-SLPTX-Ssm4a group and simultaneously injection scalpel soybean protein and kappa-SLPTX-Ssm4a group.After injection scalpel soybean protein 4 hours, the liver of getting mouse detects AST and ALT content.After 8 hours, detect TNF-α in mice serum, interleukin-2 (IL-2) and Gan Rao Su – γ (INF-γ) content.

SEQUENCE LISTING

<110> Kunming Institute of Zoology, Chinese Academy of Sciences

The few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a of <120> and gene and application

<130> 1

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 51

<212> PRT

<213> Scolopendra subspinipes mutilans

<400> 1

Thr Asp Asp Glu Ser Ser Asn Lys Cys Ala Lys Thr Lys Arg Arg Glu

1 5 10 15

Asn Val Cys Arg Val Cys Gly Asn Arg Ser Gly Asn Asp Glu Tyr Tyr

20 25 30

Ser Glu Cys Cys Glu Ser Asp Tyr Arg Tyr Glu Arg Cys Leu Asp Leu

35 40 45

Leu Arg Asn

50

<210> 2

<211> 563

<212> DNA

<213> Scolopendra subspinipes mutilans

<400> 2

atgaattctt cgatagctat tttgctagta atggctctaa ttatgttttc tttggacaaa 60

tcttattcga ctgatgatga atcaagcaat aaatgcgcga aaacaaaacg tcgtgaaaac 120

gtttgccgag tatgtggtaa ccgatcgggc aatgatgaat attattccga atgttgcgaa 180

tctgattata gatatgaaag gtgtctggat ttgctgcgaa attgacttca tagcattctc 240

tactataaaa ccagcgaaat gcttttttga atccatgatt ttttatgtta ttaattttct 300

aaaattttga cagtaaacaa tttgtcaaaa agtattgttt ttttgttaaa tttaagaatt 360

atataaatgg aaaattttat aaaattgtaa atttctttta aatttacaat gggtttttgt 420

tttgttttat ataaatataa tttcgtttgt aattttatta taatattgct gataaccttt 480

tgttagtact aaaggattag gctgtgattt ttattcaaaa taaattgctc tcaataaaaa 540

aaaaaaaaaa aaaagaaaaa aaa 563

Claims (4)

1. few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a, is characterized in that being comprised of the aminoacid sequence shown in SEQ ID NO:1.

2. the gene of few sour jujube centipede polypeptide toxin kappa-SLPTX-Ssm4a described in coding claim 1, is characterized in that being comprised of the nucleotide sequence shown in SEQ ID NO:2.

3. the application of polypeptide toxin kappa-SLPTX-Ssm4a claimed in claim 1 in preparation self property Immunological diseases medicine.

4. the application of the polypeptide toxin kappa-SLPTX-Ssm4a described in claim 3 in self property Immunological diseases medicine of preparation, is characterized in that described self property Immunological diseases comprise: psoriatic, hepatitis.

Images