CN102965370A - Method and special primer for identifying gene mutation of sodium ion channel of plutella xylostella - Google Patents
Method and special primer for identifying gene mutation of sodium ion channel of plutella xylostella Download PDFInfo
- Publication number
- CN102965370A CN102965370A CN2012105377819A CN201210537781A CN102965370A CN 102965370 A CN102965370 A CN 102965370A CN 2012105377819 A CN2012105377819 A CN 2012105377819A CN 201210537781 A CN201210537781 A CN 201210537781A CN 102965370 A CN102965370 A CN 102965370A
- Authority
- CN
- China
- Prior art keywords
- sequence
- single strand
- genotype
- strand dna
- dna shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method and a special primer for identifying gene mutation of a sodium ion channel of plutella xylostella. A primer compound disclosed by the invention is formed by a primer compound A and a primer compound B, wherein the primer compound A is formed by single-chain DNA (Deoxyribonucleic Acid) molecules represented by sequence 1, sequence 2, sequence 3, sequence 4 and sequence 5; and the primer compound B is formed by single-chain DNA (Deoxyribonucleic Acid) molecules represented by sequence 6, sequence 7, sequence 8, sequence 9 and sequence 10. According to a special primer compound disclosed by the invention, Kdr(knockdown resistance) related para type sodium ion channel gene mutation (T929I mutation and L1014F mutation) of plutella xylostella can be effectively identified; and with regard to the monitoring of a resistance gene frequency to synthetic pyrethroid insecticides by plutella xylostella field population and a drug resistance generation development trend to the synthetic pyrethroid insecticides, a plutella xylostella preventing strategy is adjusted in time and the method has the important meanings of guiding reasonable drug use and delaying resistance development.
Description
Technical field
The present invention relates to identify method and the primer special of the sudden change of small cabbage moth (Plutella xylostella) paravoltage dependent sodium channel gene, be specifically related to identify the L1014F sudden change of the relevant para type paravoltage dependent sodium channel gene of small cabbage moth kdr and method and the primer special thereof that T929I suddenlys change, method provided by the invention and primer special can be used for monitoring small cabbage moth to the resistance of pyrethroid medicament.
Background technology
Pyrethroid (pyrethroids) is the insecticides that biological activity is strong, Environmental compatibility is high that has after organochlorine, organophosphorus and carbamate, since its have knock down fast, virulence is strong, insecticidal spectrum is wide, toxicity is low and the residual advantage such as few, in the control of Agricultural pests, forestry pest and sanitary insect pest, be widely used.Along with chrysanthemum ester class medicament in worldwide continuously, a large amount of and be widely used, many controlling objects are all because huge selective pressure and it has been produced serious resistance.
Kdr(knockdown resistance) in housefly, finds the earliest.1951, Busvine observes adult housefly quick paralysis and the toxic action of DDT and pyrethroid insecticides is shown resistance, thereafter, Milani has carried out genetic analysis to it, think that the gene of this resistance of control is positioned on the housefly III karyomit(e), be the knock down resistance gene (kdr gene) of recessiveness, and this resistance is called " knock down resistance ".1978, Sawicki etc. find that again the housefly strain that Deltamethrin is produced more than 500 times of resistance has super knock down resistance gene (super-kdr gene).
Sodium-ion channel belongs to voltage-gated channel, the instantaneous permeability of main regulating cell film sodium ion, participating in forming the rising phase of cytolemma action potential, have vital role in the conduction of nerve excitability signal, is pyrethroid and the pharmaceutically-active molecular target of many neurotoxicities.
After finding that housefly " knock down resistance " was relevant with the sudden change of para type sodium channel gene (Vsscl) in 1996, directly in homology sodium channel gene sequence, 20 point mutation that resistance is relevant have been found at the para of other 13 kinds of insects so far.Mutational site in the Super-kdr gene is M918T/L1014F in housefly, is T929I/L1014F in small cabbage moth, is T929I/L932F in the pediculus humanus capitis.
