CN102965290A - Pichia kudriavzevii ZJPH0802 and application thereof in preparation of curcumin derivatives - Google Patents
Pichia kudriavzevii ZJPH0802 and application thereof in preparation of curcumin derivatives Download PDFInfo
- Publication number
- CN102965290A CN102965290A CN2012104784733A CN201210478473A CN102965290A CN 102965290 A CN102965290 A CN 102965290A CN 2012104784733 A CN2012104784733 A CN 2012104784733A CN 201210478473 A CN201210478473 A CN 201210478473A CN 102965290 A CN102965290 A CN 102965290A
- Authority
- CN
- China
- Prior art keywords
- zjph0802
- pichia kudriavzevii
- transformation
- curcumine
- curcumin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses Pichia kudriavzevii ZJPH0802 and an application thereof in preparation of curcumin derivatives. The strain is collected in China Center for Type Culture Collection (CCTCC), the address is Wuhan University, Wuhan, China, the collection data is September 24, 2012, and the collection number is CCTCC M 2012373. The invention provides a new strain, namely the Pichia kudriavzevii ZJPH0802 for preparing the curcumin derivatives by biotransformation, and structural modification can be performed on curcumin by utilizing a strain resting cell transformation method for obtaining the corresponding derivatives; the pharmacological or biological activity of structurally modified matters of the curcumin can be improved to different extents relative to a curcumin substrate before modification so as to be conductive to development of new pharmaceutical preparations. The technology for obtaining the curcumin derivatives by adopting the biotransformation method, disclosed by the invention, is simpler and environment-friendly, a biological catalyst is a microbial thallus, and the Pichia kudriavzevii ZJPH0802 further has the advantages of self-fermentation and production, stable quality and low cost.
Description
(1) technical field
The present invention relates to the new curcumine of a strain and transform bacterial strain----pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802, and prepare application in the curcumin derivate in microbial transformation.
(2) background technology
Curcumine is orange-yellow crystalline powder, flavor is slightly bitter, is insoluble in water, is dissolved in the organic solvents such as ethanol, propylene glycol, be soluble in Glacial acetic acid and basic solution, being sorrel when alkalescence, being yellow when neutral and acid, is a kind of hydrophobicity polyphenolic substance, there is one special 1, the basic framework of 7-diaryl heptane is comprised of two methylated phenol of neighbour and a beta-diketon, and molecular formula is C
21H
20O
6Wherein the beta-diketon structure has enol-keto tautomerism, mainly exists with keto-acid (1) structure in acid and neutral solution, and mainly exists with enol form (2) Stability Analysis of Structures in basic solution.
The chemical structural formula of curcumine is:
The biological activitys such as that curcumine has is anti-oxidant, anti-inflammatory, reducing blood-fat, atherosclerosis, anticancer, anti-HIV, can be used for treating tetter, diabetes, rheumatic arthritis, cyst cystic fibrosis, acquired immune deficiency syndrome (AIDS) and kinds cancer etc., and its molecular weight is little, toxicity is low, has good clinical application potentiality.But the poorly water-soluble of curcumine, structural instability are restricted its application in the food and medicine field, and its selectivity is low, drug effect is lasting, by the ability that body absorbs, and cause its bioavailability low, and these deficiencies have limited its clinical application.Present many scholars have synthesized more curcumin derivate and analogue, and their physico-chemical property and biological activity are carried out detecting and assessing, but utilize the microorganism cells method for transformation less to the report that curcumine carries out structural modification.The employings such as Xing Zhang directly add curcumine in zhizopchin (Rhizopus chinensis) nutrient solution grown cultures conversion method obtains curcumin derivate (Biocatalysis and Biotransformation, September – December 2010; 28 (5 – 6): 380 – 386).The present invention adopts pichia kudriavzevii conversion of resting cells method, not only Effective Raise transformation efficiency, also can effectively control the composition of conversion fluid, to adapt to the top condition of substrate conversion; Reduce simultaneously medium component to the impact of biotransformation, be convenient to later separation and the purification of converted product.Bacterial classification of the present invention is easily cultivated, and the preparation cost that contains the enzyme source cell is low, and the conversion reaction time of curcumine substrate can shorten greatly.The structural modification that adopts biotransformation method to carry out natural product has the advantages such as selectivity is good, high specificity, and living things system can produce the different enzyme of multiple nature and function, thereby but catalysis curcumine substrate conversion generates the series derivates with different replacement modes, be expected to therefrom to find active better or have the compound of new texture, significant for " structure activity relationship " of this compounds of research.
(3) summary of the invention
The object of the invention provides new curcumine microbial transformation bacterial strain-----pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 of a strain, and utilizes this bacterial strain to transform the method for preparing curcumin derivate.
The technical solution used in the present invention is:
The invention provides new curcumine microbial transformation bacterial strain-----the pichia kudriavzevii ZJPH0802 (Pichia kudriavzevii ZJPH0802) of a strain, be preserved in Chinese Typical Representative culture collection center, address: Wuhan, China Wuhan University, preservation date: on September 24th, 2012, deposit number: CCTCC M 2012373.
The bacterial classification source: pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 bacterial strain system separation screening from pick up from Hangzhou Zhejiang Polytechnical University (morning sunlight school district) soil sample obtains.
Described pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 screens acquisition as follows:
Soil sample collection → dull and stereotyped cultivation → strain separating → slant culture → seed culture →
Fermentation culture → bioconversion reaction → liquid chromatographic detection product → acquisition purpose bacterial strain
The feature of described pichia kudriavzevii ZJPH0802 bacterial strain is as follows:
Colonial morphology: dull and stereotyped upper 30 ℃ of cultivation 48 h of wort, it is irregularly shaped that bacterium colony is, oyster white, surface drying, coarse, loose, flat, the edge indentation.
Cellular form: oval type or sausage type, periphery sprout, and pseudohypha is arranged, 1 ~ 2 thecaspore.
Physiological and biochemical property: utilizable carbon source has: D-Glucose, Pfansteihl, succsinic acid, ethanol.Unavailable carbon source has: D-wood sugar, L-arabinose, melizitose, maltose, starch, Xylitol, cellobiose, D-semi-lactosi, L-rhamnosyl, saligenin, L-sorbose.Utilizable nitrogenous source has: 1B, ethamine.Unavailable nitrogenous source has: nitrate, nitrite, creatine, creatinine.
