CN102925556A - Kit for detecting mRNA expression quantity of m BCR fusion gene - Google Patents
Kit for detecting mRNA expression quantity of m BCR fusion gene Download PDFInfo
- Publication number
- CN102925556A CN102925556A CN2012103721205A CN201210372120A CN102925556A CN 102925556 A CN102925556 A CN 102925556A CN 2012103721205 A CN2012103721205 A CN 2012103721205A CN 201210372120 A CN201210372120 A CN 201210372120A CN 102925556 A CN102925556 A CN 102925556A
- Authority
- CN
- China
- Prior art keywords
- sequence
- gene
- primer
- positive control
- fluorescent probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a kit for detecting mRNA expression quantity of an m BCR fusion gene, which belongs to the technical field of biology. The kit comprises a detection primer, a fluorescent probe, a cDNA first strand synthetic agent, an RTFQ PCR (Real-time Fluorescence Quantitative Polymerase Chain Reaction) mixed liquor, a negative control and a positive control, wherein the detection primer and the fluorescent probe comprise m BCR fusion gene primer, a reference gene ABL primer and a Taqman fluorescent probe. The m BCR fusion gene is a molecular market of ALL (Acute Lymphoblastic Leukemia) , the method for quantifying the expression quantity of the mRNA is the most sensitive method for diagnosing the ALL, and the disease prognosis can be judged through the detection for the gene before treatment; and therefore, the RTFQ PCR which has high sensitivity and high specificity is adopted for detecting the level of m BCR mRNA, the specificity and the sensitivity of a detection result are both obviously increased, and a bran-new, fast and convenient gene diagnostic technology is provided for deciding a therapeutic schedule for a clinical ALL patiend and forecasting the prognosis.
Description
Technical field
The present invention relates to the fluorescent quantitative PCR technique of biological technical field, be specifically related to a kind of test kit of the m of detection BCR fusion gene mRNA expression amount.
Background technology
Acute lymphoblastic leukemia (Acute lymphoblastic leukemia, ALL) is the unusual malignant disease of a kind of lymphocyte series hemopoietic stem cell proliferation.In ALL, Ph karyomit(e) can be detected in 20% ~ 40% adult patients and 2 ~ 5% child patients, and this karyomit(e) is to form by merging after No. 9 karyomit(e) abl gene 5 ' ends and the mutual transposition of No. 22 karyomit(e) BCR gene 3 ' ends.Breaking point in the ALL patient B CR gene mainly concentrates on about 30kb place, BCR gene 5 ' end upstream, be on the First Intron 3 ' terminal sequence, this zone is defined as two fragments---bcr2 and bcr3, be referred to as m BCR fusion gene, amalgamation mode is that e1a2 connects, be transcribed into the mRNA of 7.5kb or 7.0kb, translate into a kind of chimeric protein P190.This albumen has higher protein tyrosine kinase activity, can make to activate many barss pathway after a series of substrate protein generation phosphorylations, causes cell that hyper-proliferative, differentiation and abnormal apoptosis occur in the situation of the acellular factor.
ALL patient is at the Acute onset initial stage, and the leukemia total cellular score can reach 10 in the body
12More than, most of adult patients can be alleviated fully after the chemotherapy, but at the alleviation initial stage, all detects in marrow and the peripheral blood less than obvious leukocytic existence, and the interior leukemia total cellular score of body this moment still has 10
7~ 10
9Individual, we are referred to as MRD(Minimal Residual Desease, MRD).If these MRD can not be completely removed, cause the most at last leukemic recurrence, this also is the root of leukemia relapse.Therefore, the MRD level is to judge the key index of result for the treatment of, and the rising of this index can be used as the comprehensive recurrence that indicates in advance malignant hematologic disease.
Past, to ALL patient's the diagnosis morphological criteria that places one's entire reliance upon, but because the quality of cell smear and staining technique can directly affect the observation to its form, use lens ratio that also there is very large impact in the judgement of cellular form during observation, and reviewer's level is subject to experience, can not make the judgement of entirely accurate to normal and abnormal cells, this has inevitably caused undetected, the flase drop in laboratory, therefore recently develops into gradually to rely on molecular level methodology technology to judge.Although adopt RT-PCR(Real Time PCR, the real time fluorescent quantitative poly chain reaction) detecting m BCR fusion gene can assist us to judge sensitiveer, more specifically, but not yet detects at present the relevant report of m BCR fusion gene about real time fluorescence quantifying PCR method.
Summary of the invention
For solving the problems of the technologies described above, the invention provides a kind of test kit of the m of detection BCR fusion gene mRNA expression amount.Described technical scheme is as follows:
The embodiment of the invention provides a kind of test kit of the m of detection BCR fusion gene mRNA expression amount, comprise and detecting with primer, fluorescent probe, cDNA the first chain synthetic agent, quantitative fluorescent PCR mixed solution, negative control and positive control, described detection comprises m BCR fusion gene primer, reference gene ABL primer and Taqman fluorescent probe with primer, fluorescent probe, wherein:
M BCR fusion gene upstream primer sequence is shown in SEQ ID NO:1 in the sequence table;
M BCR fusion gene downstream primer sequence is shown in SEQ ID NO:2 in the sequence table;
M BCR fusion gene Taqman fluorescent probe is shown in SEQ ID NO:3 in the sequence table;
Abl gene upstream primer sequence is shown in SEQ ID NO:4 in the sequence table;
Abl gene downstream primer sequence is shown in SEQ ID NO:5 in the sequence table;
Abl gene Taqman fluorescent probe is shown in SEQ ID NO:6 in the sequence table;
Described cDNA the first chain synthetic agent contains MgC1
2, reversed transcriptive enzyme damping fluid, dNTPs, RNA enzyme inhibitors, Oligo (dT)
15, AMV reversed transcriptive enzyme and without the RNase deionized water; Described quantitative fluorescent PCR mixed solution contains PCR premix, Mg
2+, dNTPs, dUTP, Taq enzyme, UNG enzyme and without the RNase deionized water.