China occupies the huge chrysanthemum ester class medicament market share, be chrysanthemum ester class medicament mainly answer one of land used, and chrysanthemum ester class medicament is widely used in the control of small cabbage moth, so the monitoring small cabbage moth is significant for instructing rational use of drug, delaying drug resistance development to the resistance situation of such medicament, particularly on molecular level, China's field small cabbage moth chrysanthemum ester class medicament fastness frequency is detected, can be practical application more reliable foundation is provided.Since Allele specific PCR molecular engineering (PASA) fast effectively, can process large quantities of samples, can also distinguish SS, RR and heterozygote RS, so be applied in the detection of insect resistance site mutation.
Summary of the invention
The purpose of this invention is to provide a kind of method and primer special of identifying the sudden change of small cabbage moth paravoltage dependent sodium channel gene.
The invention provides a kind of primer sets compound (primer sets compound third), formed by primer sets compound first and primer sets compound second; Described primer sets compound first is comprised of the single strand dna shown in the sequence 5 of the single strand dna shown in the sequence 4 of the single strand dna shown in the sequence 3 of the single strand dna shown in the sequence 2 of the single strand dna shown in the sequence 1 of sequence table, sequence table, sequence table, sequence table and sequence table; Described primer sets compound second is comprised of the single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 9 of the single strand dna shown in the sequence 8 of the single strand dna shown in the sequence 7 of the single strand dna shown in the sequence 6 of sequence table, sequence table, sequence table, sequence table and sequence table.
Described primer sets compound third can be used for following (a) and (b): identify that (a) small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 12992nd Nucleotide; (b) identify that small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide.
Described primer sets compound third can be used for preparing test kit; The purposes of described test kit is following (a) and (b): identify that (a) small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 12992nd Nucleotide; (b) identify that small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide.
The present invention also protects primer sets compound first, is comprised of the single strand dna shown in the sequence 5 of the single strand dna shown in the sequence 4 of the single strand dna shown in the sequence 3 of the single strand dna shown in the sequence 2 of the single strand dna shown in the sequence 1 of sequence table, sequence table, sequence table, sequence table and sequence table.
Described primer sets compound first can be used for identifying that small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 12992nd Nucleotide.
It is the CC genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 12992nd Nucleotide that the present invention also protects a kind of evaluation small cabbage moth; the genotypic method of TT genotype or CT (method first); comprise the steps: that genomic dna take small cabbage moth to be measured is as template; with the single strand dna shown in the sequence 1 of sequence table; single strand dna shown in the sequence 5 of the single strand dna shown in the sequence 2 of sequence table and sequence table carries out first group of quantitative fluorescent PCR; with the single strand dna shown in the sequence 3 of sequence table; single strand dna shown in the sequence 5 of the single strand dna shown in the sequence 4 of sequence table and sequence table carries out second group of quantitative fluorescent PCR; if the solubility curve of first group of quantitative fluorescent PCR does not have peak small cabbage moth to be measured at the solubility curve that has 1 peak and second group of quantitative fluorescent PCR between 75-80 ℃ between 75-80 ℃ be the CC genotype; if the solubility curve of second group of quantitative fluorescent PCR does not have peak small cabbage moth to be measured at the solubility curve that has 1 peak and first group of quantitative fluorescent PCR between 75-80 ℃ between 75-80 ℃ be the TT genotype, be the CT genotype if the solubility curve of first group of quantitative fluorescent PCR has 1 peak small cabbage moth to be measured at the solubility curve that has 1 peak and second group of quantitative fluorescent PCR between 75-80 ℃ between 75-80 ℃.
The present invention also protects primer sets compound second, is comprised of the single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 9 of the single strand dna shown in the sequence 8 of the single strand dna shown in the sequence 7 of the single strand dna shown in the sequence 6 of sequence table, sequence table, sequence table, sequence table and sequence table.
Described primer sets compound second can be used for identifying that small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide.