Identify: the 26S rDNA D1/D2 region sequence characteristic of this bacterial classification: take the total DNA of the cell that extracts as template, utilize the gene by the 26S rDNA D1/D2 district of primer NL1 and NL4 amplification bacterial strain, again the PCR product is carried out 1% agarose gel electrophoresis.Confirmed by sequencing the kudriavzevii Pichia (Pichia， Kudriavzevii)， ZJPH0802 the 26S， RDNA， D1/D2 region sequence is as follows:GCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTTTGCGGCACGAGTTGTAGATTGCAGGTTGGAGTCTGTGTGGAAGGCGGTGTCCAAGTCCCTTGGAACAGGGCGCCCAGGAGGGTGAGAGCCCCGTGGGATGCCGGCGGAAGCAGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGCGCCCGACATGGGGATTGCGCACCGCTGCCTCTCGTGGGCGGCGCTCTGGGCTTTCCCTGGGCCAGCATCGGTTCTTGCTGCAGGAGAAGGGGTTCTGGAACGTGGCTCTTCGGAGTGTTATAGCCAGGGCCAGATGCTGCGTGCGGGGACCGAGGACTGCGGCCGTGTAGGTCACGGATGCTGGCAGAACGGCGCAACACCGCCCGTC
It is No.KC143811 that this sequence has been submitted the GenBank(GenBank accession number to), (http://www.ncbi.nlm.nih.gov) carries out sequence analysis (BLAST) in the NCBI website with the 26S rDNA D1/D2 region sequence of ZJPH0802 bacterial strain, and the result shows: the part bacterial strain sequence homology of ZJPH0802 bacterial strain and Pichia (Pichia sp.) is higher.The sequence homology of ZJPH0802 bacterial strain and Pichia kudriavzevii DMic 113897 bacterial strains (the GenBank accession number is No.JN032661.1) reaches 100%.
According to physio-biochemical characteristics and binding molecule biological assay, this bacterial strain is accredited as pichia kudriavzevii, called after pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802.
The invention still further relates to described pichia kudriavzevii ZJPH0802 and prepare application in the curcumin derivate in bio-transformation, described being applied as: the wet thallus that obtains take pichia kudriavzevii ZJPH0802 fermentation culture is as the enzyme source, take curcumine as substrate, in the phosphoric acid buffer liquid medium, carry out conversion reaction, reaction is carried out aftertreatment with conversion reaction liquid after finishing, and obtains described curcumin derivate.
Usually, described phosphoric acid buffer is pH value 5.8 ~ 8.0 phosphoric acid buffers.
Further, the post-treating method of described conversion reaction liquid is: after reaction finishes that conversion fluid is centrifugal, get the supernatant liquor ethyl acetate extraction, and ethyl acetate is removed in the extraction liquid underpressure distillation, get residue and carry out silica gel column chromatography, TLC follows the tracks of detection, collects R
fValue is 0.424 or 0.712 o'clock elutriant, and steaming desolventizes, and obtains described curcumin derivate.
Further, described pichia kudriavzevii ZJPH0802 preferably carries out as follows in the application that bio-transformation prepares in the curcumin derivate: at the enzyme source cell, curcumine, in the transformation system that phosphoric acid buffer consists of, the wet thallus that obtains take pichia kudriavzevii ZJPH0802 fermentation culture is as the enzyme source, take curcumine as substrate, be in the transformation system of 5.8 ~ 8.0 phosphoric acid buffers in the pH value, at 20 ~ 40 ℃, carry out conversion reaction under 150 ~ 220 rpm conditions, after reaction finishes, conversion reaction liquid is centrifugal, get the supernatant liquor ethyl acetate extraction, ethyl acetate is removed in the extraction liquid underpressure distillation, get residue and carry out silica gel column chromatography, TLC follows the tracks of detection, collects R
fValue is 0.424 or 0.712 elutriant, and steaming desolventizes, and obtains described curcumin derivate.
Further, the consumption of the wet thallus that described pichia kudriavzevii ZJPH0802 fermentation culture obtains is counted 20 ~ 150 g/L transformation systems with dry cell weight, and the starting point concentration of described curcumine substrate is 20 ~ 250 mg/L transformation systems.
Further, the consumption of the wet thallus that described pichia kudriavzevii ZJPH0802 fermentation culture obtains is counted 20 ~ 100 g/L transformation systems with dry cell weight, the starting point concentration of described substrate is 20 ~ 180 mg/L transformation systems, and the conversion reaction time is 2 ~ 24 h.
Optimum, the enzyme source, substrate, placing the pH value is that 5.8 ~ 8.0 phosphoric acid buffers consist of transformation system, and invert point is 30 ℃, and shaking speed is 200 rpm, and the conversion reaction time is 16 h.
Further, described enzyme source prepares as follows:
(1) slant culture: pichia kudriavzevii ZJPH0802 is seeded to slant medium, cultivated 2 ~ 3 days for 30 ℃, obtain the inclined-plane thalline, the final concentration of described slant medium consists of and adds 20 g agar, natural pH value in every liter of wort;
(2) seed culture: select a ring thalline from the inclined-plane thalline and be seeded to the seed culture medium, cultivate 16 h at 30 ℃, 200 rpm, obtain seed liquor; Described seed culture medium final concentration consists of: glucose 15 ~ 40 g/L, yeast extract paste 1 ~ 3 g/L, NH
4Cl 3 ~ 8 g/L, MgSO
47H
2O 0.1 ~ 0.5 g/L, KH
2PO
40.2 ~ 1.5 g/L, K
2HPO
40.2 ~ 1.5 g/L, pH 5 ~ 8, and solvent is water;
(3) fermentation culture: with volumetric concentration 5 ~ 15% inoculum sizes seed liquor is inoculated in the fermention medium, 30 ℃, 200 rpm fermentation culture, 24 h, fermentation culture is centrifugal, collect wet thallus, namely obtain described enzyme source; Described fermention medium final concentration forms the described seed culture medium final concentration of same step (2) and forms.
The medium optimization that is used for fermentation culture in the preparation process of enzyme of the present invention source is: glucose 25 ~ 35 g/L, yeast extract paste 1.5 ~ 2.5 g/L, NH
4Cl 5.5 ~ 6.5 g/L, MgSO
47H
2O 0.3 ~ 0.5 g/L, KH
2PO
40.5 ~ 1.2 g/L, K
2HPO
40.5 ~ 1.2 g/L, pH 5 ~ 8, and solvent is water, most preferably are glucose 25 g/L, yeast extract paste 2.5 g/L, NH
4Cl 5.5 g/L, MgSO
4.7H
2O 0.4 g/L, KH
2PO
41g/L, K
2HPO
41g/L, pH 6.5, and solvent is water.
Further, described pichia kudriavzevii ZJPH0802 prepares in the curcumin derivate in bio-transformation and uses, being specially the application that transforms the preparation hexahydrocurcumin carries out as follows: it is that 6.2 ~ 7.4 phosphoric acid buffers consist of transformation system that the wet thallus that pichia kudriavzevii ZJPH0802 fermentation culture is obtained and curcumine place the pH value, at 30 ℃, carry out conversion reaction 16 h under the 200 rpm conditions, after reaction finishes, conversion fluid is centrifugal, get supernatant liquor ethyl acetate extraction three times, merge all extraction liquids, be evaporated to the dried ethyl acetate of removing, get residue and carry out silica gel column chromatography after with the chromatogram dissolve with methanol, take the methylene dichloride of volume ratio 100:1 and methyl alcohol mixed liquor as eluent, the TLC method is followed the tracks of and is detected, and collects R
fValue is 0.712 o'clock elutriant, elutriant is steamed in 80 ℃ of lower water-baths desolventize, and obtains described curcumin derivate, i.e. hexahydrocurcumin; The consumption of the wet thallus that described pichia kudriavzevii ZJPH0802 fermentation culture obtains is counted 20 ~ 100 g/L transformation systems with dry cell weight, and the starting point concentration of described curcumine substrate is 20 ~ 180 mg/L transformation systems.
