CN102911890A - Pseudomonas capable of metabolizing diethylstilbestrol and application thereof - Google Patents
Pseudomonas capable of metabolizing diethylstilbestrol and application thereof Download PDFInfo
- Publication number
- CN102911890A CN102911890A CN2011102289313A CN201110228931A CN102911890A CN 102911890 A CN102911890 A CN 102911890A CN 2011102289313 A CN2011102289313 A CN 2011102289313A CN 201110228931 A CN201110228931 A CN 201110228931A CN 102911890 A CN102911890 A CN 102911890A
- Authority
- CN
- China
- Prior art keywords
- stilboestrol
- pseudomonas
- metabolism
- application
- degraded
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to the field of environmental management through microorganisms, in particular to pseudomonas capable of metabolizing diethylstilbestrol and an application thereof. The pseudomonas capable of metabolizing diethylstilbestrol is named as J61, and is registered and preserved in China General Microbiological Culture Collection Center (CGMCC); the preservation date is April, 28th, 2011; and the number is CGMCC No.4705. The pseudomonas capable of metabolizing the diethylstilbestrol is capable of degrading the diethylstilbestrol in the environment. Through the strain provided by the invention, the diethylstilbestrol of 80 ppm is effectively degraded, so that the corresponding environmental-friendly biological preparation is developed, and good application prospect is shown.
Description
Technical field
The present invention relates to utilize microorganism to carry out the environmental improvement field, but the specifically pseudomonas of metabolism stilboestrol and application thereof.
Background technology
Stilboestrol (DES, Diethylstilbestrol), chemistry 4,4 (1,2-diethyl-1 by name, the 2-vinylidene) biphenol, be a kind of non steroidal estrogen class medicine of synthetic, can impel woman organ and secondary sex character normal development, impel endometrial hyperplasia, strengthen uterine contraction, improve the susceptibility of uterus pitocin; Low dose stimulates and heavy dose of secretion that suppresses anterior pituitary gonadotropin and prolactin.20 century 70 later stages, owing to finding that DES has reproduction and genetoxic (comprising carcinogenic and teratogenesis), the U.S. just begins to limit DES from nineteen fifty-nine and is applied to its feeding, and formally forbade as additive application in Production of Livestock and Poultry, in animal derived food, must not detecting in 1979.1998, European Union also banned use of DES as the livestock growth promoter, and in the import animal-derived food product strict monitoring it is residual.China also forbade stilboestrol and the application of ester class in animal derived food thereof in 2002.But DES is still by a large amount of animal feedstuff additives that is used at present.DES excretes by approach such as drug metabolisms, enters into environment severe contamination water source and edatope.DES in the environment can pass through food chain form again harmful to human and contaminate environment, forms vicious cycle.Residual in environment of stilboestrol easily causes children's sexual precocity, growth retardation, Feminization, and mammary cancer, ovarian cancer etc. easily occur the women.
Now relative less with the research of stilboestrol in the degraded environment about processing, the degraded about stilboestrol that has developed utilizes the ironweed silicate system that DES is carried out photoxidation, ultraviolet germicidal DES in the water to be carried out the methods such as direct photodegradation.Relevantly utilize the research of the microbiological deterioration stilboestrol in the environment to there is not yet report.
Summary of the invention
The object of the present invention is to provide a kind of metabolism that utilizes bacterium self, reduce pseudomonas and the application thereof of the concentration of stilboestrol in the environment.
For achieving the above object, the technical solution used in the present invention is:
But a kind of pseudomonas of metabolism stilboestrol: but the pseudomonas of metabolism stilboestrol (Pseudomonas sp.) J61, in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) registration preservation; Preservation date is on 04 28th, 2011; Be numbered CGMCC No.4705.
But the application of the pseudomonas of metabolism stilboestrol: the stilboestrol but the false unit cell of metabolism stilboestrol can be degraded.
The degradation step of described false unit cell degraded stilboestrol is:
(1) J61 seed culture: pseudomonas is cultivated in the LB substratum, and culture temperature is 28～30 ℃, cultivates rotating speed 180～200rpm/min, and incubation time is 10-16h;
(2) J61 degraded stilboestrol: the J61 thalline in the step (1) is pressed initial concentration 1.0 * 10
8CFU/ml is inoculated in the minimal medium that contains stilboestrol and cultivates, and then the supernatant liquor of culture is detected the amount of residue stilboestrol by high performance liquid chromatography (HPLC), can obtain the efficient of pseudomonas degraded stilboestrol.