It is the CC genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide that the present invention also protects a kind of evaluation small cabbage moth; the genotypic method of TT genotype or CT (method second); comprise the steps: that genomic dna take small cabbage moth to be measured is as template; with the single strand dna shown in the sequence 6 of sequence table; single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 7 of sequence table and sequence table carries out first group of quantitative fluorescent PCR; with the single strand dna shown in the sequence 8 of sequence table; single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 9 of sequence table and sequence table carries out second group of quantitative fluorescent PCR; if the solubility curve of first group of quantitative fluorescent PCR does not have peak small cabbage moth to be measured at the solubility curve that has 1 peak and second group of quantitative fluorescent PCR between 70-80 ℃ between 70-80 ℃ be the CC genotype; if the solubility curve of second group of quantitative fluorescent PCR does not have peak small cabbage moth to be measured at the solubility curve that has 1 peak and first group of quantitative fluorescent PCR between 70-80 ℃ between 70-80 ℃ be the TT genotype, be the CT genotype if the solubility curve of first group of quantitative fluorescent PCR has 1 peak small cabbage moth to be measured at the solubility curve that has 1 peak and second group of quantitative fluorescent PCR between 70-80 ℃ between 70-80 ℃.
Described primer sets compound first can be used for identifying that small cabbage moth is to the resistance of pyrethroid insectide (pyrethroid insecticides).
Described method first can be used for identifying that small cabbage moth is to the resistance of pyrethroid insectide (pyrethroid insecticides).The genotypic small cabbage moth of TT is higher than the genotypic small cabbage moth of CC and the genotypic small cabbage moth of CT to the resistance of pyrethroid insectide (pyrethroid insecticides).
Described primer sets compound second can be used for identifying that small cabbage moth is to the resistance of pyrethroid insectide (pyrethroid insecticides).
Described method second can be used for identifying that small cabbage moth is to the resistance of pyrethroid insectide (pyrethroid insecticides).The genotypic small cabbage moth of TT is higher than the genotypic small cabbage moth of CC and the genotypic small cabbage moth of CT to the resistance of pyrethroid insectide (pyrethroid insecticides).
Described primer sets compound third can be used for identifying that small cabbage moth is to the resistance of pyrethroid insectide (pyrethroid insecticides).From 5 ' terminal the 12992nd Nucleotide, the genotypic small cabbage moth of TT is higher than the genotypic small cabbage moth of CC and the genotypic small cabbage moth of CT to the resistance of pyrethroid insectide (pyrethroid insecticides) for paravoltage dependent sodium channel gene.From 5 ' terminal the 14197th the genotypic small cabbage moth of Nucleotide TT the resistance of pyrethroid insectide (pyrethroid insecticides) is higher than the genotypic small cabbage moth of CC and the genotypic small cabbage moth of CT for paravoltage dependent sodium channel gene.
More than arbitrary described paravoltage dependent sodium channel gene specifically can be following 1) or 2) or 3) dna molecular:
1) dna molecular shown in the sequence 14 in the sequence table;
2) under stringent condition with 1) dna molecular with albumen of identical function of the dna sequence dna hybridization that limits and coding;
3) with 1) or 2) dna sequence dna that limits has the dna molecular that 90% above homology and coding have the albumen of identical function.
Above-mentioned stringent condition can be at 6 * SSC, in the solution of 0.5%SDS, hybridizes under 65 ° of C, then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively to wash film once.
Specific primer pair thing provided by the invention can effectively identify the relevant para type paravoltage dependent sodium channel gene sudden change of small cabbage moth kdr (T929I sudden change and L1014F sudden change), thereby judge that small cabbage moth is for resistance or the susceptibility of pyrethroid insecticides, have fast effectively, highly sensitive, can process the advantage of large quantities of samples, for monitoring small cabbage moth field population to the resistance gene frequency of pyrethroid insecticides and dynamic to pyrethroid insecticides resistance genesis, in time adjust the small cabbage moth control strategy, instruct rational use of drug, the delaying drug resistance development is significant.
Description of drawings
Fig. 1 is the solubility curve of quantitative fluorescent PCR.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.Used test materials among the following embodiment if no special instructions, is and purchases available from routine biochemistry reagent shop.Quantitative test in following examples all arranges repeated experiments three times, results averaged.
Carrier PUC57: give birth to worker's biotechnology (Shanghai) limited-liability company product, catalog number (Cat.No.): SD0171.