Further, described test kit also comprises primer and the Taqman fluorescent probe of inner positive control sequence, inner positive control sequence, and wherein: inner positive control sequence is shown in SEQ ID NO:7 in the sequence table; The upstream primer of inner positive control sequence is shown in SEQ ID NO:8 in the sequence table; The downstream primer of inner positive control sequence is shown in SEQ IDNO:9 in the sequence table; The Taqman fluorescent probe of inner positive control sequence is shown in SEQ ID NO:10 in the sequence table.
Further, 5 ' end of the Taqman fluorescent probe of described m BCR fusion gene and the Taqman fluorescent probe of abl gene is connected with fluorescence report group FAM, 3 ' end all is connected with fluorescent quenching group TAMRA, 5 ' end of the Taqman fluorescent probe of inner positive control sequence is connected with fluorescence report group TET, and 3 ' end is connected with fluorescent quenching group TAMRA.
Particularly, the nucleotide sequence of described reference gene ABL is shown in SEQ ID NO:11 in the sequence table.
Particularly, described negative control is deionized water; Described positive control is the total RNA sample that contains m BCR fusion gene.
Particularly, described cDNA the first chain synthetic agent is: 25mmol/L MgC1
24 μ L, 10 * reversed transcriptive enzyme damping fluid, 2 μ L, 10mmol/L dNTP2 μ L, RNA enzyme inhibitors 0.5 μ L, Oligo (dT)
150.5 μ g, AMV reversed transcriptive enzyme 1.5U and without the RNase deionized water, cumulative volume 11 μ L.
Particularly, the mixed solution of described quantitative fluorescent PCR (representing take the reaction system final concentration) as: 1 * PCR premix (stoste is 2 * PCR Premix), the Mg of 2.5-4.0mM
2+, the Taq enzyme of dUTP, 0.2U/ μ L of dNTPs, 0.3-0.6mM of 0.2-0.4mM and 0.01-0.05U/ μ L the UNG enzyme and without the RNase deionized water.
Advantage and the effect of test kit of the present invention are as follows:
(1) susceptibility is high: can repeat susceptibility is 0.01%, namely has one to contain m BCR fusion gene and just can be detected in 10000 cells.
(2) high specificity: use specific probe that quantitative molecular is identified, accuracy is high, and simultaneously, target sequence is by primer and the dual control of probe, and specificity is good and false positive is low.
(3) handy and safe: simple to operate, safety, level of automation is high and prevent from polluting.Amplification and detect and can detect in same pipe does not need to uncap, and is difficult for contaminatedly, increases simultaneously and detects a step and finish, and does not need post-processed, need not worry radiocontamination.
(4) complete monitoring: the test kit that the embodiment of the invention provides has been introduced inner positive control quality control system, and testing process is carried out Complete Quality Supervision, effectively avoids false positive or false negative.
(5) quick: the fast and high-throughput of speed, test experience can be finished at 3-4 hour.
Test kit of the present invention is detection by quantitative m BCR fusion gene mRNA level fast and accurately, false positive and false-negative generation have effectively been stopped, be used for the diagnosis of acute lymphoblastic leukemia and the monitoring of therapeutic process minimal residual disease, for the diagnosis of acute lymphoblastic leukemia, formulate treatment plan and therapeutic evaluation and prognosis important detection means is provided.
Description of drawings
In order to be illustrated more clearly in the technical scheme in the embodiment of the invention, the accompanying drawing of required use was done to introduce simply during the below will describe embodiment, apparently, accompanying drawing in the following describes only is some embodiments of the present invention, for those of ordinary skills, under the prerequisite of not paying creative work, can also obtain according to these accompanying drawings other accompanying drawing.
Figure 1A is the fluorescence real-time quantitative PCR reaction system amplification 1.0x10 of the test kit that provides of the embodiment of the invention 2
6-1.0x10
3The fluorescence curve figure of the positive control sequence standard substance in the inside of copy;
Figure 1B is the fluorescence real-time quantitative PCR reaction system amplification 1.0x10 of the test kit that provided by the embodiment of the invention 2
6-1.0x10
3The canonical plotting that the fluorescence curve figure of the positive control sequence standard substance in the inside of copy obtains;
Fig. 2 A is the fluorescence real-time quantitative PCR reaction system amplification 1.0x10 of the test kit that provides of the embodiment of the invention 2
6-1.0x10
3The fluorescence curve figure of the ABL standard substance of copy;
Fig. 2 B is the fluorescence real-time quantitative PCR reaction system amplification 1.0x10 of the test kit that provided by the embodiment of the invention 2
6-1.0x10
3The canonical plotting that the ABL standard substance fluorescence curve figure of copy obtains.
Embodiment
For making the purpose, technical solutions and advantages of the present invention clearer, embodiment of the present invention is described further in detail below in conjunction with accompanying drawing.
The preparation of embodiment 1. test kits of the present invention
1, the design of specific primer and fluorescent probe
(abl gene sequence, BCR gene order derive from American National biotechnology information center nucleic acid database, and wherein abl gene ID is respectively 25, and reference sequences number is NM005157.4 according to gene order; The BCR gene I/D is respectively 613, and reference sequences number is NG009244.1) design respectively primer and the fluorescent probe special to above-mentioned each gene order.
