CN102952848A - Detection method of small non-messenger RNA - Google Patents
Detection method of small non-messenger RNA Download PDFInfo
- Publication number
- CN102952848A CN102952848A CN2011102352529A CN201110235252A CN102952848A CN 102952848 A CN102952848 A CN 102952848A CN 2011102352529 A CN2011102352529 A CN 2011102352529A CN 201110235252 A CN201110235252 A CN 201110235252A CN 102952848 A CN102952848 A CN 102952848A
- Authority
- CN
- China
- Prior art keywords
- probe
- rna
- hybridization
- little rna
- heteroduplex
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a detection method of small non-messenger RNA. The method includes: conducting non-isotope labelling at the 3' end of a oligonucleotide sequence probe under the effect of a terminal transferase; reacting the labelled probe and a sample RNA fully in a liquid phase hybridization environment to make the target small non-messenger RNA in the sample and the probe form heteroduplex; then subjecting the hybridization product to non-denaturing polyacrylamide gel electrophoresis, separating RNA-probes and non-hybridized excessive probes combined into double chains, transferring the heteroduplex to a nylon membrane, performing ultraviolet crosslinking fixation, adding streptavidin-HRP, thus achieving color developing and luminescence; and in the system, with the hybridized target RNA-probe and a single non-hybridized probe both being able to pass the streptavidin-HRP, adding an enzyme substrate to emit a fluorescence band, and performing developing on an X-ray plate.
Description
Technical field
The present invention relates to a kind of method that detects the little RNA of non-coding, relate in particular to a kind of method that the non-radiactive probe solution hybridization detects the little RNA of non-coding of using.
Background technology
The little RAN of non-coding (small non-messenger RNA, the present invention is also referred to as little RNA) be that a large class is comprised of to hundreds of Nucleotide tens Nucleotide in the cell, the RNA of coded protein not, such as small nuclear RNA, nucleolar RNA, microRNA, the little RNA of interference, the little RNA of sequential etc., this class RNA itself or form complex body with protein bound important biological function is arranged, the research discovery, little RNA in vivo generation and viral invasion and the defence aspect of growth, growth, differentiation even the disease of cell, tissue etc. is bringing into play vital effect.
The technology that can be used at present detecting little RNA mainly contains Northern blot, RT-PCR and micro-array chip technology.Round pcr is such as " real time fluorescence quantifying PCR method detects little RNA " (Chinese cytobiology journal, 2010,32 (3): 359 ~ 360) method of the little RNA of disclosed detection by quantitative, disclosed microRNA probe and and the method that detects microRNA for stomach-tissue of micro-array chip technology such as CN101182576A.Although comparing with Northern blot technology, the inspection of RT-PCR, microarray technology has higher sensitivity when surveying little RNA, but traditional Northern blot method not only can directly detect RNA to be measured, and the base number of the clear and definite RNA of energy, simultaneously also can carry out semiquantitative determination, so traditional Northern blot is still the gold standard that detects the little RNA of non-coding.
Using traditional little RNA of Northern blot technology for detection non-coding comprises denaturing polyacrylamide gel isolating small RNA fragment, little RNA is transferred to nylon membrane or nitrocellulose filter, prehybridization, isotope probe hybridization, detection etc.Whole process steps is loaded down with trivial details, and length consuming time needed just can finish in 2-3 days; Be applied to isotropic substance in the what is more important testing process, this needs specific operationlocation, plant and instrument and relevant speciality personnel, and these deficiencies have limited its popularization and application greatly.Therefore have the people to use non-radiactive probe (biotinylated probe) and substitute isotope-labeled probe, although avoided the disadvantageous aspect of isotropic substance, loaded down with trivial details operating process does not reduce, and the time of detection signal does not shorten yet.As everyone knows, the RNA enzyme is ubiquitous, and loaded down with trivial details operation has increased little RNA by the risk of RNA enzyme liberating, has unavoidably reduced the susceptibility of the little RNA of traditional Northern blot technology for detection, has especially strengthened the difficulty that the little RNA of low abundance non-coding is detected.
Summary of the invention
In order to overcome traditional Northern blot technology in the deficiency aspect the little RNA of detection non-coding, expand the application of Northern blot technology aspect the little RNA of detection non-coding, the invention provides a kind of novel prioritization scheme, this technology can not only effectively detect little RNA, and can also carry out easy, quick, safe and accurately the little RNA of quantitative analysis non-coding to be measured.
