CN102989007B - The extensive method preparing injection Midkine antisense oligonucleotide nano liposome - Google Patents
The extensive method preparing injection Midkine antisense oligonucleotide nano liposome Download PDFInfo
- Publication number
- CN102989007B CN102989007B CN201210226878.8A CN201210226878A CN102989007B CN 102989007 B CN102989007 B CN 102989007B CN 201210226878 A CN201210226878 A CN 201210226878A CN 102989007 B CN102989007 B CN 102989007B
- Authority
- CN
- China
- Prior art keywords
- liposome
- asodn
- solvent
- antisense oligonucleotide
- nanometer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicinal Preparation (AREA)
Abstract
The extensive method preparing injection Midkine antisense oligonucleotide nano liposome, the lipid mixture of cation lipid and phospholipid is dissolved in organic solvent by the present invention, obtain lipid soln, then by Ultrasound Instrument, liposome is tentatively disperseed, and remove organic solvent by ultrafiltration, last under high pressure with the unified particle diameter of squeezer extruding, obtain blank nanometer liposome; Then be mixed to get MK-ASODN nanometer liposome with MK-ASODN solution, injection Midkine antisense oligonucleotide nano liposome produced according to the invention, particle diameter is between 100 ~ 500nm, and stable in properties, antihepatocarcinoma effect significantly strengthens.This technical process is simple, easily realizes, and is very easy to amplify, and is suitable for suitability for industrialized production.
Description
Technical field
The invention belongs to medicines resistant to liver cancer preparing technical field, relate to and prepare the method that Midkine antisense widow closes thuja acid nanometer liposome on a large scale.
Background technology
Primary hepatoma (hepatocellularcarcinoma, HCC) is a kind of high aggressive, high metastatic solid malignant, but also lacks desirable Therapeutic Method.
Midkine (midkine, MK) be a newfound angiogenic factors, it is a kind of Heparin-binding protein of alkalescence with the tumor formation related activity such as short cell transformation, mitogenesis effect, short tumor-blood-vessel growth, anti-apoptotic and fortifying fibre protein dissolution, only in embryo's mid-term and adult renal expression.Existing research shows, in many mankind tumor tissues such as hepatocarcinoma, MKmRNA and albumen are all in highly expressing, and various normal structure only has low expression level or without expression, and with the generation of hepatocarcinoma, infiltration metastasis, angiogenesis and prognosis closely related, and angiogenesis to be hepatocarcinoma unrestrictedly attack, the basis of growth and transfer.Therefore, MK may be the desired target of antiangiogenesis therapy hepatocarcinoma.
It is the oligodeoxynucleotide with single-minded sequence that antisense widow closes thuja acid, and copying, transcribe and translating of energy specific blockage target gene is a kind of method of gene therapy.The Midkine antisense oligonucleotide (MK-ASODN sequence: CCCCGGGCCGCCCTTCTTCA) of our screening is verified has obvious antihepatocarcinoma effect in vivo and in vitro, promises to be a kind of new liver cancer treatment target spot.But, because antisense oligonucleotide is highly hydrophilic material, surface, with very strong negative charge, is therefore difficult to through cell membrane, and easily to be degraded by various enzyme in blood and unstable, so need suitable gene delivery vector antisense oligonucleotide is delivered to target cell.
Liposome is the hollow bead be made up of Lipid bilayer membranes.Just found liposome as far back as nineteen sixty-five Englishman Bangham, after this it is found that liposome has huge value as pharmaceutical carrier, it can reduce the toxicity of medicine itself and strengthen drug effect to a certain extent.The liposome medicament gone on the market at present is existing a lot, as liposome amphotericin (trade name: AmBisome), liposomal doxorubicin (Myocet) and liposomal daunorubicin (DaunoXome), these medicines all have passed the certification of FDA, listing is produced, therefore, the safety used clinically with regard to liposome has obtained certainly.1992, liposome was used for sending of ASODN by Ropert first, and had made nanometer liposome.