Further, described pichia kudriavzevii ZJPH0802 prepares in the curcumin derivate in bio-transformation and uses, being specially the application that transforms the preparation tetrahydro curcumin carries out as follows: it is that 6.2 ~ 7.4 phosphoric acid buffers consist of transformation system that the wet thallus that pichia kudriavzevii ZJPH0802 fermentation culture is obtained and curcumine place the pH value, at 30 ℃, carry out conversion reaction 16 h under the 200 rpm conditions, after reaction finishes, conversion fluid is centrifugal, get supernatant liquor ethyl acetate extraction three times, merge all extraction liquids, be evaporated to the dried ethyl acetate of removing, get residue and carry out silica gel column chromatography after with the chromatogram dissolve with methanol, take the methylene dichloride of volume ratio 50:1 and methyl alcohol mixed liquor as eluent, the TLC method is followed the tracks of and is detected, and collects R
fValue is 0.424 elutriant, elutriant is steamed in 80 ℃ of lower water-baths desolventize, and obtains described curcumin derivate, i.e. tetrahydro curcumin; The consumption of the wet thallus that described pichia kudriavzevii ZJPH0802 fermentation culture obtains is counted 20 ~ 100 g/L transformation systems with dry cell weight, and the starting point concentration of described curcumine substrate is 20 ~ 180 mg/L transformation systems.
The conversion reaction liquid (experimental group) that after the bio-transformation of pichia kudriavzevii ZJPH0802 wet thallus, obtains of the present invention, at first carry out the analysis of TLC method, with the curcumine standard substance, only add substrate in the control group 1(conversion reaction system, do not add the enzyme source, replenish volume with damping fluid) and control group 2(conversion reaction system in do not add substrate, only add the enzyme source, replenish volume with damping fluid) contrast, whether the conversion fluid of determining experimental group produces new spot, if produce new spot, then that conversion fluid is centrifugal, get the supernatant liquor ethyl acetate extraction, extraction liquid is evaporated to dried, gets enriched material chromatogram dissolve with methanol, carry out HPLC after micro-filtration (0.45 μ m) is processed and analyze, determine whether to occur the New Characteristics peak (with the curcumine standard substance, control group 1 is compared with control group 2).If there is the New Characteristics peak, the conversion fluid that obtains after the bio-transformation is centrifugal, get the supernatant liquor ethyl acetate extraction, will carry out silica gel column chromatography behind the extraction liquid concentrating under reduced pressure, collect R
fValue is 0.712 effluent liquid, removes eluent, obtains one of described curcumin derivate; Collect R
fValue is 0.424 effluent liquid, removes eluent, obtains two of described curcumin derivate.Adopt respectively its purity of high-efficient liquid phase chromatogram technique analysis.Get purity and carry out high performance liquid chromatography and mass spectrometry detection (LC-MS) in the component more than 95%,
1H-NMR and
13C-NMR detects, and identifies its structure.
Beneficial effect of the present invention is mainly reflected in: the invention provides new bacterial strain-----the pichia kudriavzevii ZJPH0802 that a strain bio-transformation prepares curcumin derivate, and utilize this bacterial strain conversion of resting cells method that curcumine is carried out structural modification, obtain thus corresponding derivative.Curcumine substrate before the pharmacology of curcumine structural modification thing or biological activity are modified has improvement in various degree, is conducive to the exploitation of medicine new preparation; It is simpler that the present invention adopts microbial conversion process to obtain the technique of curcumin derivate, environmental friendliness, and biological catalyst is microbial cells, fermentative production voluntarily, steady quality, with low cost.
(4) description of drawings
Fig. 1 the present invention utilizes pichia kudriavzevii ZJPH0802 microbial transformation to prepare the schema of curcumin derivate.
The TLC collection of illustrative plates synoptic diagram of Fig. 2 embodiment 1 curcumine converted product: 1 is control group 2 samples, and 2 is the experimental group sample, and 3 is control group 1 sample, and 4 is the curcumine standard substance; A, b are the spot that the curcumine converted product of pichia kudriavzevii ZJPH0802 bacterial strain produces; C is the spot that control group 1 sample produces; D is the spot of curcumine standard substance.
The HPLC collection of illustrative plates of Fig. 3 embodiment 1 curcumine converted product: a is the curcumine standard substance; B is control group 1 sample; C is the experimental group sample; D is control group 2 samples; The time of 1-peak, peak 6 correspondences is respectively t
1=23 min, t
2=25 min, t
3=26 min, t
4=27 min, t
5=54min, t
6=62 min, t
Curcumine=66 min.
Fig. 4 embodiment 1 curcumine converted product 3(t=26 min) one-level mass spectrum (MS).
Fig. 5 embodiment 1 curcumine converted product 3(t=26 min) three grades of mass spectrum (MS
3).
Nucleus magnetic hydrogen spectrum figure Fig. 6 embodiment 1 curcumine converted product 3(t=26 min) (
1H-NMR).
Fig. 7 embodiment 1 curcumine converted product 6(t=62 min) one-level mass spectrum (MS).
Fig. 8 embodiment 1 curcumine converted product 6(t=62 min) three grades of mass spectrum (MS
3).
Nucleus magnetic hydrogen spectrum figure Fig. 9 embodiment 1 curcumine converted product 6(t=62min) (
1H-NMR).
(5) embodiment
The present invention is described further below in conjunction with specific embodiment, but protection scope of the present invention is not limited in this:
Embodiment 1: the preparation of curcumin derivate
(1) slant culture: pichia kudriavzevii ZJPH0802 is seeded to slant medium, cultivated 3-5 days, and namely obtained slant strains for 30 ℃; Described slant medium is malt extract medium, and final concentration consists of: add 20 g agar in every liter of wort (deriving from Hangzhou Brewery), natural pH sterilized 20 minutes for 121 ℃, cooling, bevel after the sterilization;
(2) seed culture: be seeded to the 250 mL shaking flasks that 100 mL seed culture mediums are housed from step (1) inclined-plane thalline picking one ring thalline, 30 ℃, 200 rpm are cultivated 16 h, prepare seed liquor; Described seed culture medium final concentration is: glucose 25 g/L, yeast extract paste 2.5 g/L, NH
4Cl 5.5 g/L, KH
2PO
41 g/L, K
2HPO
41 g/L, MgSO
47H
2O 0.4 g/L, solvent are water, 6.5,121 ℃ of sterilizations of pH 20 minutes, cooling after the sterilization;
(3) fermentation culture: seed liquor is inoculated in the 250 mL shaking flasks that 100 mL fermention mediums are housed with volumetric concentration 10% inoculum size, 30 ℃, 200 rpm are cultivated 24 h, obtain fermented liquid, and are centrifugal, collect wet thallus; The same step of described fermention medium final concentration (2) seed culture medium final concentration forms;
(4) bio-transformation:
Experimental group: with the wet thallus 0.1M of step (3) acquisition, after the phosphate buffered saline buffer washing of pH 6.5, wet thallus is moved into 0.1 M, in the phosphate buffered saline buffer of pH 6.5, add simultaneously the curcumine substrate and consist of transformation system, the curcumine starting point concentration is 50 mg/L, and the wet thallus dosage is counted 50 g/L with dry cell weight.
