CN102908631A

CN102908631A - Function of actin 84 lysine monomethylation in cytokinesis and cell proliferation as well as application thereof to drug development

Info

Publication number: CN102908631A
Application number: CN2012101550921A
Authority: CN
Inventors: 杨运桂; 李明明; 史悦
Original assignee: Beijing Institute of Genomics of CAS
Current assignee: Beijing Institute of Genomics of CAS
Priority date: 2012-05-17
Filing date: 2012-05-17
Publication date: 2013-02-06
Anticipated expiration: 2032-05-17
Also published as: CN102908631B

Abstract

The invention discloses function of actin new methylation, namely 84 lysine monomethylation (actin K84mel), in cytokinesis and cell proliferation as well as potential application value in allusion to actin K84mel anti-cancer drug development. Only after demethylation is carried out on the actin K84mel by the ALKBH4 protein, the NMII is capable of sliding along actin fibers. The actin K84mel is capable of suppressing the interference of the contraction of contractile rings on the cytokinesis. Through the ALKBH4 gene silencing, the expression index of the actin K84mel can be increased; and through the over-expression of the actin K84mel, the mitotic time retardation and the cytokinesis failure are caused, the cell apoptosis and the multinuclear cell generation are finally caused, and the cell proliferation and migration defects are caused and the cells finally die. The expression index of the actin K84mel can be used for developing anti-tumor drugs.

Description

84 lysine monomethylations of actin are modified at the function in cytokinesis and the cell proliferation and use in medicament research and development

Technical field

The present invention relates to 84 lysine monomethylations modifications of actin (actin K84me1) functions in cytokinesis and cell proliferation reaches for the potential using value in the actin K84me1 cancer drug development.

Background technology

Cytokinesis is four main stages of experience usually: split plate is established (cleavage plane specification), minute dehiscence furrow contraction (cleavage furrow ingression), middle body forms (midbody formation) and fracture (abscission).The cytokinesis failure can cause centrosome over-replicate genomic instability usually, and these all can cause pernicious increment and migration.In order to guarantee that at room and time cytokinesis correctly occurs, many components of cytokinesis and other cell pathway process all participate in this closely regulation process.Retraction ring (contractile ring) contraction that cytokinesis is considered to form by actin fiber (F-actin) and the non-muscle myosin of two types (non-muscle myosin II or NM II) is usually finished, and the actin fiber plays key effect in minute dehiscence furrow formation and contraction process.Retraction ring is the height dynamic change along with the fast transition between actin fiber and the non-muscle myosin of two types, and the actin fiber is assembled the actin transmitting fiber tow that is by the one-tenth nuclear effect of minute dehiscence furrow place actin fiber or the nucleation that other positions have existed and is delivered to minute dehiscence furrow place at minute dehiscence furrow place.The non-muscle myosin of two types is gathered in a minute dehiscence furrow place and does not rely on the atpase activity of himself, but depends on the phosphorylation modification of light chain.The non-muscle myosin of two types is dynein main in the cytokinesis process, and it is along the slip of actin fiber and promote that the depolymerization of actin fiber all is that minute dehiscence furrow contraction is necessary.Actin and the myosin height change at minute dehiscence furrow place is to be subject to protein post-translational modification institute (post-translational modifications or PTMs) regulation and control; there is the research table to show to recruit a minute dehiscence furrow place at mitotic early anaphase myosin and finishes by phosphorylation modification; promote the kinases degraded of phosphorylation can cause myosin location and actin in a minute dehiscence furrow place depolymerization; the depolymerization of actin and polymerization also are subject to the signal path regulation and control of multiple post translational modification; for example oxidation; arginyl; SUMOization and S-nitrosoglutathione; these are to the actin structure; distribution and function have material impact, yet whether the actin on retraction ring and middle body has similar modification; these modifications are that how to affect the 26S Proteasome Structure and Function of body in the retraction ring now not clear.