Nanometer liposome is a kind of targeted drug carrier, belong to a kind of novel form of targeting drug delivery system, the nanometer liposome of different-grain diameter size can accumulate in different internal organs, and most nano-lipid knows from experience passive target in liver, is conducive to MK-ASODN and plays a role in liver.
The large-scale production of injection Midkine antisense oligonucleotide nano liposome needs antisensenucleic acids and liposome can carry out large-scale production and preparation.Along with the development of automatic dna synthesizer, the single sintering amount of antisense oligonucleotide reaches 1000mmol/L, can reach the rank of large-scale production completely.And the preparation method of liposome experienced by the development of more than 20 year, have film dispersion method, reverse evaporation respectively, detergent dialysis methods, solvent injection method etc., a lot of method all can only carry out laboratory scale lab scale.
Summary of the invention
The object of the present invention is to provide a kind of extensive method preparing injection Midkine antisense oligonucleotide nano liposome, the method is mainly based upon on the basis of solvent injection method, form the process of an automatization, also overcome small scale in traditional solvent injection method, injection Midkine antisense oligonucleotide nano liposome produced according to the invention, particle diameter is between 100 ~ 500nm, stable in properties, antihepatocarcinoma effect significantly strengthens.Process is simple, easily realizes, and is very easy to amplify, and is suitable for suitability for industrialized production.
For reaching goal of the invention the technical solution used in the present invention be:
In order to realize above-mentioned object, the technical solution used in the present invention is:
The method comprises the following steps:
(1) prepare lipid soln: this lipid soln be by comprise DOPE (DOPE) and 3-β-[N-(N '; N '-dimethyl amino-ethyl)] material dissolution of carbamoyl cholesterol (DC-Chol) is in organic solvent; be stirred to solution clear; the consumption of organic solvent makes cation lipid and phospholipid just dissolve completely; obtain lipid soln; solution temperature is 20 ~ 60 DEG C
Above-mentioned raw materials molar percentage consists of: DOPE (DOPE) 5-95%, 3-β-[N-(N ', N '-dimethyl amino-ethyl)] carbamoyl cholesterol (DC-Chol) 95-5%;
(2) adopt cross-current technology make lipid soln and aquation solvent by volume 1:50 ~ 3:17 mix, the thick liposome obtained after mixing is ultrasonic by Ultrasound Instrument, preliminary dispersion, unifies particle diameter by liposome by the squeezer being covered with polycarbonate membrane by exerting pressure;
(3) liposome turbid liquor flowed out is by ultrafilter ultrafiltration, removing organic solvent, continuous supplementation liposome aquation solvent during ultrafiltration, obtain blank nanometer liposome, for subsequent use or add lyophilizing after freeze drying protectant after the nanometer liposome filtration sterilization subpackage made, liquid is in 2-8 DEG C of preservation, and dried frozen aquatic products is in less than-20 DEG C preservations;
(4) by Midkine antisense oligonucleotide (MK-ASODN) according to being dissolved in aquation solvent, obtain MK-ASODN solution, step (3) is obtained liposome solutions and MK-ASODN solution to mix according to charge ratio 1:1 ~ 5:1 or directly MK-ASODN solution is added nanometer liposome dried frozen aquatic products is mixed to get MK-ASODN nanometer liposome, wherein the sequence of MK-ASODN is CCCCGGGCCGCCCTTCTTCA.
The sequence of described MK-ASODN is that we screen effective Midkine antisense oligonucleotide: CCCCGGGCCGCCCTTCTTCA.Antisensenucleic acids for MK has different antisense activity, but the physicochemical property between them is very similar, as molecular weight is large, water solublity is high, electronegative, and all need the effect of carrier competence exertion, the technology of cross-current described in the present invention refers to that aquation solvent and lipid soln produce intersection-type collision at high speeds and form nanometer liposome, aquation solvent and lipid mixture solution are after high speed intersection-type collision, again through having the thick liposome of the ultrasonic formation of container of ultrasound wave function, preliminary dispersion, liposome also can be concentrated to suitable concentration by the organic solvent in ultrafiltration removing nanometer liposome, squeezer was used for the particle diameter of unified nanometer liposome and plays degerming effect when the aperture of film is less than 0.22um time.