The detection method of described HPLC is: liquid chromatograph: skyray LC-310 liquid chromatographic system; Chromatographic column: the reverse post 4.6 * 250mm of Waters C18, granularity 5 μ m; Testing conditions is moving phase, V (methyl alcohol): V (water)=85: 15; Sample size is 20 μ L; Temperature is 25 ℃; The UV-detector detect parameters is for detecting wavelength 280nm.
Described LB substratum is to add 10g Tryptones, 5g yeast extract and 10g sodium-chlor in every premium on currency.
The prescription of described minimal medium is: add 1360mg potassium primary phosphate, 1780mg Sodium phosphate dibasic, 500.08mg sal epsom in every premium on currency, 500mg ammonium chloride, 0.1mg aluminium hydroxide, 0.05mg tindioxide, 0.05mg potassiumiodide, 0.05mg lithium chloride, 0.05mg boric acid, 0.1mg zinc sulfate, 0.01mg cobalt chloride, 0.01mg single nickel salt, 0.05mg bariumchloride and 0.05mg ammonium molybdate, pH, 7.2 ± 0.1.
The pseudomonas of cultivating in containing the minimal medium of stilboestrol is got its supernatant liquor, adds isopyknic ethanol, the static 10min of room temperature, and centrifugal 5min under 13,000rpm rotating speed, supernatant is stand-by with the membrane filtration of 0.22 μ m.
Compared with prior art, positively effect of the present invention is:
At present, in the degraded of heavy metal accumulation, organic contamination and oil degradation, application is arranged all by bacterial metabolism process degraded environmental pollutant.Stilboestrol in this pseudomonas degraded environment has the advantages such as degradation speed is fast, expense is low, operation steps is simple, for the residual preferably thinking that provides of stilboestrol in the environment thoroughly is provided.
Description of drawings
Fig. 1 processes the HPLC spectrogram of front and back stilboestrol concentration for the pseudomonas CGMCC No.4705 of the present invention that utilizes that the embodiment of the invention provides.
The sequence of the 16S rDNA of the pseudomonas J61 that Fig. 2 provides for the embodiment of the invention.
Behind the pseudomonas J61 degraded vagestrol that Fig. 3 provides for the embodiment of the invention, the relative residual quantity of stilboestrol over time in the nutrient solution supernatant.Among the figure, X-coordinate is fate, and ordinate zou is the relative residual quantity of stilboestrol.(■, not stilboestrol relatively residual in the solution of inoculated bacteria; Mouthful, the relative residual quantity of stilboestrol in the nutrient solution behind the inoculation pseudomonas J61).
The degradation efficiency of the stilboestrol of the pseudomonas J61 degraded different concns that Fig. 4 provides for the embodiment of the invention.Among the figure, X-coordinate is fate, and ordinate zou is the relative degradation efficiency of stilboestrol.
Under different pH environment, the degrade efficient of stilboestrol of the pseudomonas J61 that Fig. 5 provides for the embodiment of the invention.Among the figure, X-coordinate is pH, and ordinate zou is the relative degradation efficiency of stilboestrol.
The cytotoxicity of the stilboestrol that Fig. 6 provides for the embodiment of the invention and pseudomonas J61 degraded after product.Add PBS (a) in the cell cultures hole; The medium supernatant that contains stilboestrol (b) of inoculated bacteria not; Contain stilboestrol or/and the supernatant liquor of its meta-bolites (c) behind the inoculation pseudomonas J61.
Embodiment
Embodiment 1: the screening of pseudomonas J61 and 16S rDNA obtain
The seawater sample that gathers is applied to contains in the 10ppm stilboestrol solid medium, cultivated 2 days for 28 ℃.The mono-clonal microbionation to inorganic salt peptone liquid nutrient medium, was cultivated 24 hours for 28 ℃, then bacterium is seeded to respectively in the minimal medium that contains stilboestrol and cultivated 24 hours.Utilize the variation of stilboestrol content in the solution of HPLC determination and analysis degradation by bacteria front and back.J61 can descend separate stilboestrol in the environment in the situation take ethanol as sole carbon source.Neat, flat moistening in the pseudomonas J61 not agent of edge that flat board is grown, single bacterium colony does not appear.