With each group laboratory sample conversion reaction 16 h under 30 ℃, 200 rpm conditions, after reaction finishes, with the centrifugal thalline of removing of conversion fluid, supernatant liquor ethyl acetate extraction three times, combining extraction liquid, be evaporated to the dried ethyl acetate of removing in 50 ℃, it is to be detected after with the chromatogram dissolve with methanol that each organizes enriched material.
(5) analyzing and testing
1. thin-layer chromatography detects (TLC): draw respectively a certain amount of experimental group sample, control group 1 sample, control group 2 samples and curcumine standard substance with the capillary microcap, point sample is on preactivated silica gel thin-layer plate respectively, developing agent is methylene dichloride: methyl alcohol=50:1(v/v), under 254 nm ultraviolet lamps, the experimental group sample is compared with control sample and standard substance, adopt the rear observation of volumetric concentration 10 % ethanol solution of sulfuric acid spraying colour developing whether to produce new spot.
2. high performance liquid chromatography detects (HPLC): use first 0.45 μ m filtering with microporous membrane before all samples sample detection, experimental group sample spectrogram and control group 1 sample, control group 2 samples and curcumine standard substance are compared, observe new material peak whether occurs.
Chromatographic column is ZORBAX Eclipse XDB-C
18(5 μ m, 250 * φ, 4.6 mm, Aglient), detect wavelength: 260 nm, flow velocity: 0.5 mL/min, sample size: 20 μ L, moving phase: acetonitrile-0.1 % acetic acid aqueous solution, condition of gradient elution such as following table 1:
Table 1. HPLC condition of gradient elution
The experimental group sample detects two new spots of appearance through TLC and (sees the a(R among Fig. 2
fValue is 0.712) and b(R
fValue is 0.424) shown in), the HPLC method detects and obtains six microbial transformation products (shown in the 1-peak, peak 6 among Fig. 3), and wherein the HPLC collection of illustrative plates shows product 3(t=26 min, R when namely TLC detects
fValue is 0.424 o'clock spot that occurs) and product 6(t=62 min, R when namely TLC detects
fValue is 0.712 o'clock spot that occurs) peak area higher, content is more, is two of pichia kudriavzevii ZJPH0802 bacterial strain main curcumine converted products.
(6) separation and purification of converted product:
Utilize silica gel column chromatography that above-mentioned two main curcumine converted products (being the enriched material of conversion fluid behind centrifugal, extraction, concentrating under reduced pressure) are separated.Eluent is methylene dichloride: methyl alcohol (100:1; 50:1 (v/v)) gradient elution, the silica gel particle diameter is the 100-200 order, the silica gel model is gross porosity ZCX II; Adopt wet method dress post, take by weighing 60 g silica gel and be loaded in the chromatography column of diameter 2 cm, applied sample amount (being above-mentioned enriched material) is 0.5 g, and flow rate control is at 2 mL/min; Elutriant is followed the tracks of with TLC and is detected, and collects R
fValue is 0.424 o'clock elutriant, detects purity (the same step of testing conditions (5)) with the HPLC method, through separation and purification, obtains product 3(t=26 min); Collect R
fValue is 0.712 o'clock elutriant, detects purity (the same step of testing conditions (5)) with the HPLC method, through separation and purification, obtains product 6(t=62min), carry out respectively LC-MS,
1H-NMR and
13C-NMR detects, and it is carried out Structural Identification.
High performance liquid chromatography and mass spectrometry detect (LC-MS): sheath gas velocity (arb): 20; Assisted gas flow velocity (arb): 20; Spray voltage (kv): 3.5; Capillary temperature (℃): 275.
Through identifying, infer this converted product 3(t=26 min) be hexahydrocurcumin, its structural formula is:
This compound has following physico-chemical property: white crystals, infer that its molecular formula is C
21H
26O
6.Obtain [M+H+NH by high-resolution EI-MS
3]
+Be 392, [M-H]
-Be 373, therefore, it is 374 that deducibility goes out its molecular weight, in (+) EI-MS, two main molecular ion peaks also occur, [M+H]
+Be 375, [M+H-H
2O]
+Be 357.Molecular ion peak fracture with m/z 357 obtains three grades of mass spectrum (MS
3), its m/z is respectively 339,177, and 163.Shown in Figure 4 and 5.
1H-NMR result is:
1H-NMR (MeOD): δ=6.77 (2H, s, H-2'); δ=6.70 (2H, dd, H-5'); δ=6.62 (2H, d, H-6'); δ=4.02 (H, m, H-3); δ=3.84 (3H, s, H-OCH
3); δ=3.83 (3H, s, H-OCH
3); δ=2.78 (4H, m, H-4,6); δ=2.60 (4H, m, H-1,7); δ=1.71 (2H, m, H-2) as shown in Figure 6.
Through identifying, infer converted product 6(t=62 min) be tetrahydro curcumin, its structural formula is:
This compound has following physico-chemical property: faint yellow crystallization, infer that its molecular formula is C
21H
24O
6, obtain [M+H] by high-resolution EI-MS
+Be 373, [M-H]
-Be 371, therefore, it is 372 that deducibility goes out its molecular weight, in (+) EI-MS, a main molecular ion peak also occurs, [M+H-H
2O]
+Be 355.Molecular ion peak fracture with m/z 355 obtains three grades of mass spectrum (MS
3), its m/z is respectively 219,179,177,163,137, shown in Fig. 7 and 8.
1H-NMR result is:
1H-NMR (CDCl
3), δ=6.85 (2H, d, H-5'); δ=6.70 (2H, s, H-2'); δ=6.67 (2H, d, H-6'); δ=5.48 (2H, m, H-OH); δ=3.85 (6H, s, H-OCH
3); δ=3.50 (2H, s, H-4); δ=2.85-2.88 (4H, m, H-2,6); δ=2.55-2.58 (4H, m, H-1,7), as shown in Figure 9.