Aquation solvent in described step (2) and step (4) is phosphate buffer, water, Tris buffer or citrate buffer.
In described step (4), MK-ASODN nanometer liposome pH is 4.0-9.0, and the nanometer liposome obtained is positively charged.
Organic solvent in described step (1) is the single solvent in methanol, ethanol, the tert-butyl alcohol, or the mixed solvent that two or more solvent is wherein made;
further,the aperture of the polycarbonate membrane used in described step (2) is 50 ~ 400nm, the number of plies 1 ~ 10 layer.
The liposome that described step (4) obtains is with liquid storage or be made as dried frozen aquatic products, and freeze drying protectant is lactose, trehalose, glucose, sucrose or mannitol, and frozen-dried protective agent concentration is at 5%-25%(g/ml).
describedstep (3) described Ultrasound Instrument is water bath sonicator method or Probe Ultrasonic Searching.
describedstep (3) lipid soln and aquation solvent by volume 1:49 mix.
describedstep (4) be by Midkine antisense oligonucleotide (MK-ASODN) according to being dissolved in aquation solvent, obtain MK-ASODN solution, step (3) obtained liposome solutions and MK-ASODN solution mixes according to charge ratio 1:1.
Compared with prior art, preparation method of the present invention adopts conventional equipment such as Ultrasound Instrument, ultrafilter, squeezer etc. to couple together, on the basis of solvent injection method, establish a kind of automatically can the method for large-scale production injection Midkine antisense oligonucleotide nano liposome, this liposome is made up of cation lipid, both sexes phospholipid and MK-ASODN, considerably improve the curative effect of MK-ASODN, achieve the targeting transport of MK-ASODN.
Accompanying drawing explanation
Fig. 1 is Midkine antisense oligonucleotide nano liposome Electronic Speculum figure.
Fig. 2 is Midkine antisense oligonucleotide nano liposomal particle size.
Fig. 3 is Midkine antisense oligonucleotide nano liposome encapsulation electrophoretogram.
(swimming lane 1:Mark in Fig. 3, swimming lane 2: naked ASODN, swimming lane 3:Lipo/ASODN=1:1, swimming lane 4:Lipo/ASODN=2:1, swimming lane 5:Lipo/ASODN=3:1, swimming lane 6:Lipo/ASODN=4:1, swimming lane 7:Lipo/ASODN=5:1, swimming lane 8:Lipo/ASODN=6:1.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is further described, but does not limit the invention to these detailed description of the invention.One skilled in the art would recognize that all alternatives, improvement project and the equivalents that present invention encompasses and may comprise in Claims scope.
In the present invention:
DOPE: DOPE;
DC-Chol:3-β-and [N-(N ', N '-dimethyl amino-ethyl)] carbamoyl cholesterol.
MK-ASODN: Midkine antisense oligonucleotide
Embodiment 1: preparation 100ml injection Midkine antisense oligonucleotide nano liposome
Raw material: DC-Chol100mg
DOPE100mg
MK-ASODN5.5g
Methanol+dehydrated alcohol 5ml
Glucose 8g.
Preparation method:
(1) by DC-Chol and DOPE under temperature 45 C condition, add Jia Chun ︰ dehydrated alcohol (v/v=1:1) stir, to solution clear, obtain lipid soln, be incubated under 45 DEG C of conditions;
(2) cross-current technology is adopted to make lipid soln and water rapid mixing by a certain percentage subsequently, volume ratio is less than 3:17, namely lower than 15% concentration of volume percent, by probe type ultrasonic instrument, ultrasonic (power is 200w to the liposome obtained after mixing, ultrasonic 100 times, ultrasonic 1s, interval 2s), then make liposome extrude 5 times to unify particle diameter through the squeezer of the polycarbonate membrane being covered with 1 0.1 μm by high pressure pump;
(3) liposome turbid liquor flowed out, immediately by ultrafilter ultrafiltration, removes organic solvent, middle constantly supplementing water solution, be about 5 times of volumes of liposome, obtain blank nanometer liposome, the nanometer liposome made adds lyophilizing after the glucose of 8%, in 2-8 DEG C of preservation.