The method of the little RNA of detection non-coding provided by the invention, step comprises:
Step 1 is at 3 ' end mark heterotope of oligonucleotide probe;
Step 2, the non isotopic probe of mark and sample RNA place the liquid hybridization environment, make the little RNA of non-coding and described probe carry out solution hybridization and form heteroduplex, separate described heteroduplex;
Step 3, the quantitative or described little RNA of qualitative detection.
Wherein, described quantitatively or qualitative detection all can adopt the non-denaturing polyacrylamide gel system to detect, be preferably 15% non-denaturing polyacrylamide gel system.
In the little RNA method of the above-mentioned detection non-coding of the present invention, heterotope is preferably vitamin H described in the step 1.The method of using described vitamin H to carry out the oligonucleotide probe mark can adopt prior art to implement by those skilled in the art, such as zymetology method, chemical method, photochemical method etc.
In the above-mentioned little RNA method of detection non-coding of the present invention, separate and obtain after the described heteroduplex, add HRP conjugate enzyme avidin and make described heteroduplex colour developing, particularly, first described heteroduplex is transferred on the nylon membrane, ultraviolet-crosslinkable is fixed, and then adds described HRP coupling streptavidin (below be also referred to as " Streptavidin-HRP ").
In the above-mentioned little RNA method of detection non-coding of the present invention, oligonucleotide probe described in the step 1 is the complementary sequence of little RNA to be measured.
In the above-mentioned little RNA method of detection non-coding of the present invention, described liquid hybridization environment comprises hybridization buffer, and described hybridization buffer can be phosphate buffered saline buffer or Tris-HCl damping fluid.Wherein:
Phosphate buffered fluid component: 30mmol/L phosphate buffer, 0.3mmol/L NaCl, 10mmol/LEDTA;
Tris-HCl buffer composition were: 100mM Tris-HCl (pH value 8.5), 500nM KCl, 15mM MgCl
2, 1%Tritox-100, perhaps 100mM Tris-HCl (pH value 7.5), 1M NaCl, 10mM EDTA.
In the above-mentioned little RNA method of detection non-coding of the present invention, described solution hybridization can adopt PCR instrument or water-bath to anneal.Wherein, use described PCR instrument method for annealing to be: progressively cooling on the PCR instrument, first 90 ℃, 2min, then every 90s cooling is 1 ℃, until near 25 ℃ of temperature; Described water-bath annealing conditions is: then 95 ℃ of water-bath 5min placed 42 ℃, 2 ~ 3 hours.
The little RNA method of detection non-coding that the present invention is above-mentioned can be used for the little rna content of detection by quantitative, and analytical electrophoresis detects heteroduplex band gray-scale value and hybridization probe band gray-scale value not, and described little rna content calculation formula is:
The present invention also provides the application of a kind of aforesaid method in detecting the little RNA of non-coding, can be the little RNA of the described non-coding of detection by quantitative or qualitative detection, the little RNA of described non-coding can be small nuclear RNA, nucleolar RNA, microRNA, the little RNA of interference, the little RNA of sequential etc.
The little RNA method of detection non-coding provided by the invention, the purpose RNA-probe after the hybridization and single not hybridization probe all can pass through Streptavidin-HRP, add enzyme substrates and send the fluorescence band, develop at the x-ray mating plate.But the base number of heterozygosis chain is more than single probe base number (approximately poor〉20nt), can be in non-denaturing polyacrylamide gel effective separation, thereby effectively show the result.The biotin labeling oligonucleotide probe can increase the sensitivity of the little RNA of probe in detecting non-coding, and easy to operate, quick, "dead"; Solution hybridization has improved the combination rate of probe and purpose RNA, but non-sex change gathers the excessive not bonding probes of propionic acid amide gel electrophoresis effective separation, avoid residual probe to cause a deviation, the transfer printing of solid support nylon membrane is used applied widely, avoid the restriction of high experimental installation, reduced experimental cost.Relatively traditional Northern blot technology, the method for the invention has following advantage:
1, probe and purpose nucleic acid fragment are hybridized in the liquid phase damping fluid, have changed the first solid support of traditional northern blot technology and have shifted, and use the operation of probe hybridization again.Not only simplify schedule of operation, greatly shortened the operating time, also improved probe hybridization efficient, be easy to subsequent detection.