The pseudomonas J61 that collection is in stationary phase extracts the genomic dna of this bacterium.Concrete steps are:
The J61 bacterial strain of (1) 30 ℃ of incubated overnight is inoculated in the test tube that contains 10ml LB substratum (adding 10g Tryptones in every premium on currency, 5g yeast extract and 10g sodium-chlor) by 1% volume ratio, treats the OD of bacterium
600During ≈ 1.0 left and right sides, get 1mL bacterium liquid in the 1.5mL centrifuge tube 10, the centrifugal 1min of 000g collects thalline.。
(2) in thalline, add 1mL 0.9%NaCl washing precipitation, the centrifugal 3min of 10,000g.
(3) abandon supernatant, in precipitation, add 450 μ L TE damping fluid (12mM Tris-HCl, 12mMEDTA, pH 8.0) Eddy diffusion precipitation, add again the SDS of 50 μ L 20%, the centrifuge tube that turns upside down gently makes it mixing, place 5min in 75 ℃ of water-baths, become to the cracking of bacterium liquid and clarify.
(4) add phenol-chloroform (volume ratio 3: 1) extracting of 500 μ L, put upside down gently and make it mixing, room temperature leaves standstill behind the 5min 10, the centrifugal 5min of 000g.
(5) supernatant is transferred to a new 1.5mL centrifuge tube and supply volume to 500 μ L with the TE damping fluid, adds phenol-chloroform (volume ratio 3: 1) of 500 μ L, the mixing room temperature leaves standstill behind the 5min 10, the centrifugal 5min of 000g.Again supernatant is transferred in the new centrifuge tube, so repeatedly, until till the protein layer in the middle of can't see.
(6) supernatant is transferred to a new 1.5ml centrifuge tube and supplies 500 μ L with the TE damping fluid, adds 500 μ L chloroforms, gently behind the mixing 10, and the centrifugal 5min of 000g.
(7) supernatant is transferred to a new 1.5mL centrifuge tube, adds the 3M NaAc mixing of supernatant liquor 1/10 volume, then adds and the isopyknic Virahol of supernatant liquor, turns upside down several times, should see having flocks to produce the centrifugal 5min of 10,000g this moment.
(8) abandon supernatant, add the washing with alcohol precipitation of 1mL 70%, the centrifugal 5min of 10,000g blots liquid as far as possible, and drying at room temperature is 10min approximately.
(9) add 50 μ L and contain the TE damping fluid dissolving DNA that final concentration is 10-20mg/mL RNaseA.
Utilizing 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACG ACTT) is primer, and the J61 genomic dna of extraction is template, and its 16S rDNA of pcr amplification also identifies.The condition of PCR is 94 ℃ of sex change 4min, 94 ℃ of sex change 30s, and 57 ℃ of annealing 1min, 72 ℃ are extended 1min, from second step, 30 circulations.The PCR product is checked order by Beijing promise match gene.The dna sequencing fragment is seen Fig. 2.
Embodiment 2: the content temporal evolution process of stilboestrol in the inoculum supernatant
Be 1.0 * 10 with initial concentration
8The pseudomonas J61 of CFU/mL is seeded to and contains in the minimal medium that final concentration is the 10ppm stilboestrol.Shaking flask liquid amount 30%, culture temperature are 28～30 ℃, cultivate rotating speed 180～200rpm/min.Took out the inoculum of 500 μ L every 24 hours, and add the ethanol of 500 μ L, room temperature left standstill 10 minutes.The centrifugal precipitation of abandoning of 10,000rpm after the supernatant liquid filtering degerming, utilizes HPLC to analyze the content of remaining stilboestrol in the nutrient solution supernatant.With the minimal medium that contains stilboestrol of not inoculating J61 in contrast, take the initial add-on of stilboestrol as 100%, behind the inoculation pseudomonas J61 in the inoculum supernatant the time dependent process of relative content of stilboestrol see Fig. 3.At inoculation pseudomonas J61, continue to cultivate after 24 hours, in the solution content of stilboestrol 85%, but along with the increase of time, the content of residue stilboestrol is not very large in the supernatant.As seen, inoculation pseudomonas J61 can the fast reducing environment in the content of vagestrol.