Cytokinesis is an astonishing complicated regulation process, needs very many interaction component and regulatory pathway, and the failure of cytokinesis can result from the result of certain component inactivation in any one-phase of this four-stage or excessive activation.Although the albumen of many cytokinesiss is identified, we know just that these albumen are how interactional and how to be regulated and control.It unsuccessfully is very important understanding cytokinesis, because it may be the reason that produces unsettled tetraploid cell and tumor.Yet what cytokinesis failure also can physiological regulation occurs in some tissues, even those do not have the tissue of tumor tendency, such as heart.How to understand reply unlike signal or cell be under pressure and situation about damaging under physiological regulation and control cytokinesis, be still the field of following primary study.Although cytokinesis unsuccessfully is accompanied by some pathological phenomenons, such as cancer, drug-induced cytokinesis unsuccessfully can be used as the important directions of new drug development.The Rho inhibitors of kinases has been developed into cardiovascular drugs, in the middle of the Aurora A inhibitor being is is being researched and developed as cancer therapy drug.Because these inhibitor also can be induced normal structure cytokinesis failure, be very important so determine different tissues to the consequence of cytokinesis sensitivity and different tissues generation tetraploid cell.

Summary of the invention

The invention discloses the new modification that methylates of a kind of actin, namely 84 lysine monomethylations modification (actin K84me1) functions in cytokinesis and cell proliferation reach for the potential using value in the actin K84me1 cancer drug development.Described people ALKBH4 cDNA sequence is shown in sequence table SEQ ID NO.1, described people ALKBH4 H169A-D171A-H254A mutants cDNA sequence such as sequence table SEQ ID NO.2, shown in described mice ALKBH4 genomic dna sequence shown in sequence table SEQ ID NO.3, described people β-actin cDNA sequence is shown in sequence table SEQ ID NO.4, described people β-actin K84A mutants cDNA sequence is shown in sequence table SEQ ID NO.5, described people ALKBH4 protein sequence is shown in sequence table SEQ ID NO.6, described people ALKBH4 H169A-D171A-H254A mutant protein sequence is shown in sequence table SEQ ID NO.7, described mice ALKBH4 protein sequence is shown in sequence table SEQ ID NO.8, described people β-actin protein sequence is shown in sequence table SEQ ID NO.9, and described people β-actin K84A mutant protein sequence is shown in sequence table SEQ ID NO.10.Described ALKBH4 siRNA sequence SEQ ID NO.27, SEQ ID NO.28 and SEQ ID NO.29, effect is with the ALKBH4 gene silencing, degraded ALKBH4 cDNA and the endogenous ALKBH4 protein expression of reduction, the target spot of these three sequences is positioned at 3 ' the end noncoding region of ALKBH4 mRNA, so can not reticent heterogenous expression ALKBH4 gene.Described NM II siRNA sequence SEQ ID NO.30, SEQ ID NO.31 and SEQ ID NO.32 effect are with NM II gene silencing, degraded NM II cDNA and reduction NM II protein expression.

At first, immunofluorescence and immunoblot experiment detect actin (actin) and ALKBH4 protein localization on retraction ring (contractile ring) and middle body (midbody), mass-spectrometric technique finds that 84 lysines of actin have monomethylation and modify (actin K84me1), immunofluorescence technique detects retraction ring and the middle body that actin K84me1 also is positioned at cell, so technical solution problem one of the present invention provides a kind of new modified forms actin K84me1 of actin albumen and its organelle specific localization phenotype.

Secondly, co-immunoprecipitation and mass-spectrometric technique find that ALKBH4 albumen and actin (actin) and the non-muscle myosin of two types (NM II) interact, ALKBH4 albumen and the specific interaction of actin K84me1, and NM II interacts with the actin that modifies that do not methylate, and actin K84me1 disturbs NM II combination, suppress NM II fiber and slide along the actin fiber, this depression effect interferes with retraction ring and shrinks, and destroys the cytokinesis process.Only NM II could slide along the actin fiber after ALKBH4 albumen is with actin K84me1 demethylation.Therefore technical solution problem two of the present invention provides actin K84me1 to disturb NM II combination and suppresses NM II and slide along the actin fiber, and actin K84me1 inhibition retraction ring shrinks and disturbs cytokinesis.

At last, the present invention finds that by gene silencing, immunofluorescence and Flow Cytometry the ALKBH4 gene silencing can cause actin K84me1 expression to increase, actin K84me1 crosses to express and causes cell division phase retardance and cytokinesis failure, cause that finally apoptosis and apocyte generate, actin K84me1 crosses expression can cause cell proliferation migration defective finally deathward.So technical solution problem three of the present invention provides the basic research evidence for its death of tumor cell induction that suppresses the malignant proliferation migration, this just provides strong theoretical basis for our research for the antitumor drug research and development that actin K84me1 crosses expression.