The preparation of embodiment 1, template
With the small cabbage moth of pyrethroid medicament sensitivity is compared, the kdr that the pyrethroid medicament is had the small cabbage moth of resistance is correlated with, and (genomic dna of this gene is shown in the sequence 14 of sequence table for para type paravoltage dependent sodium channel gene, protein shown in the sequence 13 of code sequence tabulation) in two coding mutations have occured, namely this gene sports T(from 5 ' terminal the 12992nd Nucleotide by C and causes the respective egg white matter to sport Isoleucine from N-terminal the 877th amino acids residue by Threonine; The T929I sudden change), the 14197th Nucleotide sports T(by C and causes the respective egg white matter to sport phenylalanine from N-terminal the 962nd amino acids residue by leucine; The L1014F sudden change).
1, the double chain DNA molecule shown in the sequence 11 of composition sequence table, and be inserted between the StuI and SmaI restriction enzyme site of carrier PUC57, responsive plasmid obtained.
2, the double chain DNA molecule shown in the sequence 12 of composition sequence table, and be inserted between the StuI and SmaI restriction enzyme site of carrier PUC57, r plasmid obtained.
The design of embodiment 2, primer
Sequences Design allelespecific-PCR primer according to the relevant para type paravoltage dependent sodium channel gene of mutant small cabbage moth kdr.
Comprise the T929I sudden change in the target sequence of primer SF929 and primer R929,3 ' of primer SF929 holds first Nucleotide (seeing the underscore mark) consistent with the Nucleotide before the sudden change, and primer CSF929 is the reverse complementary sequence of primer SF929.Comprise the T929I sudden change in the target sequence of primer RF929 and primer R929,3 ' of primer RF929 holds first Nucleotide (seeing the underscore mark) consistent with the Nucleotide after the sudden change, and primer CRF929 is the reverse complementary sequence of primer RF929.
Comprise the L1014F sudden change in the target sequence of primer SF1014 and primer R1014,3 ' of primer SF1014 holds first Nucleotide (seeing the underscore mark) consistent with the Nucleotide before the sudden change, and primer CSF1014 is the reverse complementary sequence of primer SF1014.Comprise the L1014F sudden change in the target sequence of primer RF1014 and primer R1014,3 ' of primer RF1014 holds first Nucleotide (seeing the underscore mark) consistent with the Nucleotide after the sudden change, and primer CRF1014 is the reverse complementary sequence of primer RF1014.
The nucleotide sequence of each primer sees Table 1.
The nucleotide sequence of each primer of table 1
| Primer | Sequence (5'-3') |
| SF929 | GCCTTGGGCAACCTGA C(sequence 1) |
| CSF929 | GTCAGGTTGCCCAAGGC(sequence 2) |
| RF929 | GCCTTGGGCAACCTGA T(sequence 3) |
| CRF929 | ATCAGGTTGCCCAAGGC(sequence 4) |
| R929 | CACTCCCACCAATTTCACTTAC(sequence 5) |
| SF1014 | CGTCGTCATTGGCAAC C(sequence 6) |
| CSF1014 | GGTTGCCAATGACGACG(sequence 7) |
| RF1014 | CCGTCGTCATTGGCAAC T(sequence 8) |
| CRF1014 | AGTTGCCAATGACGACGG(sequence 9) |
| R1014 | CTCAAACCAGGGCAAACAC(sequence 10) |
The application of embodiment 3, primer
Respectively take the responsive plasmid of embodiment 1 preparation or r plasmid as template; adopt the primer sets compound that primer SF929, primer CSF929 and primer R929 form (T929I suddenly change responsive primer sets compound), in ABI 7500 quantitative real time PCR Instruments, carry out pcr amplification.The pcr amplification system sees Table 2.
Table 2PCR amplification system (20 μ l)
Respectively take the responsive plasmid of embodiment 1 preparation or r plasmid as template; the primer sets compound (T929I sudden change resistance primer sets compound) that adopts primer RF929, primer CRF929 and primer R929 to form carries out pcr amplification in ABI 7500 quantitative real time PCR Instruments.The pcr amplification system sees Table 3.