2, according to each component of the composition reagent preparation box of following test kit
Test kit of the present invention is composed as follows:
1. RNA extracts reagent: (Invitrogen company, the product article No.: 15596-026/100ml), every 1ml myeloid tissue adds 1mlTrizol rapid extraction leukaemic myeloid tissue RNA to Trizol reagent.
2. cDNA the first chain synthetic agent box (RT-PCR) (Fermentas company, product article No.: K1622): 25mmol/LMgCl
24 μ L, 10 * reversed transcriptive enzyme damping fluid, 2 μ L, 10mmol/L dNTP2 μ L, RNA enzyme inhibitors (RNasin, a kind of acid glycoprotein) 0.5 μ L, Oligo (dT)
150.5 μ g, AMV reversed transcriptive enzyme 1.5U and without the RNase deionized water, cumulative volume 11 μ L.
3. primer, probe and standard substance: comprise m BCR fusion gene primer, inner positive control sequence primer, reference gene ABL primer and the Taqman fluorescent probe corresponding with primer, specific as follows:
M BCR fusion gene upstream primer sequence is: 5 '-CGCAAGACCGGGCAGAT-3 ' (sequence 1 in the sequence table);
MBCR fusion gene downstream primer sequence is: 5 '-AACGAGCGGCTTCACTCAGA-3 ' (sequence 2 in the sequence table);
M BCR fusion gene Taqman fluorescent probe: sequence 3 in FAM5 '-ACGATGGCGAGGGC-TAMRA3 ' TAMRA(sequence table);
Inner positive control sequence is: 5 '-CGCAAGACCGGGGACAUCUGGCCCAACGAUGCGGAGGGCGCCUUCCAUGGAGACGC AGAAGCCCUUCAGCGGCCAGUAGCAUCUGACUUUGAGCCUCAGGGUGUCAGUGAAG CCGCUCGUU-3 ' (sequence 7 in the sequence table);
Inner positive control sequence upstream primer sequence is: 5 '-CGCAAGACCGGGGACAT-3 ' (sequence 8 in the sequence table);
Inner positive control sequence downstream primer sequence is: 5 '-AACGAGCGGCTTCACTGACA-3 ' (sequence 9 in the sequence table);
Sequence 10 in inner positive control sequence Taqman fluorescent probe: TET5 '-ACGATGCGGAGGGC-3 ' TAMRA(sequence table);
ABL gene sequence: 5'-CAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAGTATCTGCTGAGCAGCGGGATCAATGGCAGCTTCTTGGTGCGTGAGAGTGAGAGCAGTCCTGGC-3’(The sequence of Sequence 11);
Abl gene upstream primer sequence is: 5 '-CCGGGTCTTAGGCTATAATCACA-3 ' (sequence 4 in the sequence table);
Abl gene downstream primer sequence is: 5 '-GCCTTGGCCATTTTTGGTT-3 ' (sequence 5 in the sequence table);
Sequence 6 in abl gene Taqman fluorescent probe: FAM5 '-TGGTGTGAAGCCC-3 ' TAMRA(sequence table);
Wherein, inner positive control sequence is artificial synthesized sequence, comprises the artificial composition sequence of the known mBCR fusion gene sequence of a part and a part; Inner positive control sequence and abl gene sequence are used separately as standard substance.
Above-mentioned primer sequence, control sequence, gene order and Taqman fluorescent probe sequence are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
4. negative control and positive control: with the negative contrast of deionized water, to contain the positive contrast of total RNA sample of mBCR fusion gene, RNA extracts reagent to adopt the test kit of the present invention that provides in above-described embodiment 1 to form 1.: Trizol reagent (Invitrogen company, product article No.: 15596-026/100ml), the ratio that adds 1ml Trizol reagent in every 1ml myeloid tissue, the acute lymphoblastic leukemia patient's of containing m BCR fusion gene that rapid extraction has been made a definite diagnosis myeloid tissue RNA is as positive control.
5. m BCR fusion gene fluorescence quantitative PCR reaction solution: formed by quantitative fluorescent PCR mixed solution and the primer, the probe that detect m BCR fusion gene: 1 * PCR premix (Qiagen company, product article No.: 210212,2 * PCRPremix), the Mg of 2.5-4.0mM
2+0.2-0.4mM dNTPs and the dUTP of 0.3-0.6mM, 0.2U/ the UNG enzyme of the Taq enzyme of μ L and 0.01-0.05U/ μ L, 0.25pmol/ the m BCR fusion gene upstream primer (sequence 1 in the sequence table) of μ L, 0.25pmol/ the m BCR fusion gene downstream primer (sequence 2 in the sequence table) of μ L, 0.3pmol/ the m BCR fusion gene Taqman fluorescent probe (sequence 3 in the sequence table) of μ L, 0.25pmol/ the positive control sequence upstream primer (sequence 8 in the sequence table) in the inside of μ L, 0.25pmol/ the positive control sequence downstream primer (sequence 9 in the sequence table) in the inside of μ L, 0.3pmol/ the positive control sequence Taqman fluorescent probe (sequence 10 in the sequence table) (above all concentration all refers to the final concentration of PCR reaction system) in the inside of μ L.Usually get the template (comprising cDNA and the synthetic cDNA of inner positive control sequence RNA reverse transcription that sample RNA reverse transcription is synthetic) of 1-2 μ L, all the other are without the RNase deionized water, and the reaction cumulative volume is generally 20 μ L.
