CN102925404A - Genetic engineering strain enriched with heavy cadmium, as well as construction and application thereof - Google Patents

Abstract

The invention belongs to the technical field of biological engineering, relates to a cadmium-enriched genetic engineering strain, and a construction and an application thereof, and in particular relates to the construction of the cadmium-enriched genetic engineering strain and a strain formed by construction of the cadmium-enriched genetic engineering strain, as well as representation of cadmium tolerance, cadmium absorption and other functions of the strain. The genetic engineering strain enriched with heavy cadmium, which is obtained by adopting the construction method disclosed by the invention, is classified and named as Pseudomonasputida KT2440-SpPCS, and the collection number is CCTCCNO: M 2012435. The construction process is mainly as follows: a molecular biology means is used for heterologous expression of Schizosaccharomycespombe phytochelatin in Pseudomonas putida KT2440 for synthesizing an enzyme gene SpPCS, and the genetic engineering strain obtained by the construction method disclosed by the invention can be used as a plant growth promoting bacteria so as to lay a foundation for follow-up research of repair of a heavy metal by coordination and synergy with a plant.

Description

Genetic engineering bacterium and structure and the application of the heavy cadmium of enrichment

Technical field

The invention belongs to technical field of bioengineering, relate to cadmium enrichment genetic engineering bacterium and construction process thereof and application, specifically refer to the strain bacterial strain that cadmium enrichment construction of genetic engineering and structure thereof obtain, also relate to the sign of the functions such as the cadmium tolerance of this bacterial strain and cadmium absorption.

Background technology

The plurality of heavy metal that is produced by the industrial and agricultural production activity has caused very severe harm to human and ecotope, such as Cd, Hg, As, Pb etc., can replace Zn, Fe, Cu and other some non-heavy metal elements, destroy them as the cofactor effect of some albumen and enzyme, thereby disturb the normal physiological Metabolic activity of organism.And most of heavy metal can rest in the ambient soil for a long time, with traditional physico-chemical process reparation, comprise and utilize chemical reagent extraction, electrochemistry, emergency burial etc., often cost prohibitive, inefficiency, even can change the physics and chemistry structure of soil, greatly reduce soil fertility.

In recent years, the biological restoration mode take genetic engineering bacterium as the basis is just more and more paid attention to advantages such as its economy and validity.Pseudomonas putida ( Pseudomonas putida) be the strain environmental advantage bacterial strain with very strong anti-adversity, the Some Organic Pollutants in the environment of can degrading such as toluene, and has certain heavy metal (such as Cu and Cd) tolerance etc.Pseudomonas putida KT2440 ( Pseudomonas putidaKT2440) be a strain pattern environmental microorganism bacterial strain, it also is the saprophytic pseudomonas that so far genetic research is set forth the most clearly, metabolism diversity is studied the most thoroughly, and as plant growth-promoting rhizobacteria, can with the plant mating reaction, strengthen the viability of plant in environment-stress especially heavy metal contamination.Pseudomonas putida KT2440 genome is resolved in 2002, is first resolved pseudomonas putida bacterial strain.Because its genetic operating system is simply clear, be one of first-selected gene clone, gram negative strain of expression.

Utilize at present the mechanism of the heavy-metal contaminated soil in the microorganism repairing and treating soil to comprise that organic acid by the thalline secretion and amino acid whose solvency action, microorganism are to the biotransformation of heavy metal etc.And derive from the phytochelatin synthase of fission yeast, lower algae and majority of plant, under the inducing of heavy metal ion, can the low-molecular-weight gsh of catalysis (GSH) and generate the phytochelatin (γ-Glu-Cys) n-Gly(n=2-11) of relative high molecular by transpeptidation reaction, the latter has more non-albumen sulfydryl (NPT) polypeptide of strong metal sequestering power.Studies show that, by E.coliMiddle heterogenous expression grain wine split yeast ( Schizosaccharomyces pombe) SpPCSGene and wheat AtPCSGene is the anti-Cd ability of enhancement engineering bacterium obviously, and can improve the semi-invariant (reach respectively 14.9 μ mol/g[dry weight] and 7.2 μ mol/g[dry weight]) of Cd in the thalline.

Summary of the invention

First technical purpose of the present invention be to provide a strain new can the enriching heavy metal cadmium the pseudomonas putida genetic engineering bacterium; So that the engineering strain that the present invention obtains has the plant growth-promoting bacteria of can be used as, can cooperate with plant the potentiality of collaborative restoration of soil polluted by heavy metal.