It is reported (Naito M, Wu X, Nomura H, Kodama M, Kato Y, Kato Y, et al. The protective effects of tetrahydrocurcumin on oxidative stress in cholesterol-fed rabbits. J Atheroscler Thromb 2002; 9:243 – 50; Murugan P, Pari L. Effect of tetrahydrocurcumin on plasma antioxidants in streptozotocin-nicotinamide experimental diabetes. J Basic Clin Physiol Pharmacol 2006; 17:231 – 44; Murugan P, Pari L. Antioxidant effect of tetrahydrocurcumin in streptozotocin-nicotinamide induced diabetic rats. Life Sci 2006; 79:1720 – 8; Somparn P, Phisalaphong C, Nakornchai S, Unchern S, Morales NP. Comparative antioxidant activities of curcumin and its demethoxy and hydrogenated derivatives. Biol Pharm Bull 2007; 30:74 – 8.), the biology of hexahydrocurcumin and tetrahydro curcumin and pharmacologically active have all obtained larger improvement than the curcumine substrate, for example: the ability of the anti-LDL oxidation of tetrahydro curcumin is higher than curcumine, and it can also more effectively suppress than curcumine the peroxidation of erythrocyte membrane lipid.Within suffering from the diabetes rat body, tetrahydro curcumin can be regulated better than curcumine the function of kidney and liver, and can regulate better blood sugar concentration and plasma insulin level, therefore, tetrahydro curcumin has the effect of better treatment diabetes than curcumine.In addition, the anti-oxidant activity of hexahydrocurcumin and tetrahydro curcumin all increases than curcumine, and its anti-oxidant activity sequentially is tetrahydro curcumin〉hexahydrocurcumin〉curcumine.
Embodiment 2: the orthogonal optimization of fermention medium component
Table 2 fermention medium quadrature factor water-glass
Utilize pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 bacterial strain, carry out slant culture and seed culture by the method for embodiment 1 after, press the testing program of table 2 design and optimize glucose, yeast extract paste, NH in the fermention medium
4Cl and MgSO
47H
2The concentration of O.50 mL, 0.1 M is equipped with in the adding of wet thallus after the fermentation, and in the 250 mL triangular flasks of pH 6.5 phosphoric acid buffers (the wet thallus add-on is counted 50 g/L with dry cell weight), substrate curcumine concentration is 50 mg/L, and in 30 ℃, 200 rpm transform 16 h.After reaction finishes, the centrifugal thalline of removing, get supernatant liquor, supernatant liquor ethyl acetate extraction three times, combining extraction liquid is removed ethyl acetate in 50 ℃ of underpressure distillation, and is to be detected behind the residue usefulness chromatogram dissolve with methanol, calculate product 6(t=62 min according to area normalization method) productive rate, the results are shown in Table 3 and table 4.
Table 3 fermention medium orthogonal test L
9 (3
4) result
Annotate: K '
i=K
i/ n
The variance analysis of table 4 fermention medium orthogonal test
According to variance analysis, MgSO
47H
2O affects product 6(t=62 min) the comparatively significant factor of yield, according to shown in the table 3, the best proportioning of four factors is A
1B
3C
1D
2, i.e. glucose concn 25 g/L, yeast extract paste concentration 2.5 g/L, NH
4Cl concentration 5.5 g/L, MgSO
4.7H
2O concentration 0.4 g/L.When the fermention medium that adopts this proportioning was cultivated, the thalline of gathering in the crops reached 72.4% to the yield that curcumine is converted into product 6.
Utilize pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 bacterial strain, press the method for embodiment 1 after fermentation culture, 50 mL 0.1M are equipped with in the wet thallus adding, in the 250 mL triangular flasks of pH 6.5 phosphoric acid buffers (wet thallus is counted 50 g/L with dry cell weight), substrate curcumine final concentration is respectively shown in 20 mg/L, 50 mg/L, 180 mg/L, the 250 mg/L(tables 5), respectively at 30 ℃, 200 rpm transform 16 h.After reaction finishes, with the centrifugal thalline of removing of conversion fluid, get supernatant liquor, supernatant liquor ethyl acetate extraction three times, combining extraction liquid is evaporated to dried in 50 ℃, get enriched material with to be detected behind the chromatogram dissolve with methanol, detection method is with embodiment 1 step (5), calculates product 6(t=62 min according to area normalization method) yield, the results are shown in Table 5.
The different concentration of substrate of table 5 are on converted product 6(t=62 min) impact of yield
Conclusion: as shown in Table 5, better substrate mass concentration is 50 mg/L.
Utilize pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 bacterial strain, press the method for embodiment 1 after fermentation culture, 50 mL 0.1M are equipped with in the wet thallus adding, in the 250 mL triangular flasks of pH 6.5 phosphoric acid buffers (wet thallus is counted 20 g/L, 50 g/L, 100 g/L and 150 g/L with dry cell weight) (shown in the table 6), substrate curcumine final concentration is respectively 50 mg/L, respectively at 30 ℃, 200 rpm transform 16 h.After reaction finishes, with the centrifugal thalline of removing of conversion fluid, get supernatant liquor, supernatant liquor ethyl acetate extraction three times, combining extraction liquid is evaporated to dried in 50 ℃, get enriched material with to be detected behind the chromatogram dissolve with methanol, detection method is with embodiment 1 step (5), calculates product 6(t=62 min according to area normalization method) yield, the results are shown in Table 6.
The different cell concentrations of table 6 are on the impact of pichia kudriavzevii ZJPH0802 activity of conversion
| Embodiment | Cell concentration/(g/L) | |
| 7 | 20 | 73.8 |
| 8 | 50 | 74.4 |
| 9 | 100 | 65.3 |
| 10 | 150 | 60.0 |
Conclusion: as known from Table 6, better cell concentration is 50 g/L.
Embodiment 11 ~ 16 pH values are on the impact of pichia kudriavzevii ZJPH0802 activity of conversion
Utilize pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 bacterial strain, press the method for embodiment 1 after fermentation culture, 50 mL 0.1M are equipped with in the wet thallus adding, pH is respectively in the 250 mL triangular flasks of 5.8 ~ 8.0 phosphoric acid buffers (shown in the table 7) (the wet thallus final concentration is 50 g/L), substrate curcumine concentration is 50 mg/L, in 30 ℃, 200 rpm transform 16 h.After reaction finishes, the centrifugal thalline of removing, get supernatant liquor, supernatant liquor ethyl acetate extraction three times, combining extraction liquid is evaporated to the dried ethyl acetate of removing, get enriched material with to be detected behind the chromatogram dissolve with methanol, detection method is with embodiment 1 step (5), calculates product 6(t=62 min according to area normalization method) yield, the results are shown in Table 7.
The different pH of table 7 are on converted product 6(t=62 min) impact of yield
| | pH | Product | 6 yield/% |
| 11 | 5.8 | 48.2 | |
| 12 | 6.2 | 65.6 | |
| 13 | 6.5 | 74.2 | |
| 14 | 7.0 | 73.1 | |
| 15 | 7.4 | 72.6 | |
| 16 | 8.0 | 71.3 |
Conclusion: as can be seen from Table 7, better pH is 6.5.
Embodiment 17 ~ 20 invert points are on the impact of pichia kudriavzevii ZJPH0802 activity of conversion
Utilize pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 bacterial strain, press the method for embodiment 1 after fermentation culture, 50 mL 0.1M are equipped with in the wet thallus adding, in the 250 mL triangular flasks of pH 6.5 phosphoric acid buffers (the wet thallus final concentration is 50 g/L), substrate curcumine concentration is 50 mg/L, in 25 ~ 40 ℃ (shown in tables 8), 200 rpm transform 16 h.After reaction finishes, the centrifugal thalline of removing, get supernatant liquor, supernatant liquor ethyl acetate extraction three times, combining extraction liquid is evaporated to the dried ethyl acetate of removing, get enriched material with to be detected behind the chromatogram dissolve with methanol, detection method is with embodiment 1 step (5), calculates product 6(t=62 min according to area normalization method) yield, the results are shown in Table 8.