The detection method of described HPLC is: liquid chromatograph: skyray LC-310 liquid chromatographic system; Chromatographic column: the reverse post 4.6 * 250mm of Waters C18, granularity 5 μ m; Testing conditions is moving phase, V (methyl alcohol): V (water)=85: 15; Sample size is 20 μ L; Temperature is 25 ℃; The UV-detector detect parameters is for detecting wavelength 280nm.The prescription of described minimal medium is: add 1360mg potassium primary phosphate, 1780mg Sodium phosphate dibasic, 500.08mg sal epsom in every premium on currency, 500mg ammonium chloride, 0.1mg aluminium hydroxide, 0.05mg tindioxide, 0.05mg potassiumiodide, 0.05mg lithium chloride, 0.05mg boric acid, 0.1mg zinc sulfate, 0.01mg cobalt chloride, 0.01mg single nickel salt, 0.05mg bariumchloride and 0.05mg ammonium molybdate, pH, 7.2 ± 0.1.
Embodiment 3: utilize pseudomonas J61 to process the solution that contains the different concns stilboestrol
Be 1.0 * 10 with initial concentration
8The pseudomonas J61 of CFU/mL be seeded to respectively contain final concentration be 5,10,20,40 and the minimal medium of 80ppm stilboestrol in.Shaking flask liquid amount 30%, culture temperature are 28～30 ℃, cultivate rotating speed 180～200rpm/min.Take out the inoculum of 500 μ L after 24 hours, and add the ethanol of 500 μ L, room temperature left standstill 10 minutes.The centrifugal precipitation of abandoning of 10,000rpm after the supernatant liquid filtering degerming, utilizes HPLC to analyze the content of remaining stilboestrol in the nutrient solution supernatant.The detection method of described HPLC such as embodiment 2.With the minimal medium that contains stilboestrol of not inoculating J61 in contrast.The initial add-on of stilboestrol is as 100% under the various concentration conditions, and the efficient of degradation by bacteria stilboestrol is seen Fig. 4 with different stilboestrol initial concentration change procedures behind the inoculation pseudomonas J61.As seen, the concentration of stilboestrol is during less than 40ppm, and along with the increase of stilboestrol concentration, degradation by bacteria efficient increases along with the increase of vagestrol concentration in the environment; And when the concentration of stilboestrol in the nutrient solution was increased to 80ppm from 40ppm, degradation efficiency there is no the generation considerable change.
Embodiment 4: the variation of the lower pseudomonas J61 degraded of different pH value impacts stilboestrol efficient
Be 1.0 * 10 with initial concentration
8The pseudomonas J61 of CFU/mL is seeded to respectively and contains in the minimal medium of different pH that final concentration is the 10ppm stilboestrol.Shaking flask liquid amount 30%, culture temperature are 28～30 ℃, cultivate rotating speed 180～200rpm/min.Take out the inoculum of 500 μ L after 24 hours, and add the ethanol of 500 μ L, room temperature left standstill 10 minutes.The centrifugal precipitation of abandoning of 10,000rpm after the supernatant liquid filtering degerming, utilizes HPLC to analyze the content of remaining stilboestrol in the nutrient solution supernatant.The detection method of described HPLC such as embodiment 2.With the minimal medium that contains stilboestrol of not inoculating J61 in contrast.The initial add-on of stilboestrol is as 100% under the various pH condition, and the efficient of degradation by bacteria stilboestrol is seen Fig. 5 with different pH change procedures behind the inoculation pseudomonas J61.As seen, pH 7.0 is best pH of pseudomonas J61 degraded stilboestrol, departs from the efficient that this pH can cause pseudomonas J61 degraded stilboestrol and sharply descends.
Embodiment 5: the cytotoxicity of the product of stilboestrol behind degradation by bacteria
Be 1.0 * 10 with initial concentration
8The pseudomonas J61 of CFU/mL is seeded to respectively and contains in the minimal medium that final concentration is the 10ppm stilboestrol.Shaking flask liquid amount 30%, culture temperature are 28～30 ℃, cultivate rotating speed 180～200rpm/min, with the minimal medium supernatant liquor that contains stilboestrol of inoculated bacteria not in contrast.Take out the nutrient solution of 500 μ L after 24 hours, add the ethanol of 500 μ L, room temperature left standstill 10 minutes.The centrifugal precipitation of abandoning of 10,000rpm after the supernatant liquid filtering degerming, utilizes HPLC to analyze inoculated bacteria and the content of stilboestrol under two kinds of conditions of inoculated bacteria not, the detection method of described HPLC such as embodiment 2.And the supernatant of filtration sterilization joined respectively in the Hela cell adherent on 96 orifice plates, under inverted microscope, observe the variation of ne ar after 8 hours, observations is as shown in Figure 6.The result shows, stilboestrol can make the Hela Growth of Cells obviously be suppressed, and causes its cellular form in process of growth that serious distortion occurs; And through the stilboestrol behind the degradation by bacteria, namely contain a small amount of residual stilboestrol or/and the inoculum supernatant of its degraded product, to the growth of Hela cell without obvious effect, Hela cell growth state and contrast after it is processed, namely PBS is basically identical.