Second technical purpose of the present invention is to provide the construction process of said gene engineering strain, this construction process be a kind of in pseudomonas putida KT2440 the heterogenous expression schizosaccharomyces pombe ( Schizosaccharomyces pombe)The phytochelatin synthase gene SpPCSGene engineering method.

The 3rd technical purpose of the present invention is the application of said gene engineering strain in cooperating plant cooperated repairing heavy metal in soil pollution.

For realizing technical purpose of the present invention, the present invention by the following technical solutions.

One, adopt the genetic engineering bacterium of the heavy cadmium of a strain enrichment that construction process of the present invention obtains, its Classification And Nomenclature be pseudomonas putida ( Pseudomonas putida) KT2440-SpPCS, its deposit number is: CCTCC NO:M 2012435.

But two, pseudomonas putida of the present invention ( Pseudomonas putida) construction process of KT2440-SpPCS: with environmental pattern bacterial strain pseudomonas putida ( Pseudomonas putida) KT2440 is the bacterium that sets out, recombinant expressed schizosaccharomyces pombe ( Schizosaccharomyces pombe) gene SpPCS, the target gene engineering bacteria that acquisition can the enriching heavy metal cadmium.

Concrete steps are as follows:

1) take the schizosaccharomyces pombe genomic dna as template, pcr amplification goes out SpPCSGene is connected to sequencing vector PMD19-T Simple plasmid through the T-A clone, chooses correct transformant, and through order-checking, comparison is correct, obtains comprising expressing gene SpPCSMiddle interstitial granules PMD19-T- SpPCS

2) the design restriction enzyme site will SpPCSBe inserted between the corresponding restriction enzyme site of expression plasmid pBBR1MCS-5 carrier, connect and obtain recombinant plasmid pBBR1MCS-5- SpPCS

3) with the recombinant plasmid pBBR1MCS-5-that builds SpPCSElectric shock transforms and to import in the competent cell of pseudomonas putida KT2440, through the gentamicin screening of 50 μ g/mL obtain positive transformant be pseudomonas putida ( Pseudomonas putida) KT2440-SpPCS.

Three, the application of cadmium enrichment genetic engineering bacterium of the present invention, particularly, refer to pseudomonas putida ( Pseudomonas putida) KT2440-SpPCS cooperates the application in polluting of plant cooperated repairing heavy metal in soil.

To the checking of above-mentioned application method comprise mainly that the cadmium tolerance significantly improves, cadmium accumulation ability showed increased, non-albumen sulfydryl output significantly improve three steps.

(1) the cadmium tolerance detects:

Starting strain and recombination engineering strain of the present invention are contained overnight incubation in the seed liquor of corresponding resistant at 5 mL, be switched in the triangular flask that contains 100 mL nutrient solutions, work as OD ₆₀₀=0.5 o'clock, add 0.6 mM IPTG and induce, after 1 hour, add 500 μ M Cadmium chloride fine powdeies, afterwards every two hours at OD ₆₀₀Measure cell density under the condition.

Recombinant bacterium and empty plasmid are transferred respectively in the triangular flask of 50 mL nutrient solutions to overnight incubation in the seed liquor that impinges upon corresponding resistant, work as OD ₆₀₀=0.5 o'clock, add 0.6 mM IPTG and induce, work as OD ₆₀₀=1.0 o'clock, respectively by 1,10 ^-2, 10 ^-4, 10 ^-6Extent of dilution, get 100 μ L bacterium liquid and be coated on different concns Cd ²⁺Resistant panel on, cultivate after 30 hours for 30 ℃, taking-up is taken pictures.

(2) the cadmium accumulation ability detects: the recombinant bacterium of switching incubated overnight and contrast empty plasmid bacterial strain are worked as OD in 25mL LB liquid nutrient medium ₆₀₀=0.5 o'clock, the cadmium chloride solution and the 0.6mM IPTG that add different concns induce, 30 ℃ are continued to cultivate 5 hours, receive bacterium, with 5mM HEPES(pH 7.1,0.85% NaCl) lower dry 24 hours of twice, 65 ℃ on bacterium, concentrated nitric acid with 70% is processed and is spent the night, and gets solvend and detects the cadmium absorbed dose with the sampling Graphite Furnace Atomic Absorption spectrophotometer under 228.8 nm.