Table 3PCR amplification system (20 μ l)
Respectively take the responsive plasmid of embodiment 1 preparation or r plasmid as template; adopt the primer sets compound that primer SF1014, primer CSF1014 and primer R1014 form (L1014F suddenly change responsive primer sets compound), in ABI 7500 quantitative real time PCR Instruments, carry out pcr amplification.The pcr amplification system sees Table 4.
Table 4PCR amplification system (20 μ l)
Respectively take the responsive plasmid of embodiment 1 preparation or r plasmid as template; the primer sets compound (L1014F sudden change resistance primer sets compound) that adopts primer RF1014, primer CRF1014 and primer R1014 to form carries out pcr amplification in ABI 7500 quantitative real time PCR Instruments.The pcr amplification system sees Table 5.
Table 5PCR amplification system (20 μ l)
More than each individual system reaction conditions of carrying out quantitative fluorescent PCR all see Table 6.
Each individual system of table 6 is carried out the reaction conditions of quantitative fluorescent PCR
When being 65 ℃, annealing temperature the results are shown in Figure 1.Figure 1A is for take responsive plasmid or r plasmid as template, adopt T929I to suddenly change solubility curve figure that responsive primer sets compound carries out the fluorescent quantitation amplification.Figure 1B is for take responsive plasmid or r plasmid as template, the solubility curve figure that adopts T929I sudden change resistance primer sets compound to carry out the fluorescent quantitation amplification.Fig. 1 C is for take responsive plasmid or r plasmid as template, adopt L1014F to suddenly change solubility curve figure that responsive primer sets compound carries out the fluorescent quantitation amplification.Fig. 1 D is for take responsive plasmid or r plasmid as template, the solubility curve figure that adopts L1014F sudden change resistance primer sets compound to carry out the fluorescent quantitation amplification.
Take responsive plasmid as template, carry out quantitative fluorescent PCR with the T929I responsive primer sets compound that suddenlys change, melt curve analysis has a typical spike at about 77 ℃.Take r plasmid as template, carry out quantitative fluorescent PCR with the T929I responsive primer sets compound that suddenlys change, melt curve analysis is background level, does not see obvious peak at 77 ℃.Therefore the described T929I applicable detection that the T929I sudden change does not occur of responsive primer sets compound that suddenlys change.
Take r plasmid as template, carry out quantitative fluorescent PCR with T929I sudden change resistance primer sets compound, melt curve analysis has a typical spike at about 77 ℃.Take responsive plasmid as template, carry out quantitative fluorescent PCR with T929I sudden change resistance primer sets compound, melt curve analysis is background level, does not see obvious peak at 77 ℃.The applicable detection that the T929I sudden change occurs of therefore described T929I sudden change resistance primer sets compound.
Take responsive plasmid as template, carry out quantitative fluorescent PCR with the L1014F responsive primer sets compound that suddenlys change, melt curve analysis has a typical spike at about 75 ℃.Take r plasmid as template, carry out quantitative fluorescent PCR with the L1014F responsive primer sets compound that suddenlys change, melt curve analysis is background level, does not see obvious peak at 75 ℃.Therefore the described L1014F applicable detection that the L1014F sudden change does not occur of responsive primer sets compound that suddenlys change.
Take r plasmid as template, carry out quantitative fluorescent PCR with L1014F sudden change resistance primer sets compound, melt curve analysis has a typical spike at about 75 ℃.Take responsive plasmid as template, carry out quantitative fluorescent PCR with L1014F sudden change resistance primer sets compound, melt curve analysis is background level, does not see obvious peak at 75 ℃.The applicable detection that the L1014F sudden change occurs of therefore described L1014F sudden change resistance primer sets compound.
The result shows: T929I suddenlys change responsive primer sets compound to only responsive plasmid being increased, and its melt curve analysis has a typical spike about 77 ℃ greatly; The L1014F responsive primer sets compound that suddenlys change only increases to responsive template, and its melt curve analysis has a typical spike about 75 ℃ greatly; A T929I sudden change resistance primer sets compound antagonism template increases, and its melt curve analysis has a typical spike about 77 ℃ greatly; L1014F sudden change resistance primer sets compound can only the antagonism template increase, and its melt curve analysis has a typical spike about 75 ℃ greatly.Above-mentioned responsive primer sets compound and resistance primer sets compound can be distinguished allelotrope well, select corresponding special primer composition to be used for the detection of T929I and L1014F allelic mutation, namely can detect specifically small cabbage moth and whether the pyrethroid medicament produced resistance.