(4) be dissolved in the aqueous solution of 100ml by 5.5g Midkine antisense oligonucleotide (MK-ASODN), pH is 7.0, obtains MK-ASODN solution, is directly added in dried frozen aquatic products by MK-ASODN solution, makes both fully mix by demand, usually according to charge ratio 1; 1 mixing, rebuilds in the process of liposome MK-ASODN encapsulating to enter, obtains MK-ASODN nanometer liposome.
Embodiment 2: preparation 500ml injection Midkine antisense oligonucleotide nano liposome
Raw material: DC-Chol500mg
DOPE36.44mg
MK-ASODN2.79mg
Dehydrated alcohol 10ml
Mannitol 25g.
Preparation method:
By DC-Chol and DOPE under temperature 20 DEG C of conditions, drip absolute ethyl alcohol and stirring, to solution clear, obtain lipid soln, cross-current technology is adopted to make lipid soln and phosphate buffer rapid mixing by a certain percentage subsequently, the liposome obtained after mixing by water bath sonicator (power is 120w, ultrasonic 5min), then makes liposome extrude 2 unified particle diameters through the squeezer of the polycarbonate membrane being covered with 5 0.1 μm by high pressure pump; The liposome turbid liquor flowed out is immediately by ultrafilter ultrafiltration, removing organic solvent, the middle 5 times of volumes constantly supplementing liposome hydrating fluid and be about liposome, finally obtain nanometer liposome, the nanometer liposome made adds lyophilizing after the mannitol of 5%, in-20 DEG C of preservations.Be dissolved in the phosphate buffer of 500ml by Midkine antisense oligonucleotide (MK-ASODN), pH is 7.4, obtains MK-ASODN solution, and temperature remains on 20 DEG C, is directly added in dried frozen aquatic products by MK-ASODN solution, makes both fully mix by a certain percentage.
Embodiment 3: preparation 1000ml injection Midkine antisense oligonucleotide nano liposome
Raw material: DC-Chol1000mg
DOPE72.88mg
MK-ASODN5.58mg
Methanol 20ml.
Preparation method:
By DC-Chol and DOPE under temperature 40 DEG C of conditions, add absolute ethyl alcohol and stirring, to solution clear, obtain lipid soln, cross-current technology is adopted to make lipid soln and Tris buffer by rapid mixing by a certain percentage subsequently, the liposome obtained after mixing by water bath sonicator (power is 120w, ultrasonic 10min), then makes MK-ASODN liposome unify particle diameter through the squeezer of the polycarbonate membrane being covered with 10 0.2 μm by high pressure pump; The liposome turbid liquor flowed out, immediately by ultrafilter ultrafiltration, removes organic solvent, and centre constantly supplements Tris buffer, is about 6 times of volumes of liposome, finally obtains nanometer liposome, in 2-8 DEG C of preservation; Be dissolved in Tris buffer by Midkine antisense oligonucleotide (MK-ASODN), pH is 9.0, obtains MK-ASODN solution, is directly fully mixed with nanometer liposome by a certain percentage by MK-ASODN solution, obtains MK-ASODN nanometer liposome.
Embodiment 4: preparation 5L injection Midkine antisense oligonucleotide nano liposome
Raw material: DC-Chol5000mg
DOPE6924mg
MK-ASODN1395mg
Tert-butyl alcohol 50ml
Lactose 750g.
Preparation method:
By DC-Chol and DOPE under temperature 60 C condition, add the tert-butyl alcohol to stir, to solution clear, obtain lipid soln, adopt subsequently cross-current technology make lipid soln and citrate buffer by a certain percentage rapid mixing obtain thick liposome, the thick liposome obtained after mixing by water bath sonicator (power is 120w, ultrasonic 10min), then unifies particle diameter by high pressure pump liposome through the squeezer of the polycarbonate membrane being covered with 5 0.4 μm and 5 0.1 μm; The liposome turbid liquor flowed out is immediately by ultrafilter ultrafiltration, removing organic solvent, the middle 10 times of volumes constantly supplementing liposome hydrating fluid and be about liposome, obtain blank nanometer liposome, lyophilizing after the lactose of the nanometer liposome interpolation 15% of making, in less than-20 DEG C preservations.Then MK-ASODN is dissolved in the citrate buffer of 5LpH5.0, by a certain percentage with the mixing of blank liposome dried frozen aquatic products, the MK-ASODN nanometer liposome obtained.