(3) non-albumen sulfydryl (NPT) detects: original bacterium and recombinant bacterium add the Cadmium chloride fine powder of different concns after 1 hour after 0.6 mM IPTG induces, after 10 hours, thalline cools off in liquid nitrogen rapidly, grind thoroughly broken.Take 300 mL and contain 1 M NaOH and 1mg/L NaBH ₄Solution dissolving, 4 ℃ of lower centrifugal 5 min of 13000 g get supernatant contains 37% (w/v) with 50 mL HCl acidifying.The detection of total NPT is got 10 mL sample liquid and is added 500 mL Ellman ' s reagent 5,5'-dithiobis (2-nitrobenzoic acid)] (DTNP), 30 ℃ of reactions detected absorbancy after two minutes at 412 nm places.

Beneficial effect of the present invention is:

The present invention will derive from schizosaccharomyces pombe ( Schizosaccharomyces pombe) the phytochelatin synthase gene ( SpPCS) by engineered method success heterogenous expression in pseudomonas putida KT2440, successfully made up Cd has been polluted the bioengineered strain with certain biological restoration potentiality, can improve dramatically endobacillary non-albumen sulfydryl (NPT) content and to the tolerance of heavy metal cadmium, detecting genetic engineering bacterium through sampling Graphite Furnace Atomic Absorption can the more heavy metal cadmium of enrichment, no matter be to original starting strain KT2440 and gene ( SpPCS) the source bacterial strain, it has realized beyond thought effect, be the wide host's carrier of first passage pBBR1MCS-5 in pattern environment bacterial strain pseudomonas putida KT2440 successful expression the phytochelatin synthase gene of schizosaccharomyces pombe, and can improve to a certain extent in heavy metal cadmium tolerance, cadmium enriching quantity and the cell of Host Strains sulfydryl total amount with the cadmium chelating.And pseudomonas putida can cooperate it as the plant growth-promoting effect of plant growth-promoting bacteria with some hyperaccumulative plant or general common plant, to reach better phytoremdiation.

Description of drawings

Fig. 1 phytochelatin synthase gene ( SpPCS) electrophorogram of pcr amplification product.

The wide host expresses carrier of Fig. 2 pBBR1MCS-5 -SpPCSThe structure collection of illustrative plates.

Fig. 3 expression vector pBBR1MCS-5 -SpPCSEnzyme cut the evaluation collection of illustrative plates.

Fig. 4 expression vector pBBR1MCS-5 -SpPCSThe enzyme that imports pseudomonas putida KT2440 is cut the evaluation collection of illustrative plates.

The SDS-PAGE electrophorogram that Fig. 5 recombinant protein is expressed in pseudomonas putida KT2440.

The original bacterium of Fig. 6 and genetic engineering bacterium at 0.5 mM Cd ²⁺Growth curve chart under coercing.

Fig. 7 bacterial strain of the present invention and empty plasmid control strain are at different concns Cd ²⁺Cd impact experiment figure with different OD values.

The engineering bacteria of Fig. 8 empty plasmid control strain and different transformants is induced 4 hours cadmium absorbed dose in 30 μ M cadmium chloride solutions.

Fig. 9 empty plasmid control strain and bacterial strain of the present invention are induced the cadmium absorbed dose of different time in 30 μ M cadmium chloride solutions.

Figure 10 empty plasmid control strain and bacterial strain of the present invention are to impinging upon the cadmium absorbed dose of inducing 3 hours in the different concentrations of cadmium chloride.

Figure 11 empty plasmid control strain and growth differences and the NPT content balance of bacterial strain of the present invention under different Cd concentration.

Wherein, pBB:KT2440-pBBR1MCS-5-empty plasmid control strain, PCS:KT2440-SpPCS invention bacterial strain; PBB-I, pBB+I: the empty plasmid control strain does not add IPTG, adds IPTG; PCS-I, PCS+I: the invention bacterial strain does not add IPTG, adds IPTG.

Bacterial strain of the present invention, its Classification And Nomenclature are pseudomonas putida Pseudomonas putidaKT2440-SpPCS; Its preservation mechanism full name is Chinese Typical Representative culture collection center, is called for short CCTCC, and the address is China. Wuhan. and Wuhan University; Preservation date is on October 28th, 2012, and preserving number is numbered: CCTCC NO:M 2012435.

Embodiment

The following examples elaborate to the present invention, but to not restriction of the present invention.

The explanation in the source of biomaterial of the present invention:

1, plasmid source:

(1) PMD19-T Simple: available from Promega company.