Will be identify that through the pyrethroid medicament (responsive to the pyrethroid medicament) and order-checking identify the small cabbage moth extraction genomic dna of (be the CC genotype and be the CC genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide from 5 ' terminal the 12992nd Nucleotide for paravoltage dependent sodium channel gene), with genomic dna as template, and carrying out according to the method described above quantitative fluorescent PCR, each result is consistent with the result of responsive plasmid.
Will be identify that through the pyrethroid medicament (the pyrethroid medicament is had resistance) and order-checking identify the small cabbage moth extraction genomic dna of (be the TT genotype and be the TT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide from 5 ' terminal the 12992nd Nucleotide for paravoltage dependent sodium channel gene), with genomic dna as template, and carrying out according to the method described above quantitative fluorescent PCR, each result is consistent with the result of r plasmid.
Claims (10)
1. the primer sets compound is comprised of primer sets compound first and primer sets compound second;
Described primer sets compound first is comprised of the single strand dna shown in the sequence 5 of the single strand dna shown in the sequence 4 of the single strand dna shown in the sequence 3 of the single strand dna shown in the sequence 2 of the single strand dna shown in the sequence 1 of sequence table, sequence table, sequence table, sequence table and sequence table;
Described primer sets compound second is comprised of the single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 9 of the single strand dna shown in the sequence 8 of the single strand dna shown in the sequence 7 of the single strand dna shown in the sequence 6 of sequence table, sequence table, sequence table, sequence table and sequence table.
2. the described primer sets compound of claim 1 is at following (a) with the application (b):
(a) identify that small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 12992nd Nucleotide;
(b) identify that small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide.
3. the application of the described primer sets compound of claim 1 in the preparation test kit; The purposes of described test kit is following (a) and (b):
(a) identify that small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 12992nd Nucleotide;
(b) identify that small cabbage moth is CC genotype, TT genotype or CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide.
4. primer sets compound first is comprised of the single strand dna shown in the sequence 5 of the single strand dna shown in the sequence 4 of the single strand dna shown in the sequence 3 of the single strand dna shown in the sequence 2 of the single strand dna shown in the sequence 1 of sequence table, sequence table, sequence table, sequence table and sequence table.
5. the described primer sets compound of claim 4 first is identifying that small cabbage moth is application in CC genotype, TT genotype or the CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 12992nd Nucleotide.
6. identify that small cabbage moth is the CC genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 12992nd Nucleotide for one kind, the genotypic method of TT genotype or CT, comprise the steps: that genomic dna take small cabbage moth to be measured is as template, with the single strand dna shown in the sequence 1 of sequence table, single strand dna shown in the sequence 5 of the single strand dna shown in the sequence 2 of sequence table and sequence table carries out first group of quantitative fluorescent PCR, with the single strand dna shown in the sequence 3 of sequence table, single strand dna shown in the sequence 5 of the single strand dna shown in the sequence 4 of sequence table and sequence table carries out second group of quantitative fluorescent PCR, if the solubility curve of first group of quantitative fluorescent PCR does not have peak small cabbage moth to be measured at the solubility curve that has 1 peak and second group of quantitative fluorescent PCR between 75-80 ℃ between 75-80 ℃ be the CC genotype, if the solubility curve of second group of quantitative fluorescent PCR does not have peak small cabbage moth to be measured at the solubility curve that has 1 peak and first group of quantitative fluorescent PCR between 75-80 ℃ between 75-80 ℃ be the TT genotype, be the CT genotype if the solubility curve of first group of quantitative fluorescent PCR has 1 peak small cabbage moth to be measured at the solubility curve that has 1 peak and second group of quantitative fluorescent PCR between 75-80 ℃ between 75-80 ℃.
7. primer sets compound second is comprised of the single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 9 of the single strand dna shown in the sequence 8 of the single strand dna shown in the sequence 7 of the single strand dna shown in the sequence 6 of sequence table, sequence table, sequence table, sequence table and sequence table.