6. ABL reference gene fluorescence quantitative PCR reaction solution: formed by quantitative fluorescent PCR mixed solution and the primer, the probe that detect the ABL reference gene: 1 * PCR premix (Qiagen company, 210212,2 * PCR Premix), the Mg of 2.5-4.0mM product article No.:
2+, the Taq enzyme of dUTP, 0.2U/ μ L of dNTPs, 0.3-0.6mM of 0.2-0.4mM and the UNG enzyme of 0.01-0.05U/ μ L, the ABL reference gene upstream primer (sequence 4 in the sequence table) of 0.25pmol/ μ L, the ABL reference gene downstream primer (sequence 5 in the sequence table) of 0.25pmol/ μ L, the abl gene Taqman fluorescent probe (sequence 6 in the sequence table) (above all concentration all refers to the final concentration of PCR reaction system) of 0.3pmol/ μ L.During detection, add abl gene standard substance template 2 μ L, all the other are without the RNase deionized water, and the reaction cumulative volume is generally 20 μ L.
7. inner positive control sequence fluorescence quantitative PCR reaction solution: formed by quantitative fluorescent PCR mixed solution and the primer, the probe that detect inner positive control sequence: 1 * PCR premix (Qiagen company, product article No.: 210212,2 * PCRPremix), the Mg of 2.5-4.0mM
2+, the Taq enzyme of dUTP, 0.2U/ μ L of the dNTPs of 0.2-0.4mM and 0.3-0.6mM and the UNG enzyme of 0.01-0.05U/ μ L, the positive control sequence upstream primer (sequence 8 in the sequence table) in inside of 0.25pmol/ μ L, the positive control sequence downstream primer (sequence 9 in the sequence table) in inside of 0.25pmol/ μ L, the positive control sequence Taqman fluorescent probe (sequence 10 in the sequence table) (above all concentration all refers to the final concentration of PCR reaction system) in inside of 0.3pmol/ μ L.During detection, usually get the template (cDNA that inner positive control sequence RNA reverse transcription is synthetic) of 1-2 μ L, all the other are without the RNase deionized water, and the reaction cumulative volume is generally 20 μ L.
3, the setting of pcr amplification program: on the lightcycler instrument first through 50 ℃ of 10s, 95 ℃ of 10min, and then through 95 ℃ of 15s, 60 ℃ of 1min, totally 40 circulations.
The test kit of embodiment 2. usefulness embodiment 1 preparation detects the expression amount of m BCR fusion gene mRNA
To detect 30 routine acute lymphoblastic leukemia Bone Marrow of Patients tissue sample results as example.
The testing process that the test kit of the present invention that provides with embodiment 1 detects m BCR fusion gene mRNA expression amount is: at first design specific primer and fluorescent probe according to gene order.Next obtains clinical leukaemic's myeloid tissue sample, and rapid extraction is organized RNA, carries out synthetic cDNA the first chain of reverse transcription PCR; Prepare first the fluorescence quantitative PCR reaction solution of ABL reference gene and inner positive control sequence, it is 1.0x10 that the positive control sequence standard substance in inside and ABL standard substance are diluted to respectively copy number/mL
3, 1.0x10
4, 1.0x10
5And 1.0x10
6Make respectively inner positive control sequence standard substance typical curve (shown in Figure 1A and Figure 1B) and abl gene standard substance typical curve (shown in Fig. 2 A and Fig. 2 B), and then preparation m BCR fusion gene fluorescence quantitative PCR reaction solution, carry out the fluorescence quantitative PCR detection sample, in the quantitative real time PCR Instrument data analysis system, read CT value result.Pcr amplification is at first analyzed inner positive control sequence amplification, if its Ct value is less than 33 after finishing, point out whole testing process effective, if its Ct value greater than 35, is pointed out and detected unsuccessfully, then need to re-start detection, if its Ct value is positioned between 33 ~ 35, need duplicate detection.When the positive control sequence Ct value in inside less than 33 the time, the real-time fluorescence quantitative PCR the data obtained is calculated, calculate respectively the Ct value of m BCR fusion gene and abl gene, both differences are Δ Ct value.At last, fluorescent quantitative PCR result adopts software analysis, and markization calculating sampled data.
Concrete steps are as follows:
1. the extracting of the total RNA of acute lymphoblastic leukemia myeloid tissue: the total RNA that presses the method extracting acute lymphoblastic leukemia myeloid tissue sample of RNA extracting and purifying.The RNA that extracts identifies its integrity through agarose gel electrophoresis, by purity and the concentration of ultraviolet spectrophotometer mensuration 260nm and 280nm optical density value calculating RNA, regulates each sample RNA of extracting to same concentrations with the water that 0.1%DEPC processes.
2. cDNA is synthesized in reverse transcription: get the above-mentioned RNA extracting solution of 2 μ L, at 70 ℃ of insulation 10min, the test kit of the present invention that adding subsequently embodiment 1 provides forms 2. cDNA the first chain synthetic agent box, that is: 25mmol/L MgC1
24 μ L, 10 * reversed transcriptive enzyme damping fluid, 2 μ L, 10mmol/L dNTPs2 μ L, RNA enzyme inhibitors 0.5 μ L, Oligo (dT)
150.5 μ g and AMV reversed transcriptive enzyme 1.5U add without the RNase deionized water to cumulative volume 20 μ L, in 42 ℃ of insulation 15min, carry out reverse transcription reaction, synthetic cDNA the first chain.Reaction is heated to 99 ℃ after finishing, and 5min adds 20 μ L sterilized water mixings and puts refrigerator-20 ℃ preservation with the deactivation reversed transcriptive enzyme.