(2) pBBR1MCS-5 source: microorganism journal (2006) 46:763-766.The applicant is at first by finding the above-mentioned document source of this biomaterial, and contacted utterer Li Shunpeng professor, asks its this biomaterial of gifting, and freely obtained this biomaterial; And the applicant states at this, guarantees to provide this biomaterial to the public in 20 years from the application's day.

2, the schizosaccharomyces pombe genomic dna ( SpPCSGene accession number NM_001018985) source:

New?Phytologist?(2003)?159:?323–330。The applicant is at first by finding the above-mentioned document source of this biomaterial, and contacted utterer Stephan Clemens, and its this biomaterial of gifting of mail requests, and freely obtained this biomaterial; And the applicant states at this, guarantees to provide this biomaterial to the public in 20 years from the application's day.

3, starting strain: the source of the competence bacterial strain of pseudomonas putida KT2440:

Soil?Biology?&?Biochemistry,?32(2000)?315-321。The applicant is at first by finding the above-mentioned document source of this biomaterial, and contacted utterer J.L. Ramos, and its this biomaterial of gifting of mail requests, and freely obtained this biomaterial; And the applicant states at this, guarantees to provide this biomaterial to the public in 20 years from the application's day.

4, the design of primer and synthetic: designed, designed and outer Si Rui covered with gold leaf biotech company are synthetic.

Embodiment 1

The present embodiment explanation makes up and comprises expressing gene SpPCSMiddle interstitial granules PMD19-T- SpPCSMethod.Its process comprises:

1, synthetic upstream primer and downstream primer without restriction enzyme site of design,

Primer1 upstream primer: 5 '-ATGAACATTGTTAAACGAGCA-3 ';

Primer2 downstream primer: 5 '-TCACGTATTTTTACAGCA-3 '.

2, take the schizosaccharomyces pombe genomic dna as template, pcr amplification goal gene fragment the results are shown in Figure 1, and reaction conditions is: 94 ° of C denaturation 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1.5 min, 72 ℃ of 5 min, 30 circulations.Pcr amplification goes out SpPCSBehind the gene, be connected to sequencing vector PMD19-T Simple plasmid through the T-A clone, the transformant that picking is correct, through order-checking, comparison is correct, obtains comprising expressing gene SpPCSMiddle interstitial granules PMD19-T- SpPCS

Embodiment 2

The present embodiment explanation makes up and comprises expressing gene SpPCSRecombinant plasmid pBBR1MCS-5- SpPCSMethod, specifically the structure approach is seen Fig. 2.Its process comprises:

1, comprises gene SpPCSRecombinant plasmid pBBR1MCS-5- SpPCSStructure,

(1) synthetic with Sal1The downstream primer of the upstream primer of restriction enzyme site and EcoR1 restriction enzyme site:

The Primer3 upstream primer:

5’-?GCG GTCGAC ATGAACATTGTTAAACGAGCA?-3’；

The Primer4 downstream primer:

5’-?GGG GATATC TCACGTATTTTTACAGCA?-3’。

(2) with PMD19-T- SpPCSBe template, pcr amplification goal gene fragment, reaction conditions is: the PCR reaction conditions is: 94 ℃ of denaturation 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1.5 min, 72 ℃ of 5 min, 30 circulations.Purifying amplifies with restriction enzyme site SpPCSBehind the gene, be connected with the pBBR1MCS-5 expression plasmid of cutting through same restriction enzyme site enzyme, enzyme is cut result's (seeing Fig. 3 and Fig. 4) and is shown recombinant plasmid pBBR1MCS-5- SpPCSSuccessfully construct.

Embodiment 3

The present embodiment explanation is with the recombinant plasmid pBBR1MCS-5-that builds SpPCSElectric shock transforms and imports in the competent cell of pseudomonas putida KT2440, obtains the method for positive transformant KT2440-SpPCS through the gentamicin screening of 50 μ g/mL.

(1) preparation of KT2440 competent cell: at flat board activation KT2440 bacterial strain; Choose single bacterium colony after 20 hours, be inoculated in the 5mL LB seed liquor; Transfer in 100 mL LB nutrient solutions by 1% inoculum size after 12 hours; When OD600=0.6 ~ 0.75, immediately in ice bath on ice 20 minutes; 4 ℃, 5000 r/min received bacterium, and washed bacterium 3 times with HEPES damping fluid (3 mM, pH=7.0) in centrifugal 10 minutes; Add 500 μ L HEPES buffering resuspended, 500 μ L, 20% glycerine, per 50 μ L packing are used for once electricity conversion.