8. primer sets compound second is identifying that small cabbage moth is application in CC genotype, TT genotype or the CT genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide.
9. identify that small cabbage moth is the CC genotype for paravoltage dependent sodium channel gene from 5 ' terminal the 14197th Nucleotide for one kind, the genotypic method of TT genotype or CT, comprise the steps: that genomic dna take small cabbage moth to be measured is as template, with the single strand dna shown in the sequence 6 of sequence table, single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 7 of sequence table and sequence table carries out first group of quantitative fluorescent PCR, with the single strand dna shown in the sequence 8 of sequence table, single strand dna shown in the sequence 10 of the single strand dna shown in the sequence 9 of sequence table and sequence table carries out second group of quantitative fluorescent PCR, if the solubility curve of first group of quantitative fluorescent PCR does not have peak small cabbage moth to be measured at the solubility curve that has 1 peak and second group of quantitative fluorescent PCR between 70-80 ℃ between 70-80 ℃ be the CC genotype, if the solubility curve of second group of quantitative fluorescent PCR does not have peak small cabbage moth to be measured at the solubility curve that has 1 peak and first group of quantitative fluorescent PCR between 70-80 ℃ between 70-80 ℃ be the TT genotype, be the CT genotype if the solubility curve of first group of quantitative fluorescent PCR has 1 peak small cabbage moth to be measured at the solubility curve that has 1 peak and second group of quantitative fluorescent PCR between 70-80 ℃ between 70-80 ℃.
10. claim 6 and 8 described methods are being identified small cabbage moth to the application in the resistance of pyrethroid insectide, or the described primer sets compound of claim 1 is identifying that small cabbage moth is to the application in the resistance of pyrethroid insectide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210537781.9A CN102965370B (en) | 2012-12-12 | 2012-12-12 | Method and special primer for identifying gene mutation of sodium ion channel of plutella xylostella |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210537781.9A CN102965370B (en) | 2012-12-12 | 2012-12-12 | Method and special primer for identifying gene mutation of sodium ion channel of plutella xylostella |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102965370A true CN102965370A (en) | 2013-03-13 |
| CN102965370B CN102965370B (en) | 2014-06-25 |
Family
ID=47795806
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210537781.9A Expired - Fee Related CN102965370B (en) | 2012-12-12 | 2012-12-12 | Method and special primer for identifying gene mutation of sodium ion channel of plutella xylostella |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102965370B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624278A (en) * | 2014-12-01 | 2016-06-01 | 南京农业大学 | Molecular detection method for target resistance of plutella xylostella to sodium ion channel blocking agent |
| CN112342299A (en) * | 2020-10-27 | 2021-02-09 | 海南大学 | Method for identifying gene mutation of liriomyza trifoliata sodium ion channel and special primer |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6207425B1 (en) * | 1997-09-11 | 2001-03-27 | City Of Hope | Bidirectional PCR amplification of specific alleles |
| CN102382876A (en) * | 2010-08-30 | 2012-03-21 | 高希武 | Method for detecting avermectin pesticide resistance produced by diamondback moth |
-
2012
- 2012-12-12 CN CN201210537781.9A patent/CN102965370B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6207425B1 (en) * | 1997-09-11 | 2001-03-27 | City Of Hope | Bidirectional PCR amplification of specific alleles |
| CN102382876A (en) * | 2010-08-30 | 2012-03-21 | 高希武 | Method for detecting avermectin pesticide resistance produced by diamondback moth |
Non-Patent Citations (3)
| Title |
|---|
| DEOK HO KWON ET AL.: "Estimation of knockdown resistance in diamondback moth using real-time PASA", 《PESTICIDE BIOCHEMISTRY AND PHYSIOLOGY》 * |
| 王建军 等: "南京小菜蛾对拟除虫菊酯的抗性机制", 《植物保护学报》 * |
| 赵丽萍: "小菜蛾（Plutella xylostella）击倒抗性基因频率的龄期、季节及地方变化", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105624278A (en) * | 2014-12-01 | 2016-06-01 | 南京农业大学 | Molecular detection method for target resistance of plutella xylostella to sodium ion channel blocking agent |