As everyone knows, malignant cell is can wireless propagation and the cell of migration, and Normocellular vivosphere has been occupied in its pernicious amplification, causes that numerous organ failuries seize patients ' lives.And we find that actin K84me1 plays crucial regulating and controlling effect in especially cytokinesis process of cell division, if actin K84me1 expression in the increase tumor cell, tumor cell can't breed and move and finally cause its death so, thereby reach the purpose for the treatment of malignant tumor.In sum, illustrating can be for the research and development antitumor drug for actin K84me1 expression.

Description of drawings

Fig. 1 human dioxygenase AlkB protein family forms and enzymatic activity key structure territory

Fig. 2 dioxygenase AlkB protein family has identical demethylation mechanism with histone demethylase JHDM protein family

Fig. 3 affinitive layer purification 6 * His-ALKBH4 wild type and HDH mutant fusion protein

Fig. 4 concentrates 6 * His-ALKBH4 wild type and HDH mutant fusion protein and verifies the purity of these two albumen

Fig. 5 verifies GST-ALKBH4 fusion rotein solubility expression, affinity chromatograph and ion-exchange chromatography separation and purification GST-ALKBH4 fusion rotein

Fig. 6 affinitive layer purification is used for the rabbit source ALKBH4 antibody of immunofluorescence experiment

The specificity of Fig. 7 immunofluorescence experiment checking rabbit source ALKBH4 antibody

Fig. 8 is for the preparation of the antibody of immunoblot experiment and the specificity of immunoblot experiment checking antibody

Fig. 9 immunofluorescence experiment proves that endogenous ALKBH4 protein localization is on centrosome (centrosome) and middle body (midbody)

Figure 10 immunofluorescence experiment proof external source 3 * Flag-ALKBH4 is positioned on the centrosome, and the centrosome separating experiment proves that endogenous ALKBH4 is positioned on the centrosome

Body separating experiment proof ALKBH4 is positioned on retraction ring (contractile ring) and the middle body in Figure 11 immunofluorescence experiment and the retraction ring

Figure 12 ALKBH4 co-immunoprecipitation mass spectrometry results, actin K84me1 and NM II are present in the ALKBH4 co-immunoprecipitation sample

Figure 13 co-immunoprecipitation experimental results show that endogenous and ALKBH4 external source interacts with actin

Figure 14 co-immunoprecipitation experimental results show that HA-β-actin K84A mutant disturbs the ALKBH4 combination, and the binding ability of Flag-GFP-ALKBH4 HDH mutant and actin strengthens

Figure 15 co-immunoprecipitation experimental results show that ALKBH4 and NM II interact, and HA-β-actin K84A mutant disturbs the combination between itself and NM II

Figure 16 co-immunoprecipitation experimental results show that the ALKBH4 gene silencing does not affect the interaction between actin and NM II

Figure 17 co-immunoprecipitation experimental results show that NM II gene silencing does not affect ALKBH4 and actin interphase interaction

Figure 18 co-immunoprecipitation experimental results show that NM II inhibitor B lebbistatin does not affect ALKBH4 and actin interphase interaction

Figure 19 co-immunoprecipitation experimental results show that actin polymerization inhibitor Cytochalasin D has destroyed the interaction between ALKBH4 and actin, NM II

Polypeptide and HA-β-actin that Figure 20 rabbit source actin K84me1 antibody can specific recognition contains K84me1 can not identify non-methylated polypeptide and HA-β-actin K84A mutant

Figure 21 immunofluorescence experiment checking actin K84me1 is positioned on retraction ring and the middle body

Figure 22 in vivo ALKBH4 can make actin K84me1 demethylation, and ALKBH4 is combined with actin K84me1 and NM II is combined with the actin that modifies that do not methylate

Figure 23 immunofluorescence experiment proof ALKBH4 gene silencing causes the retraction ring malposition, middle body structure is unusual and the centrosome over-replicate

Figure 24 Flow Cytometry proof ALKBH4 gene silencing causes G2/M phase and M phase cytosis