Claims (7)
1. but the pseudomonas of a metabolism stilboestrol is characterized in that: but the pseudomonas of metabolism stilboestrol (Pseudomonas sp.) J61, in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) registration preservation; Preservation date is on 04 28th, 2011; Be numbered CGMCC No.4705.
2. but the application of the pseudomonas of a metabolism stilboestrol claimed in claim 1 is characterized in that: the stilboestrol but the false unit cell of metabolism stilboestrol can be degraded.
3. but press the application of the pseudomonas of metabolism stilboestrol claimed in claim 2, it is characterized in that: the degradation step of described false unit cell degraded stilboestrol is:
(1) J61 seed culture: pseudomonas is cultivated in the LB substratum, and culture temperature is 28～30 ℃, cultivates rotating speed 180～200rpm/min, and incubation time is 10-16h;
(2) J61 degraded stilboestrol: the J61 thalline in the step (1) is pressed initial concentration 1.0 * 10
8CFU/ml is inoculated in the minimal medium that contains stilboestrol and cultivates, and then the supernatant liquor of culture is detected the amount of residue stilboestrol by high performance liquid chromatography (HPLC), can obtain the efficient of pseudomonas degraded stilboestrol.
4. but press the application of the pseudomonas of metabolism stilboestrol claimed in claim 3, it is characterized in that: the detection method of described HPLC is: liquid chromatograph: skyray LC-310 liquid chromatographic system; Chromatographic column: the reverse post 4.6 * 250mm of Waters C18, granularity 5 μ m; Testing conditions is moving phase, V (methyl alcohol): V (water)=85: 15; Sample size is 20 μ L; Temperature is 25 ℃; The UV-detector detect parameters is for detecting wavelength 280nm.
5. but press the application of the pseudomonas of metabolism stilboestrol claimed in claim 3, it is characterized in that: described LB substratum is to add 10g Tryptones, 5g yeast extract and 10g sodium-chlor in every premium on currency.
6. but press the application of the pseudomonas of metabolism stilboestrol claimed in claim 3, it is characterized in that: the prescription of described minimal medium is: add the 1360mg potassium primary phosphate in every premium on currency, the 1780mg Sodium phosphate dibasic, 500.08mg sal epsom, 500mg ammonium chloride, 0.1mg aluminium hydroxide, 0.05mg tindioxide, 0.05mg potassiumiodide, 0.05mg lithium chloride, 0.05mg boric acid, 0.1mg zinc sulfate, 0.01mg cobalt chloride, 0.01mg single nickel salt, 0.05mg bariumchloride and 0.05mg ammonium molybdate, pH, 7.2 ± 0.1.
7. but press the application of the pseudomonas of metabolism stilboestrol claimed in claim 3, it is characterized in that: the pseudomonas of in containing the minimal medium of stilboestrol, cultivating, get its supernatant liquor, add isopyknic ethanol, the static 10min of room temperature, centrifugal 5min under 13,000rpm rotating speed, supernatant is stand-by with the membrane filtration of 0.22 μ m.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110228931.3A CN102911890B (en) | 2011-08-05 | 2011-08-05 | Pseudomonas capable of metabolizing diethylstilbestrol and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110228931.3A CN102911890B (en) | 2011-08-05 | 2011-08-05 | Pseudomonas capable of metabolizing diethylstilbestrol and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102911890A true CN102911890A (en) | 2013-02-06 |
| CN102911890B CN102911890B (en) | 2014-06-04 |
Family
ID=47610471
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110228931.3A Expired - Fee Related CN102911890B (en) | 2011-08-05 | 2011-08-05 | Pseudomonas capable of metabolizing diethylstilbestrol and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102911890B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774798A (en) * | 2015-05-04 | 2015-07-15 | 四川农业大学 | Bacillus subtillis capable of effectively degrading diethylstilbestrol |
| CN111302499A (en) * | 2019-11-07 | 2020-06-19 | 桂林理工大学 | Method for rapidly catalyzing and degrading diethylstilbestrol |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1992003128A1 (en) * | 1990-08-22 | 1992-03-05 | Riace Establishment | Pharmaceutical compositions with mucolytic and antitussive activity containing (-)-trans-sobrerol |