(2) electric conversion condition: get 50 ng recombinant plasmids, press following Studies on Electroporation Transformation: 1.2 kV, 200 Ω, 25 μ F, 1mm electricity revolving cup.After suspending with 1 mL SOC substratum, change in the 15 mL polyacrylamide centrifuge tubes 30 ℃ of recoveries over to after 2 hours, obtaining positive transformant through the gentamicin screening of 50 μ g/mL is purpose bacterial strain KT2440-SpPCS.Other gets 50 ng pBBR1MCS-5 empty plasmids, obtains empty plasmid control strain KT2440-pBBR1MCS-5 by the same terms.

Embodiment 4

The present embodiment explanation SDS-PAGE gel electrophoresis plant identification chelating peptide synthetic enzyme expression of results.

Import the engineering bacteria KT2440-of recombinant plasmid SpPCS, successful expression goes out phytochelatin synthase after 30 ℃ of lower cultivations.SDS-PAGE electrophoresis result (Fig. 5) shows, import thalline (the 2nd, 3,4,5 bands of recombinant plasmid, represent respectively with IPTG and induced 3,4,5,6 hours) a specific assorted band arranged above 45KDa, arrow is pointed out, with the expection in the same size, and prolong in time, the protein content of this purpose band is more and more, and in the original bacterium (the first band) without this band.

Embodiment 5

The contrast that contains genetic engineering bacterium KT2440-SpPCS and the tolerance of starting strain KT2440 cadmium, cadmium accumulation ability and non-albumen sulfhydryl content that the present embodiment explanation successfully constructs.

1, cadmium tolerance performance comparison:

Set out bacterium and recombinant bacterium of KT2440 contains overnight incubation in the LB seed liquor of corresponding resistant at 5 mL, is switched in the triangular flask that contains 100 mL LB nutrient solutions, works as OD ₆₀₀=0.5 o'clock, add 0.6 mM IPTG and induce, after 1 hour, add 500 μ M Cadmium chloride fine powdeies, afterwards every two hours at OD ₆₀₀Measure cell density under the condition, the growth curve chart that obtains is seen Fig. 6, and as can be seen from Figure, under the liquid condition was cultivated, the growing state under genetic engineering bacterium KT2440-SpPCS high density chlorination cadmium is coerced was more much better than starting strain KT2440.

Recombinant bacterium and empty plasmid control strain be overnight incubation in the LB of corresponding resistant seed liquor, transfers respectively in the triangular flask of 50 mL LB nutrient solutions, works as OD ₆₀₀=0.5 o'clock, add 0.6 mM IPTG and induce, work as OD ₆₀₀=1.0 o'clock, respectively by 1,10 ^-2, 10 ^-4, 10 ^-6Extent of dilution, get 100 μ L bacterium liquid and be coated on different concns Cd ²⁺Resistant panel on, cultivate after 30 hours for 30 ℃, taking-up is taken pictures.The results are shown in Figure 7, as can be seen from Figure, on the Cadmium chloride fine powder flat board of different concns, under the extent of dilution of different bacterium liquid, genetic engineering bacterium KT2440- SpPCSAll look good than starting strain KT2440, show that KT2440-SpPCS has better Cd tolerance than KT2440.

2, cadmium accumulation ability contrast: the engineering bacteria of anti-cadmium KT2440-SpPCS of switching incubated overnight and empty plasmid control strain are worked as OD in 25mL LB liquid nutrient medium ₆₀₀=0.5 o'clock, the cadmium chloride solution and the 0.6mM IPTG that add different concns induce, and 30 ℃ are continued to cultivate 5 hours, receive bacterium, with 5mM HEPES(pH 7.1,0.85% NaCl) washed twice, 65 ℃ of lower drying of bacterium 24 hours, the Cadmium chloride fine powder with 70% is processed and is spent the night, get solvend and under 228.8nm, detect the cadmium absorbed dose with the sampling Graphite Furnace Atomic Absorption spectrophotometer, the various data resultss of gained are seen Fig. 8-Figure 10, as we know from the figure, import expression plasmid pBBR1MCS-5- SpPCSThe different transformants of genetic engineering bacterium KT2440-SpPCS, at the Cd of different time and different concns ²⁺Under the cadmium absorbed dose all many than empty plasmid contrast.