2, replace denaturing polyacrylamide gel with non-denaturing polyacrylamide gel, preparation is simple, and it is convenient to remove.Add a certain amount of urea in the preparation denaturing polyacrylamide gel, the urea precipitation can stick to instrument and the article that contact on, be difficult to remove, affect instrument reuse and attractive in appearance.Adopt non-denaturing polyacrylamide gel to solve above problem with regard to good, and do not affect the electrophoresis of nucleic acid.
3, non-radiactive probe, but complete complete independently is low to requirement for experiment condition, easy and simple to handle, can be competent at detection of nucleic acids fully, has broken away from and has bought the limitation of biotech firm's probe and the radioactivity of isotopic labeling probe self.
4, improved little RNA recall rate.Relatively traditional Northern blot technology, this technology has been simplified operating process, requirement for experiment condition is low, be easy to promote, and use solution hybridization, non-denaturing polyacrylamide gel detection system to improve detecting the little RNA of non-coding, also can carry out quantitatively little RNA, change the deficiency that traditional Northern blot technology detects little RNA.
In sum, the method for the invention has been reduced the loaded down with trivial details step of traditional Northern marking, and little RNA has the characteristics such as efficient, easy, quick, safe for detection of non-coding.
Description of drawings
Fig. 1 is embodiment of the invention biotinylated probe electrophoresis detection result;
Fig. 2 is the little RNA of embodiment of the invention non-coding and biotinylated probe solution hybridization detected result;
Fig. 3 is that the different annealing conditions of electrophoresis detection are on the impact of solution hybridization; Wherein:
Lane1 and lane2 annealing conditions are: progressively cooling on the PCR instrument, and first 90 ℃, 2min, then every 90s cooling is 1 ℃, until near 25 ℃ of temperature; Lane3 and lane4 annealing conditions are: then 95 ℃ of water-bath 5min placed 42 ℃, 2 ~ 3 hours; The total RNA of lane1 and lane3 and U6 probe amount ratio=5 μ g:0.5 μ M; The total RNA of lane2 and lane4 and U6 probe amount ratio=5 μ g:1 μ M; Lane5 is 0.5 μ M U6 probe;
Fig. 4 is that the different hybridization buffers of electrophoresis detection are on the impact of solution hybridization;
Fig. 5 is the electrophoresis detection result of the little rna content of the inventive method quantitative analysis bronchial epithelial cell BEAS-2B and lung adenocarcinoma cell A549.
Embodiment
The invention provides a kind of method that detects the little RNA of non-coding, the oligonucleotide sequence probe is 3 ' end mark heterotope (being preferably vitamin H) under the transferring enzyme effect endways; Label probe and sample RNA place the solution hybridization environment fully to react and make the little RNA of sample purpose non-coding and probe formation heteroduplex.To hybridize the product native polyacrylamide gel electrophoresis afterwards, separation and combination is double-stranded RNA-probe and the excess probe of hybridization not, being transferred to nylon membrane, fixes through ultraviolet-crosslinkable afterwards, and adding Streptavidin-HRP can develop the color luminous.In system, the purpose RNA-probe after the hybridization and single not hybridization probe all can pass through Streptavidin-HRP, add enzyme substrates and send the fluorescence band, develop at the x-ray mating plate.
Take biotin labeling U6 probe as example, below by specific embodiment the present invention is detected the little RNA method of non-coding and carry out detailed narration and introduction, so that better understand the present invention, but the not remarkable scope of the invention of following embodiment.
Embodiment 1
Step 1
Sequence synthetic oligonucleotide: 5 '-ATTTGCGTGTCATCCTTGCG-3 ', this sequence and U6 sequence complete complementary, probe is shorter, easily is combined pairing with complementary sequence.
Adopt terminal enzyme (DNA) (TdT) at oligonucleotide 3 ' end mark vitamin H, reaction system is as follows:
Ultrapure water 25 μ l
5 times of dilution TdT reaction buffer 10 μ l
Vitamin H-11-UTP 5 μ l
TdT (2U/μl) 5μl
Reaction process: then 37 ℃ of water-bath 30min add 2.5 μ l EDTA(0.2M) termination reaction, add 50 μ l chloroforms: primary isoamyl alcohol (24:1) mix reagent, behind the mixing centrifugal (12000g, 2-3min), get supernatant 40-50 μ l and preserve.