Getting 1 μ L concentration is the inner positive control sequence RNA (sequence 7 in the sequence table) of 2 μ g/ml, and at 70 ℃ of insulation 10min, the test kit of the present invention that adding subsequently embodiment 1 provides forms 2. cDNA the first chain synthetic agent box, that is: 25mmol/L MgC1
24 μ L, 10 * reversed transcriptive enzyme damping fluid, 2 μ L, 10mmol/L dNTPs2 μ L, RNA enzyme inhibitors 0.5 μ L, Oligo (dT)
150.5 μ g and AMV reversed transcriptive enzyme 1.5U add without the RNase deionized water to cumulative volume 20 μ L, in 42 ℃ of insulation 15min, carry out reverse transcription reaction, synthetic cDNA.Reaction is heated to 99 ℃ after finishing, and 5min adds 20 μ L sterilized water mixings and puts refrigerator-20 ℃ preservation with the deactivation reversed transcriptive enzyme.
Getting 1 μ L concentration is the positive control RNA of 2 μ g/ml, and at 70 ℃ of insulation 10min, the test kit of the present invention that adding subsequently embodiment 1 provides forms 2. cDNA the first chain synthetic agent box, that is: 25mmol/L MgC1
24 μ L, 10 * reversed transcriptive enzyme damping fluid, 2 μ L, 10mmol/L dNTPs2 μ L, RNA enzyme inhibitors 0.5 μ L, Oligo (dT)
150.5 μ g and AMV reversed transcriptive enzyme 1.5U add without the RNase deionized water to cumulative volume 20 μ L, in 42 ℃ of insulation 15min, carry out reverse transcription reaction, synthetic cDNA.Reaction is heated to 99 ℃ after finishing, and 5min adds 20 μ L sterilized water mixings and puts refrigerator-20 ℃ preservation with the deactivation reversed transcriptive enzyme.
3. inside positive controlling gene sequence standard substance and ABL standard substance being diluted to respectively copy number/mL is 1.0x10
3, 1.0x10
4, 1.0x10
5And 1.0x10
6The fluorescence quantitative PCR reaction solution of the positive control sequence in the inside that provides with embodiment 1 and ABL reference gene is made respectively inner positive control sequence standard substance typical curve (shown in Figure 1A and Figure 1B) and ABL standard substance typical curve (shown in Fig. 2 A and Fig. 2 B).
4. m BCR fusion gene fluorescent quantitative PCR: the PCR reaction system is 20 μ L: contain 1 * PCR premix (Qiagen company, product article No.: 210212,2 * PCR Premix) 10.0 μ L, the Mg of 2.5-4.0mM
2+0.2-0.4mM dNTPs and the dUTP of 0.3-0.6mM, 0.2U/ the UNG enzyme of the Taq enzyme of μ L and 0.01-0.05U/ μ L, on the m BCR fusion gene, the downstream primer final concentration is 0.2 μ mol/L, m BCR fusion gene Taqman fluorescent probe final concentration 0.3 μ mol/L, the cDNA1.0 μ L that sample RNA reverse transcription is synthetic, the primer final concentration that adds simultaneously inner positive control sequence is 0.2 μ mol/L, the Taqman fluorescent probe final concentration 0.3 μ mol/L of inner positive control sequence, final concentration is the 2. synthetic cDNA of middle reverse transcription of the synthetic cDNA(of the inside positive control sequence RNA reverse transcription of 0.2 μ mol/L), add ultrapure water to cumulative volume 20 μ L.React at the lightcycler quantitative real time PCR Instrument: amplification condition: 95 ℃ of 10min denaturations, 95 ℃ of 15s then, 40 circulations of 60 ℃ of 1min amplifications, the amplification procedure Instrumental is collected fluorescent signal automatically.
5. ABL reference gene fluorescent quantitative PCR: the PCR reaction system is 20 μ L: contain 2 * PCR mixed solution (Qiagen company, product article No.: 210212,2 * PCR Premix) 10.0 μ L, the Mg of 2.5-4.0mM
2+, the Taq enzyme of dUTP, 0.2U/ μ L of the dNTPs of 0.2-0.4mM and 0.3-0.6mM and the UNG enzyme of 0.01-0.05U/ μ L, abl gene upstream and downstream primer final concentration is 0.2 μ mol/L, the Taqman fluorescent probe final concentration 0.2 μ mol/L of abl gene, abl gene cDNA1.0 μ L adds and mends to cumulative volume 20 μ L without the RNase deionized water.React at the lightcycler quantitative real time PCR Instrument: amplification condition is 95 ℃ of 10min denaturations, 95 ℃ of 15s then, and 40 circulations of 60 ℃ of 1min amplifications, the amplification procedure Instrumental is collected fluorescent signal automatically.
6. positive control, negative control fluorescent quantitative PCR: the PCR reaction system is 20 μ L: contain 2 * PCR mixed solution (Qiagen company, product article No.: 210212,2 * PCR Premix) 10.0 μ L, the Mg of 2.5-4.0mM
2+, the Taq enzyme of dUTP, 0.2U/ μ L of the dNTPs of 0.2-0.4mM and 0.3-0.6mM and the UNG enzyme of 0.01-0.05U/ μ L, m BCR fusion gene upstream and downstream primer final concentration is 0.2 μ mol/L, m BCR fusion gene Taqman fluorescent probe final concentration 0.3 μ mol/L, cDNA1.0 μ L or negative control deionized water 1.0 μ L that the positive control RNA reverse transcription is synthetic add and mend to cumulative volume 20 μ L without the RNase deionized water.React at the lightcycler quantitative real time PCR Instrument: amplification condition is 95 ℃ of 10min denaturations, 95 ℃ of 15s then, and 40 circulations of 60 ℃ of 1min amplifications, the amplification procedure Instrumental is collected fluorescent signal automatically.