The different invert points of table 8 are on converted product 6(t=62 min) impact of yield
| Embodiment | Temperature/℃ | Productive rate/% |
| 17 | 25 | 65.1 |
| 18 | 30 | 74.6 |
| 19 | 35 | 72.5 |
| 20 | 40 | 66.8 |
Conclusion: as shown in Table 8, better invert point is 30 ℃.
Embodiment 21 ~ 24 shaking speed are on the impact of pichia kudriavzevii ZJPH0802 activity of conversion
Utilize pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 bacterial strain, press the method for embodiment 1 after fermentation culture, 50 mL 0.1M are equipped with in the wet thallus adding, in the 250 mL triangular flasks of pH 6.5 phosphoric acid buffers (the wet thallus final concentration is 50 g/L), substrate curcumine concentration is 50 mg/L, in 30 ℃, shown in 150 ~ 220 rpm(tables 9) conversion 16 h.After reaction finishes, the centrifugal thalline of removing, get supernatant liquor, supernatant liquor ethyl acetate extraction three times, combining extraction liquid is evaporated to the dried ethyl acetate of removing, get enriched material with to be detected behind the chromatogram dissolve with methanol, detection method is with embodiment 1 step (5), calculates product 6(t=62 min according to area normalization method) yield, the results are shown in Table 9.
The different shaking speed of table 9 are on converted product 6(t=62 min) impact of yield
| Embodiment | Shaking speed/rpm | Productive rate/% |
| 21 | 150 | 63.2 |
| 22 | 180 | 70.5 |
| 23 | 200 | 74.1 |
| 24 | 220 | 67.3 |
Conclusion: as known from Table 9, better shaking speed is 200 rpm.
Utilize pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 bacterial strain, press the method for embodiment 1 after fermentation culture, 50 mL 0.1M are equipped with in the wet thallus adding, in the 250 mL triangular flasks of pH 6.5 phosphoric acid buffers (the wet thallus final concentration is 50 g/L), substrate curcumine concentration is 50 mg/L, in 30 ℃, 200 rpm transform shown in 2 ~ 24 h(tables 10).After reaction finishes, the centrifugal thalline of removing, get supernatant liquor, supernatant liquor ethyl acetate extraction three times, combining extraction liquid, be evaporated to dried, remove ethyl acetate, get enriched material with to be detected behind the chromatogram dissolve with methanol, detection method is with embodiment 1 step (5), calculate product 6(t=62 min according to area normalization method) yield, the results are shown in Table 10.
The different transformation times of table 10 are on converted product 6(t=62 min) impact of yield
| Embodiment | Transformation time/ | Product | 6 yield/% |
| 25 | 2 | 65.2 | |
| 26 | 4 | 67.4 | |
| 27 | 6 | 69.8 | |
| 28 | 8 | 71.9 | |
| 29 | 12 | 72.6 | |
| 30 | 16 | 74.2 | |
| 31 | 24 | 70.2 |
Conclusion: as shown in Table 10, better transformation time is 16 h.
SEQUENCE LISTING
＜110〉Zhejiang Polytechnical University
＜120〉pichia kudriavzevii ZJPH0802 and the application in the preparation curcumin derivate thereof
<130>
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 581
<212> DNA
<213> Pichia kudriavzevii
<400> 1
gcggaggaaa agaaaccaac agggattgcc tcagtagcgg cgagtgaagc ggcaagagct 60
cagatttgaa atcgtgcttt gcggcacgag ttgtagattg caggttggag tctgtgtgga 120
aggcggtgtc caagtccctt ggaacagggc gcccaggagg gtgagagccc cgtgggatgc 180
cggcggaagc agtgaggccc ttctgacgag tcgagttgtt tgggaatgca gctccaagcg 240
ggtggtaaat tccatctaag gctaaatact ggcgagagac cgatagcgaa caagtactgt 300
gaaggaaaga tgaaaagcac tttgaaaaga gagtgaaaca gcacgtgaaa ttgttgaaag 360
ggaagggtat tgcgcccgac atggggattg cgcaccgctg cctctcgtgg gcggcgctct 420
gggctttccc tgggccagca tcggttcttg ctgcaggaga aggggttctg gaacgtggct 480
cttcggagtg ttatagccag ggccagatgc tgcgtgcggg gaccgaggac tgcggccgtg 540
taggtcacgg atgctggcag aacggcgcaa caccgcccgt c 581
Claims (10)
1. pichia kudriavzevii (Pichia kudriavzevii) ZJPH0802 is preserved in Chinese Typical Representative culture collection center, the address: Wuhan, China Wuhan University, preservation date on September 24th, 2012, deposit number CCTCC M 2012373.
2. the described pichia kudriavzevii ZJPH0802 of claim 1 prepares application in the curcumin derivate in bio-transformation, it is characterized in that described being applied as: the wet thallus that obtains take pichia kudriavzevii ZJPH0802 fermentation culture is as the enzyme source, take curcumine as substrate, in the phosphoric acid buffer liquid medium, carry out conversion reaction, reaction is carried out aftertreatment with conversion reaction liquid after finishing, and obtains described curcumin derivate.
3. pichia kudriavzevii ZJPH0802 prepares application in the curcumin derivate in bio-transformation as claimed in claim 2, it is characterized in that described phosphoric acid buffer is pH value 5.8 ~ 8.0 phosphoric acid buffers.
4. pichia kudriavzevii ZJPH0802 prepares application in the curcumin derivate in bio-transformation as claimed in claim 2, the post-treating method that it is characterized in that described conversion reaction liquid is: after reaction finishes, conversion fluid is centrifugal, get the supernatant liquor ethyl acetate extraction, ethyl acetate is removed in the extraction liquid underpressure distillation, get residue and carry out silica gel column chromatography, TLC follows the tracks of detection, collects R
fValue is 0.424 or 0.712 o'clock elutriant, and steaming desolventizes, and obtains described curcumin derivate.
5. pichia kudriavzevii ZJPH0802 prepares application in the curcumin derivate in bio-transformation as claimed in claim 2, it is characterized in that described being applied as: in the enzyme source, curcumine, in the transformation system that phosphoric acid buffer consists of, the wet thallus that obtains take pichia kudriavzevii ZJPH0802 fermentation culture is as the enzyme source, take curcumine as substrate, be in the transformation system of 5.8 ~ 8.0 phosphoric acid buffers in the pH value, at 20 ~ 40 ℃, carry out conversion reaction under 150 ~ 220 rpm conditions, after reaction finishes, conversion fluid is centrifugal, get the supernatant liquor ethyl acetate extraction, ethyl acetate is removed in the extraction liquid underpressure distillation, get residue and carry out silica gel column chromatography, TLC follows the tracks of detection, collects R
fValue is 0.424 or 0.712 o'clock elutriant, and steaming desolventizes, and obtains described curcumin derivate.