| CN1465695A (en) * | 2002-07-03 | 2004-01-07 | 中国农业大学 | Microbe for degrading tobacco nicotine, and method for separating and culturing same and use thereof |
| US20090238811A1 (en) * | 2002-09-09 | 2009-09-24 | Mcdaniel C Steven | Enzymatic Antimicrobial and Antifouling Coatings and Polymeric Materials |
-
2011
- 2011-08-05 CN CN201110228931.3A patent/CN102911890B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1992003128A1 (en) * | 1990-08-22 | 1992-03-05 | Riace Establishment | Pharmaceutical compositions with mucolytic and antitussive activity containing (-)-trans-sobrerol |
| CN1465695A (en) * | 2002-07-03 | 2004-01-07 | 中国农业大学 | Microbe for degrading tobacco nicotine, and method for separating and culturing same and use thereof |
| US20090238811A1 (en) * | 2002-09-09 | 2009-09-24 | Mcdaniel C Steven | Enzymatic Antimicrobial and Antifouling Coatings and Polymeric Materials |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104774798A (en) * | 2015-05-04 | 2015-07-15 | 四川农业大学 | Bacillus subtillis capable of effectively degrading diethylstilbestrol |
| CN111302499A (en) * | 2019-11-07 | 2020-06-19 | 桂林理工大学 | Method for rapidly catalyzing and degrading diethylstilbestrol |
| CN111302499B (en) * | 2019-11-07 | 2022-04-08 | 桂林理工大学 | Method for rapidly catalyzing and degrading diethylstilbestrol |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102911890B (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109593681B (en) | Composite microbial inoculum for preventing and treating cyanobacterial bloom in aquaculture and preparation method and application thereof | |
| CN108865953B (en) | Bacillus for broad-spectrum inhibition of aquatic pathogenic vibrios and composite bacterium preparation thereof | |
| CN106520597B (en) | Ecological active deodorant and preparation method thereof | |
| CN106497809B (en) | A kind of enterobacter cloacae, the microbial inoculum containing the bacterium and its application and the method for being passivated mercury | |
| CN106754579A (en) | A kind of bacillus coagulans and application thereof | |
| CN108048344A (en) | Two plants of deodorization bacterial strains and its application in composite biological deodorant is prepared | |
| CN105368755A (en) | Acid-yielding Enterococcus faecium, bacteriostatic microecological preparation and application thereof | |
| CN104673730A (en) | Brevibacillus laterosporu with function in quickly decomposing nitrite nitrogen and bacteriostasis function and application thereof | |
| CN103243044A (en) | Bacillus amyloliquefaciens and application thereof | |
| CN104195084A (en) | Diethylstilbestrol degradation strain and application thereof in sewage and animal manure treatment | |
| CN102911890B (en) | Pseudomonas capable of metabolizing diethylstilbestrol and application thereof | |
| CN108192845B (en) | Enzyme-bacterium complexing agent for harmless treatment of animal carcasses and preparation method thereof | |
| KR20150092874A (en) | Microbial agent for reducing stench | |
| CN102876617B (en) | Pseudomonas and purpose of pseudomonas | |
| CN113462614A (en) | Deep-sea-derived Bacillus belgii RS6-14 and extraction method and application of antibacterial extract produced by same | |
| CN106259511B (en) | A kind of biological algicide | |
| CN108795817A (en) | The preparation of a kind of microbial bacterial agent and the microbial bacterial agent, application method | |
| CN103952359A (en) | Brevundimonas sp. and application thereof | |
| CN102181384A (en) | Acinetobacter calcoaceticus T32 capable of metabolizing furazolidone and application thereof | |
| CN115584334B (en) | Enterococcus faecium and application thereof in acidification and odor solving of soybean whey wastewater | |
| CN101914464B (en) | Alcaligenes sp. MB-N6 for removing nitrite nitrogen pollution out of water and application thereof | |
| CN113025507B (en) | Compound microbial agent, preparation thereof and application thereof in deodorization and purification of high-concentration wastewater in livestock and poultry farms | |
| CN115053935A (en) | Application of lactobacillus salivarius in breeding of litopenaeus vannamei larvae | |
| CN101704689B (en) | Composting method for inoculating compound bacterium agent in secondary fermentation stage | |
| CN104059869A (en) | Marine Bacillus amyloliquefaciens and culturing method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140604 Termination date: 20180805 |