After probe mark is finished, mark validity is detected: label probe 1 μ M, the 2 μ M, 5 μ M, the 10 μ M that get respectively different concns, add sample-loading buffer, at 15% native polyacrylamide gel electrophoresis, adopting wets turns method, is transferred to nylon membrane, and then ultraviolet-crosslinkable is fixed, in conjunction with HRP, the X ray mating plate develops.With reference to Fig. 1, under 1 μ M, 2 μ M, 5 μ M, 10 μ M concentration, all can detect at probe end success mark vitamin H and with detection system, the probe mark success is described.From the result, but the probe availability wants high than the oligonucleotide concentration mark of 1,2 μ M behind the oligonucleotide concentration mark of 5 μ M, 10 μ M, and the result is more reliable.
Step 2
Get mark U6 probe of total RNA 5 μ g, 5 μ l, hybridization buffer (final volume is 20 μ l) places PCR instrument 95 ° of C, 2min, and then 1 ° of C falls in every 90s, until temperature reaches 25 ° of C, keeps for a long time.Adopt afterwards 15% non-denaturing polyacrylamide gel electrophoresis detection, with reference to Fig. 2,20nt left and right sides band only appears in single U6 probe, differs approximately above independent probe that RNA-probe hybridization band appears in 20nt, and the 20nt place still has excessive probe band.Illustrate the above-mentioned solution hybridization of the present invention-non-denaturing polyacrylamide gel electrophoresis-be transferred to solid phase nylon membrane-UV-crosslinked fixing-method of developing in conjunction with HRP-can be for the detection of little RNA.
Embodiment 2
With reference to embodiment 1, adopt different annealing conditions to carry out solution hybridization in the present embodiment.
Annealing conditions one: at the PCR instrument progressively cooling is set, 95 ° of C 2min, then 1 ° of C falls in every 90s, until temperature is 25 ° of C, keeps for a long time.
Annealing conditions two: 95 ° of C of water-bath, 5min; Then 42 ° of C, 2-3 hour.
With reference to Fig. 3, the result shows: all can make probe and purpose RNA hybridization under two kinds of different solution hybridization conditions, form the hydridization chain.Upper from the operating time, the action time of PCR instrument is short than water-bath action time, temperature-fall period is gentle and automatically control and need not human intervention; Water-bath prolongs action time, and annealing is relatively gentle, and the demonstration of water-bath hybridization band is more attractive in appearance clear than the PCR condition in this experiment, and non-specific binding is less than PCR instrument condition.Water-bath and PCR instrument all can be used for sample and probe solution hybridization in a word, and working conditions is extensive, can select to use according to the actual conditions in laboratory.
Embodiment 3
With reference to embodiment 1, adopt different hybridization buffers to carry out solution hybridization in the present embodiment.
Hybridization buffer A:30mmol/L phosphate buffer, 0.3mmol/L NaCl, 10mmol/LEDTA
Hybridization buffer B:Tris-HCl (pH value 8.5) 100mM, KCl 500nM, MgCl
215mM, 1%Tritox-100
Hybridization buffer C:Tris-HCl (pH value 7.5) 100 mM, 1 M NaCl, 10 mM EDTA
Hybridization buffer D:DEPC-treated H
2O
Get fresh total RNA sample 5 μ g, 4 groups of 5 μ l U6 probes add respectively the different hybridization buffer of equal-volume, at 95 ° of C of water-bath, 5min; Then 42 ° of C 2-3 hour, are fully hybridized, afterwards 15% non-denaturing polyacrylamide gel electrophoresis detection.
With reference to Fig. 4, the result shows: under identical renaturation condition, phosphate buffered saline buffer, Tris-HCl damping fluid all can be used for the solution hybridization damping fluid, but the crossbreeding effect of phosphate buffered saline buffer obviously is better than the Tris-HCl damping fluid.The non-specific hybridization band of B, C, D liquid is obviously more than A liquid, but there is no significant difference between B, C.D liquid is without any buffer salt system, the hydridization chain that a small amount of U6 probe and aim sequence can be arranged, but non-specific hybridization is more than other hybridization solutions, the appropriate hybridization buffer of this explanation can promote the hybridization between sample and probe under the solution hybridization condition, and hybridization A liquid is best solution hybridization damping fluid in this experiment.