6. pichia kudriavzevii ZJPH0802 prepares application in the curcumin derivate in bio-transformation as claimed in claim 5, the consumption that it is characterized in that the wet thallus that described pichia kudriavzevii ZJPH0802 fermentation culture obtains is counted 20 ~ 150 g/L transformation systems with dry cell weight, and the starting point concentration of described curcumine substrate is 20 ~ 250 mg/L transformation systems.
7. pichia kudriavzevii ZJPH0802 prepares application in the curcumin derivate in bio-transformation as claimed in claim 5, it is characterized in that be set forth in the transformation system that the pH value is 5.8 ~ 8.0 phosphoric acid buffers, carry out conversion reaction under 30 ℃, 200 rpm conditions, the conversion reaction time is 16 h.
8. prepare application in the curcumin derivate such as pichia kudriavzevii ZJPH0802 as described in one of claim 2 ~ 7 in bio-transformation, it is characterized in that described enzyme source prepares as follows:
(1) slant culture: pichia kudriavzevii ZJPH0802 is seeded to slant medium, cultivated 2 ~ 3 days for 30 ℃, obtain slant strains, the final concentration of described slant medium consists of and adds 20 g agar, natural pH value in every liter of wort;
(2) seed culture: select a ring thalline from the inclined-plane thalline and be seeded to the seed culture medium, cultivate 16 h at 30 ℃, 200 rpm, obtain seed liquor; Described seed culture medium final concentration consists of: glucose 15 ~ 40 g/L, yeast extract paste 1 ~ 3 g/L, NH
4Cl 3 ~ 8 g/L, MgSO
47H
2O 0.1 ~ 0.5 g/L, KH
2PO
40.2 ~ 1.5 g/L, K
2HPO
40.2 ~ 1.5 g/L, pH 5 ~ 8, and solvent is water;
(3) fermentation culture: with volumetric concentration 5 ~ 15 % inoculum sizes seed liquor is inoculated in the fermention medium, 30 ℃, 200 rpm fermentation culture, 24 h, fermentation culture is centrifugal, collect wet thallus, namely obtain described enzyme source; Described fermention medium final concentration forms the described seed culture medium final concentration of same step (2) and forms.
9. pichia kudriavzevii ZJPH0802 prepares application in the curcumin derivate in bio-transformation as claimed in claim 2, it is characterized in that described application carries out as follows: it is that 6.2 ~ 7.4 phosphoric acid buffers consist of transformation system that the wet thallus that pichia kudriavzevii ZJPH0802 fermentation culture is obtained and curcumine place the pH value, at 30 ℃, carry out conversion reaction 16 h under the 200 rpm conditions, after reaction finishes, conversion fluid is centrifugal, get supernatant liquor ethyl acetate extraction three times, merge be evaporated to behind all extraction liquids dried, get residue and carry out silica gel column chromatography after with the chromatogram dissolve with methanol, take the methylene dichloride of volume ratio 100:1 and methyl alcohol mixed liquor as eluent, the TLC method is followed the tracks of and is detected, and collects R
fValue is 0.712 o'clock elutriant, elutriant is steamed in 80 ℃ of lower water-baths desolventize, and obtains hexahydrocurcumin; The consumption of the wet thallus that described pichia kudriavzevii ZJPH0802 fermentation culture obtains is counted 20 ~ 100 g/L transformation systems with dry cell weight, and the starting point concentration of described substrate is 20 ~ 180 g/L transformation systems.
10. pichia kudriavzevii ZJPH0802 prepares application in the curcumin derivate in bio-transformation as claimed in claim 2, it is characterized in that described application carries out as follows: it is that 6.2 ~ 7.4 phosphoric acid buffers consist of transformation system that the wet thallus that pichia kudriavzevii ZJPH0802 fermentation culture is obtained and curcumine place the pH value, at 30 ℃, carry out conversion reaction 16 h under the 200 rpm conditions, after reaction finishes, conversion fluid is centrifugal, get supernatant liquor ethyl acetate extraction three times, merge be evaporated to behind all extraction liquids dried, get residue and carry out silica gel column chromatography after with the chromatogram dissolve with methanol, take the methylene dichloride of volume ratio 50:1 and methyl alcohol mixed liquor as eluent, the TLC method is followed the tracks of and is detected, and collects R
fValue is 0.424 o'clock elutriant, elutriant is steamed in 80 ℃ of lower water-baths desolventize, and obtains tetrahydro curcumin; The consumption of the wet thallus that described pichia kudriavzevii ZJPH0802 fermentation culture obtains is counted 20 ~ 100 g/L transformation systems with dry cell weight, and the starting point concentration of described curcumine substrate is 20 ~ 180 mg/L transformation systems.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210478473.3A CN102965290B (en) | 2012-11-21 | 2012-11-21 | Pichia kudriavzevii ZJPH0802 and application thereof in preparation of curcumin derivatives |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210478473.3A CN102965290B (en) | 2012-11-21 | 2012-11-21 | Pichia kudriavzevii ZJPH0802 and application thereof in preparation of curcumin derivatives |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102965290A true CN102965290A (en) | 2013-03-13 |
| CN102965290B CN102965290B (en) | 2014-01-29 |
Family
ID=47795726
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210478473.3A Active CN102965290B (en) | 2012-11-21 | 2012-11-21 | Pichia kudriavzevii ZJPH0802 and application thereof in preparation of curcumin derivatives |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102965290B (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104496779A (en) * | 2014-12-18 | 2015-04-08 | 陕西嘉禾植物化工有限责任公司 | Method for preparing tetrahydrocurcumin |
| CN107709540A (en) * | 2014-06-20 | 2018-02-16 | 韩国生命工学研究院 | Novel warehouse Delhi A Ziweishi Pichia pastoris strains NG7 and application thereof |
| CN111254085A (en) * | 2020-02-28 | 2020-06-09 | 江南大学 | Microbial compound microbial inoculum for degrading lactic acid |
| CN111278326A (en) * | 2017-07-28 | 2020-06-12 | 轨迹Ip有限责任公司 | Yeast-based mask for improving skin, hair and scalp health |
| CN111394266A (en) * | 2019-12-03 | 2020-07-10 | 延边大学 | Preparation method and application of apiose-removed platycodin D |
| CN111394265A (en) * | 2019-12-03 | 2020-07-10 | 延边大学 | Preparation method and application of platycodin D |
| CN111893050A (en) * | 2020-08-14 | 2020-11-06 | 山东省食品发酵工业研究设计院 | Pichia kudriavzevii and application thereof in preventing and treating postpartum diseases of agricultural products |