| CN105624278B (en) * | 2014-12-01 | 2018-11-23 | 南京农业大学 | Molecular detecting method of the diamondback moth to Na-ion channel blocker target resistance |
| CN112342299A (en) * | 2020-10-27 | 2021-02-09 | 海南大学 | Method for identifying gene mutation of liriomyza trifoliata sodium ion channel and special primer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102965370B (en) | 2014-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Harbort et al. | Root-secreted coumarins and the microbiota interact to improve iron nutrition in Arabidopsis | |
| Sabart et al. | Spatiotemporal variations in microcystin concentrations and in the proportions of microcystin-producing cells in several Microcystis aeruginosa populations | |
| EP2934093B1 (en) | Stable transformation of a population and a method of biocontainment using haploinsufficiency and underdominance principles | |
| Marshall et al. | Detection of kdr pyrethroid resistance in the cotton aphid, Aphis gossypii (Hemiptera: Aphididae), using a PCR-RFLP assay | |
| Takano et al. | Spread of glyphosate‐resistant sourgrass (Digitaria insularis): Independent selections or merely propagule dissemination? | |
| CN102965370B (en) | Method and special primer for identifying gene mutation of sodium ion channel of plutella xylostella | |
| Zhang et al. | A single-nucleotide-polymorphism-based genotyping assay for simultaneous detection of different carbendazim-resistant genotypes in the Fusarium graminearum species complex | |
| Miao et al. | Activity and resistance-related point mutations in target protein PcORP1 of fluoxapiprolin in Phytophthora capsici | |
| Guan et al. | Multiple origins of a single point mutation in the cotton bollworm tetraspanin gene confers dominant resistance to Bt cotton | |
| Chang | Genome‐wide nucleotide variation distinguishes Aspergillus flavus from Aspergillus oryzae and helps to reveal origins of atoxigenic A. flavus biocontrol strains | |
| Li et al. | Characterization of HMW glutenin subunit Bx7OE and its distribution in common wheat and related species | |
| CN102952889B (en) | Method and special primer of method for fast identifying plutella xylostella ryanodine receptor gene mutation | |
| Hernández et al. | Diverse mating phenotypes impact the spread of wtf meiotic drivers in Schizosaccharomyces pombe | |
| CN102864220B (en) | Method for identifying nucleotide point mutation of rhizoctonia solani Sdh gene and drug resistance of rhizoctonia solani Sdh gene to thifluzamide | |
| Chatzidimopoulos et al. | Development of a two-step high-resolution melting (HRM) analysis for screening sequence variants associated with resistance to the QoIs, benzimidazoles and dicarboximides in airborne inoculum of Botrytis cinerea | |
| CN103725784B (en) | Fast detection method of kdr (Knockdown Resistance) caused by mutation of tetranychus cinabarinus boisdu F1538I | |
| CN104313177A (en) | Molecular detection method for rapidly identifying carbendazim-resistant genotype-F200Y botrytis cinerea strain | |
| CN103820563B (en) | A kind of method based on LAMP technology rapid detection derosal high resistance sclerotinite bacterial strain | |
| CN109971654A (en) | Common big thrips biocontrol microorganisms gradually narrow Lecanicillium lecanii SCAUDCL-53 and its application | |
| Ayala-Usma et al. | Genome-wide association study identifies single nucleotide polymorphism markers associated with mycelial growth (at 15, 20, and 25 C), mefenoxam resistance, and mating type in Phytophthora infestans | |
| CN109797124A (en) | One strain insect disinfestations performance is good, environmentally safe thuringiensis and its application | |
| Lohmar et al. | Gene drive by Fusarium SKC1 is dependent on its competing allele | |
| Brasier | Genetics of pathogenicity in Ceratocystis ulmi and its significance for elm breeding | |
| CN105132568A (en) | Primers for rapidly identifying sodium ion channel gene mutation L925I of bemisia tabaci and application of primers | |
| Surana et al. | Interchromosomal transfer of immune regulation during infection of barley with the powdery mildew pathogen |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140625 Termination date: 20151212 |
|
| EXPY | Termination of patent right or utility model |