In a word, Tris-HCl damping fluid and phosphate buffered saline buffer all can be comparatively desirable is used for nucleic acid and purpose probe hybridization under the liquid-phase condition.In conjunction with this experiment actual conditions, we select phosphate buffered saline buffer, 95 ° of C of annealing conditions water-bath, and then 42 ° of C 2-3 hour, fully hybridize sample and probe.
Embodiment 4
The present invention can be used for detection by quantitative microRNA (microRNA, miRNA), and with reference to embodiment 1, the present embodiment method is as follows:
Step 1
Ripe miRNA-145 sequence: GUCCAGUUUUCCCAGGAAUCCCU
Design miRNA-145 probe sequence: AGGGATTCCTGGGAAAACTGGAC
Terminal enzyme (DNA) (TdT) is at 3 ' end mark vitamin H of miRNA-145 probe sequence oligonucleotide.
Step 2
Get fresh total RNA 5 μ g, miRNA-145 probe 5 μ l, add liquid phase hybridization buffer A to final volume 20 μ l, 95 ° of C of water-bath, 5min, 42 ° of C then, 3h.
Step 3
15% non-denaturing polyacrylamide gel system detects the miR-145 expression subsequently.Be transferred to nylon membrane, in conjunction with HRP(42 ° C, 1h) develop.
Employed probe is capacity in the solution hybridization system, and each total RNA, probe amount that adds is known.After the electrophoresis detection, the probe band of show probe and little RNA hybridization band, not hybridizing.
Total probe amount=with the probe amount of the probe amount of little RNA hybridization+do not hybridize.In theory, the probe amount in conjunction with hybridization with little RNA is:
Because probe and the little RNA of purpose are complete base complementrity pairings, so the probe amount in conjunction with hybridization described and little RNA is exactly the amount of little RNA as can be known, thereby learn the content of concrete little RNA.Can carry out relative quantification with reference to U6 according to this method, can carry out absolute quantitation to the little RNA of purpose again.
Process by image, analyze the gray-scale value that obtains band, obtain little rna content calculation formula as follows:
Table 1 is according to the gradation of image value of Fig. 5 calculating
Table 2 the present invention detects the comparison of little RNA and traditional northern blot technology
| The present invention | Tradition northern blot |
| Sample, probe demand are low, quantitative | Sample, probe demand are higher |
| Solution hybridization, the time short (2-3h) | Solid-phase hybridization, the time long (16-24h) |
| Native polyacrylamide gel electrophoresis, configuration are simply | Denaturing polyacrylamide gel electrophoresis |
| The non radioactive isotope label probe, "dead" | Mostly be the labelled with radioisotope probe, radioactivity |
| Little RNA detection sensitivity is higher | Little RNA detection sensitivity is lower |
| Easy and simple to handle, quick, approximately need 6-8h | Process is loaded down with trivial details, time and effort consuming, 2-3 days |
| Suitability is wide, and low experimental cost can be promoted | Experimental cost is higher |
Take the normal bronchial epithelial cell BEAS-2B of lung, lung adenocarcinoma cell A549 as example, with reference to Fig. 5, it is as shown in table 1 that gradation of image calculates the result.
According to formula (II), in the BEAS-2B cell, the amount that the total RNA of 5 μ g contains miRNA-145 is
；
According to formula (II), in lung cell A549, the amount that the total RNA of 5 μ g contains miR-145 is
By above-described embodiment, can find out, the present invention compares with traditional Northen bolt technology, has difference as described in Table 2 and advantage.
Above specific embodiments of the invention are described in detail, but it is just as example, the present invention is not restricted to specific embodiment described above.To those skilled in the art, any equivalent modifications that the present invention is carried out and substituting also all among category of the present invention.Therefore, not breaking away from impartial conversion and the modification of doing under the spirit and scope of the present invention, all should contain within the scope of the invention.