Embodiment 5: preparation 50L injection Midkine antisense oligonucleotide nano liposome
Raw material: DC-Chol50g
DOPE131g
MK-ASODN27919g
Dehydrated alcohol 200ml
Trehalose 2500g.
Preparation method:
By DC-Chol and DOPE under temperature 50 C condition, add diethyl ether stirring, to solution clear, obtain lipid soln, cross-current technology is adopted to make lipid soln and aqueous solution rapid mixing by a certain percentage subsequently, the liposome obtained after mixing by water bath sonicator (power is 120w, ultrasonic 20min), then makes MK-ASODN liposome unify particle diameter through the squeezer of the polycarbonate membrane being covered with 5 0.1 μm by high pressure pump; The liposome turbid liquor flowed out is immediately by ultrafilter ultrafiltration, removing organic solvent, the middle 5 times of volumes constantly supplementing liposome aquation solvent and be about liposome, obtain nanometer liposome, lyophilizing after the trehalose of the nanometer liposome interpolation 5% of making, in preserving below-20 DEG C.Be dissolved in the aqueous solution of 50L by Midkine antisense oligonucleotide (MK-ASODN), pH is 7.0, obtains MK-ASODN solution, by a certain percentage with the mixing of blank liposome dried frozen aquatic products, and the MK-ASODN nanometer liposome obtained.
Embodiment 6: preparation 50L injection Midkine antisense oligonucleotide nano liposome
Raw material: DC-Chol50g
DOPE131g
MK-ASODN0.27g
Dehydrated alcohol+tert-butyl alcohol 50ml
Sucrose 2500g.
Preparation method:
By DC-Chol and DOPE under temperature 50 C condition, add and stir Wu the Shui Yi Chun ︰ tert-butyl alcohol (v/v=4:1), to solution clear, obtain lipid soln, cross-current technology is adopted to make the PBS solution of lipid soln and pH7.4 (containing the phosphate buffer of the pH7.4 of 0.05% tween 20 subsequently, referred to as PBS-T) 5000ml mixing, obtain thick liposome, by water bath sonicator, (power is 200w to the thick liposome obtained after mixing, ultrasonic 20min), then by ultrafilter ultrafiltration, removing organic solvent, the middle 10 times of volumes constantly supplementing liposome hydrating fluid and be about liposome, blank liposome is made to unify particle diameter through the squeezer of the polycarbonate membrane being covered with 10 0.1 μm by high pressure pump again after ultrafiltration, obtain blank liposome, add lyophilizing after the trehalose of 25% again.Redissolved by the PBS of lyophilizing blank liposome 5000mlpH7.4, be dissolved in by 0.27gMK-ASODN in the PBS of 300mlpH7.4, both are rapid mixing by a certain percentage, obtains MK-ASODN nanometer liposome.
Injection Midkine antisense oligonucleotide nano liposome prepared in accordance with the present invention, antihepatocarcinoma effect significantly strengthens, safe and reliable, is suitable for suitability for industrialized production.