3, non-albumen sulfydryl (NPT) content balance: KT2440 starting strain and recombinant bacterium KT2440-SpPCS add the Cadmium chloride fine powder of different concns after 1 hour after 0.6 mM IPTG induces, after 10 hours, thalline cools off in liquid nitrogen rapidly, grind thoroughly broken.Take 300 mL and contain 1 M NaOH and 1 mg/L NaBH ₄Solution dissolving, 4 ℃ of lower centrifugal 5min of 13000 g get supernatant contains 37% (w/v) with 50 mL HCl acidifying.The detection of total NPT, get 10 mL sample liquid and add 500 mL Ellman ' s reagent 5,5'-dithiobis (2-nitrobenzoic acid)] (DTNP), 30 ℃ were reacted two minutes, detect absorbancy at 412 nm places, gained the results are shown in Figure 11, as can be seen from the figure: 1) when heavy metal stress and SpPCSDuring genetic expression, non-albumen sulfydryl total amount can increase thereupon, and increases along with the increase of concentration of heavy metal ion; 2) there be not Cd to coerce down, original bacterium and recombinant bacterium growth and the basic indifference of NPT total amount; 20 μ mol Cd induce down, both indifferences of growing, and the NPT total amount of recombinant bacterium is apparently higher than original bacterium; As Cd during at 500-700 μ mol, the recombinant bacterium growing state is better than original bacterium, in this result consistent be that the NPT total amount of recombinant bacterium also will be significantly higher than original bacterium.

The present embodiment proves, construction process by genetic engineering bacterium KT2440-SpPCS of the present invention, its recombinant pseudomonas putida KT2440-SpPCS that obtains can be tolerated and the enriching heavy metal cadmium, there is bibliographical information to cross before abroad and in intestinal bacteria and yeast saccharomyces cerevisiae, expresses different phytochelatin synthase genes, with the cadmium of raising Host Strains and tolerance and the accumulation ability of other heavy metal, mostly be its zymologic property is carried out qualitative examination, and because intestinal bacteria and yeast saccharomyces cerevisiae itself are not the environmental pattern bacterial strain, using it for edatope repairs several without possibility, and the pseudomonas putida KT2440 that uses in this experiment itself just has good metal tolerance, and can be used as plant growth-promoting rhizobacteria can Promoting plant growth, the heavy metal that utilizes its expression to be present in the phytochelatin synthase gene repair contaminate environment in the eukaryote yet there are no report, and this microorganism for Heavy-metal Polluted Environment is provided by a kind of novelty and the feasible method of providing.

Claims (4)

1. the genetic engineering bacterium of the heavy cadmium of a strain enrichment, its Classification And Nomenclature be pseudomonas putida ( Pseudomonas putida) KT2440-SpPCS, its deposit number is: CCTCC NO:M 2012435.

Smelly pseudomonas claimed in claim 1 ( Pseudomonas putida) construction process of KT2440-SpPCS, it is characterized in that: with environmental pattern bacterial strain pseudomonas putida ( Pseudomonas putida) KT2440 is the bacterium that sets out, recombinant expressed schizosaccharomyces pombe ( Schizosaccharomyces pombe) gene SpPCS, the target gene engineering bacteria that acquisition can the enriching heavy metal cadmium.

3. construction process according to claim 2 is characterized in that concrete steps are as follows:

1) take the schizosaccharomyces pombe genomic dna as template, pcr amplification goes out SpPCSGene is connected to sequencing vector PMD19-T Simple plasmid through the T-A clone, chooses correct transformant, and through order-checking, comparison is correct, obtains comprising expressing gene SpPCSMiddle interstitial granules PMD19-T- SpPCS

2) the design restriction enzyme site will SpPCSBe inserted between the corresponding restriction enzyme site of expression plasmid pBBR1MCS-5 carrier, connect and obtain recombinant plasmid pBBR1MCS-5- SpPCS

3) with the recombinant plasmid pBBR1MCS-5-that builds SpPCSElectric shock transforms and to import in the competent cell of pseudomonas putida KT2440, through the gentamicin screening of 50 μ g/mL obtain positive transformant be pseudomonas putida ( Pseudomonas putida) KT2440-SpPCS.

Pseudomonas putida claimed in claim 1 ( Pseudomonas putida) KT2440-SpPCS cooperates the application in polluting of plant cooperated repairing heavy metal in soil.

Images