| CN114891666A (en) * | 2022-04-14 | 2022-08-12 | 厦门大学 | Marine bacterial strain and application thereof in preparing tetrahydrocurcumin through catalysis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445812A (en) * | 2008-12-12 | 2009-06-03 | 浙江中医药大学 | Method for obtaining new compound group of curcumin by monascus bioconversion |
| CN102010833A (en) * | 2010-06-21 | 2011-04-13 | 唐传生物科技（厦门）有限公司 | Novel pichia strain and method for mixing and culturing same to biologically detoxify hemicellulose hydrolysate |
| WO2011153144A1 (en) * | 2010-05-31 | 2011-12-08 | Gevo, Inc. | Isobutanol production using yeasts with modified transporter expression |
-
2012
- 2012-11-21 CN CN201210478473.3A patent/CN102965290B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101445812A (en) * | 2008-12-12 | 2009-06-03 | 浙江中医药大学 | Method for obtaining new compound group of curcumin by monascus bioconversion |
| WO2011153144A1 (en) * | 2010-05-31 | 2011-12-08 | Gevo, Inc. | Isobutanol production using yeasts with modified transporter expression |
| CN102010833A (en) * | 2010-06-21 | 2011-04-13 | 唐传生物科技（厦门）有限公司 | Novel pichia strain and method for mixing and culturing same to biologically detoxify hemicellulose hydrolysate |
Non-Patent Citations (3)
| Title |
|---|
| CHAN CF ET AL: "Genome sequence of Pichia kuudriavzevii M12, a potential producer of bioethanol and phytase", 《EUKARYOTIC CELL》 * |
| ZHANG ET AL: "Microbial transformation of curcumin by Rhizopus chinensis", 《BIOCATALYSIS AND BIOTRANSFORMATION》 * |
| 彭清忠 等: "内生真菌对姜黄素的微生物转化", 《生物技术通讯》 * |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107709540A (en) * | 2014-06-20 | 2018-02-16 | 韩国生命工学研究院 | Novel warehouse Delhi A Ziweishi Pichia pastoris strains NG7 and application thereof |
| CN104496779A (en) * | 2014-12-18 | 2015-04-08 | 陕西嘉禾植物化工有限责任公司 | Method for preparing tetrahydrocurcumin |
| US11759414B2 (en) | 2017-07-28 | 2023-09-19 | Locus Solutions Ipco, Llc | Yeast-based masks for improved skin, hair and scalp health |
| CN111278326A (en) * | 2017-07-28 | 2020-06-12 | 轨迹Ip有限责任公司 | Yeast-based mask for improving skin, hair and scalp health |
| CN111394265B (en) * | 2019-12-03 | 2023-09-15 | 延边大学 | Preparation method and application of platycodin D |
| CN111394265A (en) * | 2019-12-03 | 2020-07-10 | 延边大学 | Preparation method and application of platycodin D |
| CN111394266A (en) * | 2019-12-03 | 2020-07-10 | 延边大学 | Preparation method and application of apiose-removed platycodin D |
| CN111394266B (en) * | 2019-12-03 | 2023-12-22 | 延边大学 | Preparation method and application of apigenin D |
| CN111254085A (en) * | 2020-02-28 | 2020-06-09 | 江南大学 | Microbial compound microbial inoculum for degrading lactic acid |
| CN111893050A (en) * | 2020-08-14 | 2020-11-06 | 山东省食品发酵工业研究设计院 | Pichia kudriavzevii and application thereof in preventing and treating postpartum diseases of agricultural products |
| CN111893050B (en) * | 2020-08-14 | 2022-03-11 | 山东省食品发酵工业研究设计院 | Pichia kudriavzevii and application thereof in preventing and treating postpartum diseases of agricultural products |
| CN114891666A (en) * | 2022-04-14 | 2022-08-12 | 厦门大学 | Marine bacterial strain and application thereof in preparing tetrahydrocurcumin through catalysis |
| CN114891666B (en) * | 2022-04-14 | 2024-05-24 | 厦门大学 | Marine strain and application thereof in catalytic preparation of tetrahydrocurcumin |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102965290B (en) | 2014-01-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102965290B (en) | Pichia kudriavzevii ZJPH0802 and application thereof in preparation of curcumin derivatives | |
| CN102321563B (en) | Amycolatopsis sp. and method for preparing vanillin through whole-cell transformation of Amycolatopsis sp. | |
| CN107298671A (en) | Come from the secalonic acid H of penicillium oxalicum and prepare the application of anti-human colon cancer drug | |
| CN113121557B (en) | Marine fungus-derived heterpene compound and application thereof in preparation of anti-inflammatory drugs | |
| CN110559224A (en) | Broccoli extract and preparation method and application thereof | |
| CN107298672A (en) | The secalonic acid I for coming from penicillium oxalicum is preparing the application of anti-human colon cancer drug | |
| CN103655215B (en) | There is Paecilomyces varioti extract of restraint of tyrosinase activity and Free-radical scavenging activity and uses thereof | |
| US11505812B2 (en) | Method of producing ergothioneine | |
| CN107298670A (en) | Come from penicillium oxalicum secalonic acid H and prepare anti-human oral cavity epidermoid carcinoma medicinal application | |
| CN102391968B (en) | Streptomyces and its application in echinomycin production | |
| CN104894173A (en) | Curcumin derivative preparing method | |
| CN107298669B (en) | Selenolonic acid I from penicillium oxalicum and application of medicine for resisting human oral epidermoid carcinoma | |
| CN112358516B (en) | Application of diosmetin (4-O-methyl) glucoside compound in preparation of lipid-lowering drugs | |
| CN103275884B (en) | AUH-JLC159 and transforming method thereof for preparation of (-)-5-OH-equol | |
| DK151273B (en) | PROCEDURE FOR THE PREPARATION OF THE CHOLESTEROL BIOSYNTHESE INHIBITOR MB-530A. | |
| CN114747423B (en) | Inonotus obliquus culture method and culture product thereof | |
| CN109134416B (en) | Application of seclenic acid H derived from penicillium oxalicum in preparation of human cervical cancer drugs | |
| CN102226152A (en) | Cylindrocarpon didymium and method for preparing ginsenoside Rh2 by using same | |
| CN116103161A (en) | Plant endophytic fungus for producing eupatorium and application thereof | |
| CN105779363B (en) | A kind of method of liquefied Serratia and its Synthesis heliotropin | |
| CN113881602A (en) | High yield C21Steroid compound bacillus cereus X-32 and application thereof | |
| CN110527632B (en) | Endophytic fungus strain for efficiently biotransformation of betulinic acid and application thereof | |
| CN109182180B (en) | A kind of application of the brown streptomycete of ash and its fermenting and producing bar bifilomycin A1 | |
| CN102329829B (en) | Method for converting daidzein into 8-hydroxydaidzein by utilizing penicillium | |
| CN106957881A (en) | A kind of preparation method of curcumin derivate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201127 Address after: 11th floor, donglecheng international, Shuguang Road, Chengguan Street, Dongming County, Heze City, Shandong Province Patentee after: Heze Jianshu Intelligent Technology Co., Ltd Address before: 310014 Hangzhou city in the lower reaches of the city of Zhejiang Wang Road, No. 18 Patentee before: ZHEJIANG University OF TECHNOLOGY |
|
| TR01 | Transfer of patent right |