SEQUENCELISTING
<110> Central Hospital, Huzhou City
<120> prepares the method for injection Midkine antisense oligonucleotide nano liposome on a large scale
<130>
<150>2011101816742
<151>2011-06-29
<160>1
<170>PatentInversion3.3
<210>1
<211>20
<212>DNA
<213> Midkine
<400>1
ccccgggccgcccttcttca20
Claims (1)
1. prepare a method for injection Midkine antisense oligonucleotide nano liposome on a large scale, it is characterized in that the method comprises the following steps:
(1) prepare lipid soln: this lipid soln be by comprise DOPE (DOPE) and 3-β-[N-(N '; N '-dimethyl amino-ethyl)] material dissolution of carbamoyl cholesterol (DC-Chol) is in organic solvent; be stirred to solution clear; the consumption of organic solvent makes cation lipid and phospholipid just dissolve completely; obtain lipid soln; solution temperature is 20 ~ 60 DEG C
Above-mentioned raw materials molar percentage consists of: DOPE (DOPE) 5-95%, 3-β-[N-(N ', N '-dimethyl amino-ethyl)] carbamoyl cholesterol (DC-Chol) 95-5%;
Organic solvent is the single solvent in methanol, ethanol, the tert-butyl alcohol, or the mixed solvent that two or more solvent is wherein made;
(2) adopt cross-current technology make lipid soln and aquation solvent by volume 1:49 mix, the thick liposome obtained after mixing is ultrasonic by Ultrasound Instrument, tentatively disperses, and by exerting pressure liposome is unified particle diameter by the squeezer being covered with polycarbonate membrane; The aperture of the polycarbonate membrane used is 50 ~ 400nm, the number of plies 1 ~ 10 layer; Described Ultrasound Instrument is water bath sonicator method or Probe Ultrasonic Searching;
(3) liposome turbid liquor flowed out is by ultrafilter ultrafiltration, removing organic solvent, continuous supplementation liposome aquation solvent during ultrafiltration, obtain blank nanometer liposome, for subsequent use or add lyophilizing after freeze drying protectant after the nanometer liposome filtration sterilization subpackage made, liquid is in 2-8 DEG C of preservation, and dried frozen aquatic products is in less than-20 DEG C preservations;
(4) by Midkine antisense oligonucleotide (MK-ASODN) according to being dissolved in aquation solvent, obtain MK-ASODN solution, step (3) is obtained liposome solutions and MK-ASODN solution to mix according to charge ratio 1:1 or directly MK-ASODN solution is added nanometer liposome dried frozen aquatic products is mixed to get MK-ASODN nanometer liposome, wherein the sequence of MK-ASODN is CCCCGGGCCGCCCTTCTTCA, MK-ASODN nanometer liposome pH is 4.0-9.0, and the nanometer liposome obtained is positively charged;
The liposome obtained is with liquid storage or be made as dried frozen aquatic products, and freeze drying protectant is lactose, trehalose, glucose, sucrose or mannitol, and frozen-dried protective agent concentration is at 5%-25%g/ml;
Aquation solvent in wherein said step (2) and step (4) is phosphate buffer, water, Tris buffer or citrate buffer;
MK-ASODN nanometer liposome pH is 4.0-9.0;
The nanometer liposome obtained is positively charged;
The particle size distribution of described nanometer liposome is 100-500nm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210226878.8A CN102989007B (en) | 2011-06-29 | 2012-06-29 | The extensive method preparing injection Midkine antisense oligonucleotide nano liposome |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110181674.2 | 2011-06-29 | ||
| CN201110181674 | 2011-06-29 | ||
| CN201210226878.8A CN102989007B (en) | 2011-06-29 | 2012-06-29 | The extensive method preparing injection Midkine antisense oligonucleotide nano liposome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102989007A CN102989007A (en) | 2013-03-27 |
| CN102989007B true CN102989007B (en) | 2015-12-16 |
Family
ID=47918436
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210226878.8A Active CN102989007B (en) | 2011-06-29 | 2012-06-29 | The extensive method preparing injection Midkine antisense oligonucleotide nano liposome |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102989007B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104043134A (en) * | 2014-06-30 | 2014-09-17 | 广州市军科泰特医药科技有限公司 | Nano-liposome as well as preparation method and application thereof |
| CA3225573A1 (en) * | 2021-07-08 | 2023-01-12 | Nippon Shinyaku Co., Ltd. | Precipitation suppressing agent |
| WO2023282345A1 (en) * | 2021-07-08 | 2023-01-12 | 日本新薬株式会社 | Nephrotoxicity reducing agent |