7. data collection process and analysis: pcr amplification is at first analyzed inner positive control sequence amplification, if its Ct value less than 33, points out whole testing process effective, if its Ct value then needs to re-start detection greater than 35 after finishing.When the positive control sequence Ct value in inside less than 33 the time, the real-time fluorescence quantitative PCR the data obtained is calculated, draw m BCR fusion gene and carry out again statistical study after with respect to the relative expression quantity of ABL reference gene, with ratio more than or equal to 0.0001 positive expression, less than 0.0001 negative expression (specifically referring to table 1):
Table 1 is analyzed the expression of m BCR fusion gene in the acute lymphoblastic leukemia Bone Marrow of Patients for quantitative fluorescent PCR
| Sample | M BCR template | The ABL template | m BCR/ABL |
| Acute lymphoblastic leukemia | 7758991 | 318823477 | 0.02434 |
| Acute lymphoblastic leukemia | 7718284 | 151500230 | 0.05095 |
| Acute lymphoblastic leukemia | 912788 | 278557499 | 0.00328 |
| Acute lymphoblastic leukemia | 28022 | 278124665 | 0.00010 |
| Acute lymphoblastic leukemia | 551243 | 216755774 | 0.00254 |
| Acute lymphoblastic leukemia | 27748 | 316657072 | 0.00009 |
| Acute lymphoblastic leukemia | 67013 | 312665502 | 0.00021 |
| Acute lymphoblastic leukemia | 14551 | 217254752 | 0.00007 |
| Acute lymphoblastic leukemia | 91724 | 331725548 | 0.00028 |
| Acute lymphoblastic leukemia | 612541 | 313254364 | 0.00196 |
| Acute lymphoblastic leukemia | 152514 | 244718275 | 0.00062 |
| Acute lymphoblastic leukemia | 7195462 | 301727641 | 0.02385 |
| Acute lymphoblastic leukemia | 6612745 | 212485613 | 0.03112 |
| Acute lymphoblastic leukemia | 12664861 | 301828591 | 0.04196 |
| Acute lymphoblastic leukemia | 264661 | 301857780 | 0.00088 |
| Acute lymphoblastic leukemia | 27712635 | 307764186 | 0.09005 |
| Acute lymphoblastic leukemia | 127356 | 208177583 | 0.00061 |
| Acute lymphoblastic leukemia | 41982465 | 271845588 | 0.15443 |
| Acute lymphoblastic leukemia | 26486 | 296162748 | 0.00009 |
| Acute lymphoblastic leukemia | 126658 | 261774550 | 0.00048 |
| Acute lymphoblastic leukemia | 7749 | 186566127 | 0.00004 |
| Acute lymphoblastic leukemia | 317486 | 261554585 | 0.00121 |
| Acute lymphoblastic leukemia | 754861 | 175542965 | 0.00430 |
| Acute lymphoblastic leukemia | 21274658 | 271655854 | 0.07831 |
| Acute lymphoblastic leukemia | 3758 | 218566596 | 0.00002 |
| Acute lymphoblastic leukemia | 86265911 | 310576652 | 0.27776 |
| Acute lymphoblastic leukemia | 91759560 | 319757691 | 0.28697 |
| Acute lymphoblastic leukemia | 47585 | 331768965 | 0.00014 |
| Acute lymphoblastic leukemia | 9275861 | 236518950 | 0.03922 |
| Acute lymphoblastic leukemia | 19055 | 201757785 | 0.00009 |
Numerical value in the above-mentioned table in m BCR template and the ABL template all represents the fluorescence aggregate-value.
The test kit detectivity is estimated:
With qualitative PCR method detection method as a comparison, simultaneously above-mentioned 30 routine acute lymphoblastic leukemia myeloid tissue samples are detected, comparative result shows, it is more accurate than Immunohistochemical Method to adopt this test kit of the present invention to detect its susceptibility, specificity and sensitivity, meets present clinic diagnosis real requirement (specifically referring to table 2) fully:
Table 2 is that two kinds of different methods detect the comparison that m BCR fusion gene is expressed in the acute lymphoblastic leukemia
As seen from the above table, by qualitative PCR method check fluorescent quantitation, the qualitative PCR method is as reference, it is positive that fluorescent quantitation and qualitative PCR method detect 22 examples simultaneously, and the qualitative PCR method has detected 1 example feminine gender, draws thus, and the positive predictive value of fluorescent quantitation is 95.7%; It is negative that fluorescent quantitation and qualitative PCR method detect 7 examples simultaneously, all do not detect the positive, draws thus, and the negative predictive value of fluorescent quantitation is 100%.
Wherein:
1. specificity: 87.5%;
2. sensitivity: 100%;
3. positive predictive value: positive predictive value reaches 95.7%;
4. negative predictive value: negative predictive value reaches 100%;
5. repeated: repeatedly the repeated experiments result is consistent;
6. consuming time: as to be about 4h the detection time of a clinical samples, weak point consuming time, and Immunohistochemical Method about 72h consuming time.
Above-mentioned experiment can illustrate, adopt all higher fluorescence quantitative PCR detection m BCR fusion gene mRNA levels of susceptibility and specificity, specificity and the susceptibility of its detected result are significantly increased, adopt inner positive control sequence to monitor whole testing process, effectively guaranteed the quality of each detection.
The invention provides a kind of acute lymphoblastic leukemia m BCR fusion gene real-time fluorescence quantitative PCR detection kit that can monitor whole testing process, adopt artificial design and the positive control sequence in synthetic inside, the whole process that monitoring acute lymphoblastic leukemia m BCR fusion gene real-time fluorescence quantitative PCR detects, can effectively solve the false positive in the present acute lymphoblastic leukemia m BCR fusion gene real-time fluorescence quantitative PCR testing process, Problem of False Negative, so that detected result is more reliable, this test kit provides a kind of brand-new fast and convenient gene diagnosis technology for the gene type of acute lymphoblastic leukemia and chemotherapy and prognosis.