Claims (10)
1. a method that detects the little RNA of non-coding is characterized in that, step comprises:
Step 1 is at 3 ' end mark heterotope of oligonucleotide probe;
Step 2, the non isotopic probe of mark and sample RNA place the liquid hybridization environment, make the little RNA of non-coding and described probe carry out solution hybridization and form heteroduplex, separate described heteroduplex;
Step 3, the quantitative or described little RNA of qualitative detection.
2. method according to claim 1 is characterized in that, solution hybridization described in the step 2 adopts PCR instrument or water-bath to anneal.
3. method according to claim 1 is characterized in that, described liquid hybridization environment comprises hybridization buffer, and described hybridization buffer is phosphate buffered saline buffer or Tris-HCl damping fluid.
4. method according to claim 1 is characterized in that, described heterotope is vitamin H.
5. method according to claim 4 is characterized in that, separate described heteroduplex after, first described heteroduplex is transferred on the nylon membrane, ultraviolet-crosslinkable is fixed, and adds described HRP coupling streptavidin and makes described heteroduplex colour developing, then carry out step 4.
6. method according to claim 1, oligonucleotide probe described in the step 1 is the complementary sequence of little RNA to be measured.
7. method according to claim 1, it is characterized in that, the described little RNA method of detection by quantitative is: analytical electrophoresis detects heteroduplex band gray-scale value and hybridization probe band gray-scale value not, wherein, make the capacity of probe described in the step 2, described little rna content calculation formula is
8. method according to claim 1 is characterized in that, described quantitatively or qualitative detection adopt the non-denaturing polyacrylamide gel system to detect.
9. one kind as the application of the described method of above-mentioned any one claim in detecting the little RNA of non-coding.
10. application according to claim 9 is characterized in that, the little RNA of described non-coding is miRNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110235252.9A CN102952848B (en) | 2011-08-17 | 2011-08-17 | A kind of method detecting non-coding tiny RNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110235252.9A CN102952848B (en) | 2011-08-17 | 2011-08-17 | A kind of method detecting non-coding tiny RNA |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102952848A true CN102952848A (en) | 2013-03-06 |
| CN102952848B CN102952848B (en) | 2015-09-23 |
Family
ID=47762231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110235252.9A Expired - Fee Related CN102952848B (en) | 2011-08-17 | 2011-08-17 | A kind of method detecting non-coding tiny RNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102952848B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103293318A (en) * | 2013-05-22 | 2013-09-11 | 吉林大学 | Method for detecting miRNAs (micro ribonucleic acids) by DIG labeling EDC cross-linking bridging method |
| CN112266951A (en) * | 2020-11-23 | 2021-01-26 | 广东省农业科学院植物保护研究所 | Extension method of biotin labeled primer and application thereof |
| CN112877404A (en) * | 2020-08-12 | 2021-06-01 | 广州赛诚生物科技有限公司 | Kit for detecting interaction of RNA, DNA and protein in vivo and use method thereof |
| CN117214331A (en) * | 2023-09-15 | 2023-12-12 | 中国人民解放军军事科学院军事医学研究院 | microRNA epigenetic modification detection method based on combination of two-step probe hybridization purification strategy and liquid quality technology |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240345A (en) * | 2008-03-04 | 2008-08-13 | 天津医科大学总医院 | In-situ combination detection method for miRNA expression and cell apoptosis |
-
2011
- 2011-08-17 CN CN201110235252.9A patent/CN102952848B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240345A (en) * | 2008-03-04 | 2008-08-13 | 天津医科大学总医院 | In-situ combination detection method for miRNA expression and cell apoptosis |
Non-Patent Citations (6)
| Title |
|---|
| ANNE SCHAEFER,ET AL: "Cerebellar neurodegeneration in the absence of microRNAs", 《JEM》, vol. 204, no. 7, 9 July 2007 (2007-07-09), pages 1553 - 1558 * |
| ELENA A AFANASYEVA ET AL: "ew miRNAs cloned from neuroblastoma", 《BMC GENOMICS》, vol. 9, no. 52, 29 January 2008 (2008-01-29), pages 1 - 7 * |