| WO2023282344A1 (en) * | 2021-07-08 | 2023-01-12 | 日本新薬株式会社 | Nephrotoxicity reducing agent |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1796557A (en) * | 2004-12-28 | 2006-07-05 | 湖州市中心医院 | Structure and application of antisense oligonucleotide with gene of mid-range factor as target |
| CN101716352A (en) * | 2008-12-25 | 2010-06-02 | 湖州市中心医院 | Antisense oligonucleotide nano preparation resisting middle-period factor, preparation and application thereof |
-
2012
- 2012-06-29 CN CN201210226878.8A patent/CN102989007B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1796557A (en) * | 2004-12-28 | 2006-07-05 | 湖州市中心医院 | Structure and application of antisense oligonucleotide with gene of mid-range factor as target |
| CN101716352A (en) * | 2008-12-25 | 2010-06-02 | 湖州市中心医院 | Antisense oligonucleotide nano preparation resisting middle-period factor, preparation and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 脂质体载药方法的研究进展;程冀 等;《中药饮片质量分析与中药鉴别技术交流研讨会论文集》;20090821;174-178页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102989007A (en) | 2013-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102989007B (en) | The extensive method preparing injection Midkine antisense oligonucleotide nano liposome | |
| CN103834002B (en) | Based on sensitivity to acid Zorubicin prodrug and preparation method thereof and the application of polyoxyethylene glycol | |
| CN110551709B (en) | Nano cellulose based 3D printed lactic acid bacteria embedding material and preparation method and application thereof | |
| CN104434791B (en) | A kind of preparation of modified bletilla polysaccharide derivates nanometer carrier and application technology | |
| CN106265514B (en) | A kind of doxorubicin hydrochloride magnetic nano particle and preparation method thereof | |
| EP2022853A1 (en) | Freeze-dried product for transferring nucleic acid, oligonucleic acid or derivative thereof | |
| CN102370620A (en) | Pulmonic targeting immuno nano liposome and preparation method thereof | |
| CN107213116A (en) | It is a kind of to improve the method that liposome carries doxorubicin hydrochloride content | |
| CN102772802A (en) | Oleanolic acid nanoliposome modified by chitosan and polyethylene glycol and preparation method thereof | |
| CN107638388B (en) | Asiatic acid chitosan deoxycholic acid graft micelle and preparation method thereof | |
| CN106798726B (en) | A kind of targeting carries medicine silica nodule and preparation and application | |
| CN103554296B (en) | A kind of linolic acid modified glucan and prepare the method for polymeric liposome | |
| CN114668856A (en) | Application of beta-cyclodextrin mediated immune cell-drug loaded liposome couplet in resisting atherosclerosis | |
| CN102657880A (en) | Quaternized chitosan/siRNA (small interfering Ribonucleic Acid) composite particles and preparation method thereof | |
| CN101062417A (en) | Method for preparing gene medication carrier by using chitosan modified liposome | |
| CN101015699A (en) | Polyethylene glycol-phosphatidyl ethanolamine polymer or medicinal acid addition salt and application thereof in pharmacy | |
| CN102558569B (en) | Lipopolysaccharide amine cationic polymer and preparation method and application thereof | |
| CN102526756A (en) | Adriamycin composite, micelle and preparation method for micelle | |
| CN103877593B (en) | Based on the kidney targeting supermolecule and preparation method thereof of catechol beautify chitosan | |
| CN109662956A (en) | A kind of application of the chitosan drug-loading nano particle of oleanolic acid grafting | |
| CN113712897A (en) | Soluble microneedle-mediated alkannin-carrying transdermal drug delivery system and preparation thereof | |
| CN104840422A (en) | Long circulating ceramose and preparation method thereof | |
| CN103006560B (en) | Hyaluronic acid oligosaccharide encased paclitaxel liposome and preparation method thereof | |
| CN107362135B (en) | Rhein intravenous injection lipid microbubble and preparation method thereof | |
| CN102335160B (en) | Photosensitive medicament patch and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CP02 | Change in the address of a patent holder | ||
| CP02 | Change in the address of a patent holder |
Address after: 313000 no.1558, Sanhuan North Road, Huzhou City, Zhejiang Province Patentee after: HUZHOU CENTER Hospital Address before: 313000 No. 198 Hongqi Road, Zhejiang, Huzhou Patentee before: HUZHOU CENTER Hospital |