The above only is preferred embodiment of the present invention, and is in order to limit the present invention, within the spirit and principles in the present invention not all, any modification of doing, is equal to replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (7)
1. test kit that detects m BCR fusion gene mRNA expression amount, comprise and detecting with primer, fluorescent probe, cDNA the first chain synthetic agent, quantitative fluorescent PCR mixed solution, negative control and positive control, it is characterized in that, described detection comprises m BCR fusion gene primer, reference gene ABL primer and Taqman fluorescent probe with primer, fluorescent probe, wherein:
M BCR fusion gene upstream primer sequence is shown in SEQ ID NO:1 in the sequence table;
M BCR fusion gene downstream primer sequence is shown in SEQ ID NO:2 in the sequence table;
M BCR fusion gene Taqman fluorescent probe is shown in SEQ ID NO:3 in the sequence table;
Abl gene upstream primer sequence is shown in SEQ ID NO:4 in the sequence table;
Abl gene downstream primer sequence is shown in SEQ ID NO:5 in the sequence table;
Abl gene Taqman fluorescent probe is shown in SEQ ID NO:6 in the sequence table;
Described cDNA the first chain synthetic agent contains MgC1
2, reversed transcriptive enzyme damping fluid, dNTPs, RNA enzyme inhibitors, Oligo (dT)
15, AMV reversed transcriptive enzyme and without the RNase deionized water; Described quantitative fluorescent PCR mixed solution contains PCR premix, Mg
2+, dNTPs, dUTP, Taq enzyme, UNG enzyme and without the RNase deionized water.
2. test kit according to claim 1, it is characterized in that, described test kit also comprises primer and the Taqman fluorescent probe of inner positive control sequence, inner positive control sequence, and wherein: inner positive control sequence is shown in SEQ ID NO:7 in the sequence table; The upstream primer of inner positive control sequence is shown in SEQ ID NO:8 in the sequence table; The downstream primer of inner positive control sequence is shown in SEQ ID NO:9 in the sequence table; The Taqman fluorescent probe of inner positive control sequence is shown in SEQ ID NO:10 in the sequence table.
3. test kit according to claim 2, it is characterized in that, 5 ' end of the Taqman fluorescent probe of described m BCR fusion gene and the Taqman fluorescent probe of abl gene is connected with fluorescence report group FAM, 3 ' end all is connected with fluorescent quenching group TAMRA, 5 ' end of the Taqman fluorescent probe of inner positive control sequence is connected with fluorescence report group TET, and 3 ' end is connected with fluorescent quenching group TAMRA.
4. test kit according to claim 1 is characterized in that, the nucleotide sequence of described reference gene ABL is shown in SEQ ID NO:11 in the sequence table.
5. test kit according to claim 1 is characterized in that, described negative control is deionized water; Described positive control is the total RNA sample that contains m BCR fusion gene.
6. test kit according to claim 1 is characterized in that, described cDNA the first chain synthetic agent is: 25mmol/LMgC1
24 μ L, 10 * reversed transcriptive enzyme damping fluid, 2 μ L, 10mmol/L dNTP2 μ L, RNA enzyme inhibitors 0.5 μ L, Oligo (dT)
150.5 μ g, AMV reversed transcriptive enzyme 1.5U and without the RNase deionized water, cumulative volume 11 μ L.
7. test kit according to claim 1 is characterized in that, the mixed solution of described quantitative fluorescent PCR is: 1 * PCR premix, the Mg of 2.5-4.0mM
2+, 0.2-0.4mM dNTPs, 0.3-0.6mM dUTP, 0.2U/ μ L Taq enzyme, 0.01-0.05U/ μ L the UNG enzyme and without the RNase deionized water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210372120.5A CN102925556B (en) | 2012-09-29 | 2012-09-29 | Kit for detecting mRNA expression quantity of m BCR fusion gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210372120.5A CN102925556B (en) | 2012-09-29 | 2012-09-29 | Kit for detecting mRNA expression quantity of m BCR fusion gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102925556A true CN102925556A (en) | 2013-02-13 |
| CN102925556B CN102925556B (en) | 2014-09-17 |
Family
ID=47640480
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210372120.5A Active CN102925556B (en) | 2012-09-29 | 2012-09-29 | Kit for detecting mRNA expression quantity of m BCR fusion gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102925556B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106399462A (en) * | 2015-07-27 | 2017-02-15 | 上海睿玻生物科技有限公司 | BCR-ABL fusion gene amplification kit and BCR-ABL fusion gene detection kit |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060240434A1 (en) * | 2003-03-07 | 2006-10-26 | Jean Gabert | Standardized and optimized real-time quantitative reverse transcriptase polymerase chain reaction method for detection of mrd in leukemia |
| CN1995386A (en) * | 2006-08-22 | 2007-07-11 | 上海复星医药（集团）股份有限公司 | BCR-ABL gene fluorescence quantitative RT-PCR primer and probe and reagent kit |
| CN101168772A (en) * | 2007-11-09 | 2008-04-30 | 冯文莉 | BCR/ABL fusion gene mRNA fluorescence quantitative PCR detecting kit |
| CN101624621A (en) * | 2008-07-11 | 2010-01-13 | 北京大学人民医院 | Kit for quantitatively detecting BCR/ABL mRNA level |
| CN101701253A (en) * | 2009-11-26 | 2010-05-05 | 南方医科大学 | Double fluorescent quantitative PCR kit used for detecting gene expression |