| GREGOR OBERNOSTERER,ET AL: "Post-transcriptional regulation of microRNA expression", 《RNA》, vol. 12, 31 December 2006 (2006-12-31), pages 1161 - 1167 * |
| JIAN JUN ZHAO,ET AL: "Retinoic acid downregulates microRNAs to induce abnormaldevelopment of spinal cord in spina bifida rat model", 《CHILDS NERV SYST》, vol. 24, 26 October 2007 (2007-10-26), pages 485 - 492, XP019588770 * |
| TOSHIFUMI SUGATANI,ET AL: "Impaired Micro-RNA Pathways Diminish Osteoclast Differentiation and Function", 《JBC》, vol. 284, no. 7, 13 February 2009 (2009-02-13), pages 4667 - 4678 * |
| 郭跃辉: "生物素标记探针-液相杂交-非变性PAGE检测非编码小RNA方法的建立和优化", 《国际检验医学杂志》, vol. 33, no. 6, 31 March 2012 (2012-03-31), pages 645 - 647 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103293318A (en) * | 2013-05-22 | 2013-09-11 | 吉林大学 | Method for detecting miRNAs (micro ribonucleic acids) by DIG labeling EDC cross-linking bridging method |
| CN103293318B (en) * | 2013-05-22 | 2014-10-29 | 吉林大学 | Method for detecting miRNAs (micro ribonucleic acids) by DIG labeling EDC cross-linking bridging method |
| CN112877404A (en) * | 2020-08-12 | 2021-06-01 | 广州赛诚生物科技有限公司 | Kit for detecting interaction of RNA, DNA and protein in vivo and use method thereof |
| CN112266951A (en) * | 2020-11-23 | 2021-01-26 | 广东省农业科学院植物保护研究所 | Extension method of biotin labeled primer and application thereof |
| CN117214331A (en) * | 2023-09-15 | 2023-12-12 | 中国人民解放军军事科学院军事医学研究院 | microRNA epigenetic modification detection method based on combination of two-step probe hybridization purification strategy and liquid quality technology |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102952848B (en) | 2015-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021138676A1 (en) | In situ rna analysis using probe pair ligation | |
| JP6404714B2 (en) | Multivariate diagnostic assay and method for using the same | |
| CN105886512B (en) | Oligonucleotide aptamer group for high-specificity recognition of clenbuterol hydrochloride, salbutamol and ractopamine | |
| CN105349675B (en) | Larimichthys crocea full-length genome SNP and InDel molecule labelling method based on double digestion | |
| CN111154754B (en) | Probe set for analyzing DNA sample and method for using the same | |
| Dai et al. | Catalytic hairpin assembly gel assay for multiple and sensitive microRNA detection | |
| Xu et al. | Ultrasensitive and rapid detection of miRNA with three-way junction structure-based trigger-assisted exponential enzymatic amplification | |
| EP2837695B1 (en) | Nucleic acid quantification method, detection probe, detection probe set, and nucleic acid detection method | |
| CN107937482B (en) | Kit for detecting polynucleotide kinase and detection method thereof | |
| CN103710455A (en) | Method for obtaining oligonucleotide probe | |
| CN111910008A (en) | Molecular marker related to chicken growth and development and application thereof | |
| US7541144B2 (en) | RNA labeling method | |
| CN102952848B (en) | A kind of method detecting non-coding tiny RNA | |
| CN110438201A (en) | A kind of method of microRNA detection kit and multi-biotin Molecular Detection microRNA | |
| Garosi et al. | Defining best practice for microarray analyses in nutrigenomic studies | |
| CN104988144A (en) | Gene liquid chip for detecting 10 kinds of common pathogenic microorganisms in soil and detection method of gene liquid chip | |
| CN113755558A (en) | Nucleic acid detection method based on liquid chip technology | |
| CN110747254B (en) | Detection method of single cell 5-hmC | |
| US20160362732A1 (en) | Short-chain rna detection method | |
| CN114250281A (en) | Method for detecting activity of nucleic acid metabolic enzyme | |
| CN117165665A (en) | Polygene methylation detection method and application thereof | |
| JP6705171B2 (en) | Method and apparatus for correcting expression amount of small RNA | |
| Song et al. | Quantum dot-enhanced detection of dual short RNA sequences via one-step template-dependent surface hybridization | |
| CN114085913A (en) | STR locus fluorescence labeling multiplex amplification kit for mouse cell strain identification and application thereof | |
| CN103361421B (en) | Kit and method for detecting microRNA (ribonucleic acid)-155 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150923 Termination date: 20210817 |