| CN102251031A (en) * | 2011-06-30 | 2011-11-23 | 北京思尔成生物技术有限公司 | TaqMan MGB probe real-time fluorescence PCR detection method for leukemia fusion genes, and special primers, probes and kit used by same |
| CN102649977A (en) * | 2012-04-27 | 2012-08-29 | 南京艾迪康医学检验所有限公司 | Kit for detecting relative expression index of leukemia BCR/ABL (m-bcr) fusion gene |
-
2012
- 2012-09-29 CN CN201210372120.5A patent/CN102925556B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060240434A1 (en) * | 2003-03-07 | 2006-10-26 | Jean Gabert | Standardized and optimized real-time quantitative reverse transcriptase polymerase chain reaction method for detection of mrd in leukemia |
| CN1995386A (en) * | 2006-08-22 | 2007-07-11 | 上海复星医药（集团）股份有限公司 | BCR-ABL gene fluorescence quantitative RT-PCR primer and probe and reagent kit |
| CN101168772A (en) * | 2007-11-09 | 2008-04-30 | 冯文莉 | BCR/ABL fusion gene mRNA fluorescence quantitative PCR detecting kit |
| CN101624621A (en) * | 2008-07-11 | 2010-01-13 | 北京大学人民医院 | Kit for quantitatively detecting BCR/ABL mRNA level |
| CN101701253A (en) * | 2009-11-26 | 2010-05-05 | 南方医科大学 | Double fluorescent quantitative PCR kit used for detecting gene expression |
| CN102251031A (en) * | 2011-06-30 | 2011-11-23 | 北京思尔成生物技术有限公司 | TaqMan MGB probe real-time fluorescence PCR detection method for leukemia fusion genes, and special primers, probes and kit used by same |
| CN102649977A (en) * | 2012-04-27 | 2012-08-29 | 南京艾迪康医学检验所有限公司 | Kit for detecting relative expression index of leukemia BCR/ABL (m-bcr) fusion gene |
Non-Patent Citations (2)
| Title |
|---|
| M.AMABILE ET AL: "Real-time quantification of different types of bcr-abl transcript in chronic myeloid leukemia", 《HAEMATOL》 * |
| 林江等: "用实时定量PCR检测慢性髓系白血病患者的bcr/abl~(P210)融合基因转录本", 《临床检验杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106399462A (en) * | 2015-07-27 | 2017-02-15 | 上海睿玻生物科技有限公司 | BCR-ABL fusion gene amplification kit and BCR-ABL fusion gene detection kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102925556B (en) | 2014-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Qin et al. | Potential role of circulating microRNAs as a biomarker for unexplained recurrent spontaneous abortion | |
| CN102827937B (en) | Primer and probe for detecting relative fusion genes of leukemia and kit of primer and probe | |
| CN102776185B (en) | Liver cancer diagnostic marker composed of blood plasma microRNA (micro ribonucleic acid) and new method for diagnosing liver cancer | |
| CN110305948A (en) | A kind of reagent and method detecting self-closing disease related gene UBE3A copy number | |
| CN104862310A (en) | Schizophrenia biomarker, screening method and kit | |
| CN103937888A (en) | Screening method and application of plasma microRNA markers for identifying gastric cancer | |
| CN102094074A (en) | Fluorescent reverse transcription-polymerase chain reaction (RT-PCR) kit for quantitatively detecting leukemia fusion gene TEL-AML1 | |
| CN102925558A (en) | Kit for detecting mRNA expression level of PML-RARa fusion gene | |
| CN106250717B (en) | The miRNA of acute myeloid leukaemia and the system of transcription factor and its construction method and application | |
| CN102912018B (en) | Kit for detecting expression index of mRNA (messager Ribose Nucleic Acid) of WT1 (Wilms Tumor 1) gene | |
| CN102925575A (en) | Kit for detecting protein expression indexes of test equipment list-acute myelogenous leukemia1 (TEL-AML1) fusion gene messenger ribonucleic acid (mRNA) | |
| CN106884052A (en) | A kind of curative effect of pulmonary tuberculosis kits for evaluation based on serum miRNA composition and application thereof | |
| CN102925559B (en) | Kit for quantitatively detecting W515 site mutation of MPL genes | |
| Guo et al. | Serum microRNA-155 in early diagnosis and prognosis of breast cancer | |
| CN104131113A (en) | miRNA detection kit and application thereof | |
| CN102925556B (en) | Kit for detecting mRNA expression quantity of m BCR fusion gene | |
| CN104195255A (en) | Kit for detecting fusion gene AML1-ETO mRNA expression and detection method using kit | |
| CN103571945A (en) | Method, primer, probe and kit for screening and identifying BCR-ABL unusual fusion types | |
| CN108300788A (en) | A kind of micro RNA combination and its application for detecting light-duty brain trauma | |
| CN114807124B (en) | Primer and probe composition for detecting ALK fusion gene, kit and method | |
| CN102925573B (en) | Kit for detecting protein expression indexes of acute myelogenous leukemia1-eighttwentyone (AML1-ETO) fusion gene messenger ribonucleic acid (mRNA) | |
| CN103014154A (en) | Kit capable of detecting expression quantity of BAALC (brain and acute leukemia cytoplasmic) gene mRNA (Messenger Ribose Nucleic Acid) | |
| CN107299129A (en) | Circle nucleic acid as breast cancer biomarker application | |
| CN102965433A (en) | Kit for detecting mRNA expression quantity of M BCR fusion gene | |
| CN103352070B (en) | ROS1 fusion gene screening method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191127 Address after: 511442 building 3, No.255, Xingye Avenue East, Nancun Town, Panyu District, Guangzhou City, Guangdong Province Patentee after: Guangzhou City, Panyu District Huaxin Technology Co. Ltd. Address before: 430060 No. 99 Zhang Zhidong Road, Wuchang District, Hubei, Wuhan Co-patentee before: Li Yan Patentee before: Tong Yongqing |
|
| TR01 | Transfer of patent right |