Figure 25 crosses expression 3 * Flag-ALKBH4HDH and HA-β-actin K84A mutant causes M phase cytosis

Figure 26 immunofluorescence, Flow Cytometry and living cells imaging experiment proof ALKBH4 gene silencing cause final apocyte, the apoptosis of producing of cytokinesis failure

Figure 27 Flag-GFP-ALKBH4 wild type can be repaired the cytokinesis phenomenon that the ALKBH4 gene silencing causes, and comprises that the retraction ring location is unusual, and apocyte produces and M phase cytosis, and Flag-GFP-ALKBH4 HDH mutant can not

Figure 28 ALKBH4 is at intracellular functional mode

The ALKBH4 gene silencing causes G2/M phase, M phase cytosis and apoptosis in Figure 29 Flow Cytometry proof U2OS cell

The ALKBH4 gene silencing causes apoptosis in Figure 30 Flow Cytometry proof OSC20 and the TOC2 cell

The albumen position that Figure 31 ALKBH4 knock out mice knocks out and traditional ALKBH4 knock out mice are died from the period of embryo

Figure 32 condition type ALKBH4 knock out mice design and southern blotting and RT-PCR checking

Figure 33 induces ALKBH4 knock out mice fibroblast ALKBH4 gene knockout to cause that actin K84me1 expression increases

Figure 34 induces ALKBH4 knock out mice fibroblast ALKBH4 gene knockout to cause apocyte to produce and the centrosome over-replicate

The fibroblastic propagation of Figure 35 ALKBH4 knock out mice and transfer ability disappearance

Specific embodiment

Embodiment one: the experimental technique that is applied in the embodiment of the invention and material

Experiment material:

1, the information of used cell line

2, used antibody information

3, used plasmid information

4, used chemical reagent

Nocodazole(Sigma,M1404),Cytochalasin?D(Sigma,C8273)and?Blebbistatin(Sigma,B0560)，taxol(Invitrogen?P3456)and?phalloidin(Invitrogen?P3457)，Lipofectamine?2000(Invitrogen)，Lipofectamine?RNAiMAX(Invitrogen)，PI-stained?kit(Becton-Dickinson)，Annexin?V-FITC?&?PI?Detection?Kit(Jiamay?Biotech,Beijing,China)，DAPI(Vector?Laboratories,Burlingame,CA)，anti-flag?M2?affinity?gel(sigma,A2220)，anti-HA?affinity?gel(sigma)，GFP-Trap-A?beads(ChromoTek,gta-20)，anti-Rabbit?Ig?IP?Beads(eBioscience)，anti-Mouse?Ig?IP?Beads(eBioscience)，ECL?Western?Blotting?Detection?Kit(GE)

Experimental technique:

1, the structure of expression plasmid

We are with the expression plasmid of conventional sub-clone method construction expression desirable proteins; roughly step is as follows: the design primer with the method for PCR with the genes of interest processing of from plasmid or cDNA, increasing; the PCR product is connected with the destination carrier of the same enzyme action recycling of warp after specific Cobra venom endonuclease cutting is reclaimed; the connection product changes in the DH5 α competent cell and increases; the some monoclonals of picking; tentatively enzyme action identifies whether connection is successful, and after the order-checking evaluation was errorless, amplification was also for subsequent experimental.Make up the used primer of plasmid in this paper and see experiment material 3.

2, competent cell transforms

1) take out competent cell from-80 ℃ of refrigerators, the bottom with finger is rubbed the EP pipe is gently melted fast bacterium liquid, and immediately the EP pipe is transferred in the ice, leaves standstill 10 minutes.

The plasmid that 2) will transform joins in the 100 μ l competent cells (2-3 μ l plasmid/100 μ l competent cells, plasmid volume are no more than competent cell 5%), flicks EP pipe bottom with finger and makes the content mixing; Establish simultaneously the negative control that only has competent cell and do not add plasmid, ice bath 30 minutes.The LB culture fluid can be placed during this time 37 ℃ of water-baths to heat, open 42 ℃ of metal baths.

3) the EP pipe is placed in 42 ℃ the metal bath, leaves standstill 90 seconds (not shaking).

4) fast the EP pipe is transferred in the ice bath, cooled off 2 minutes.

5) every pipe adds 800 μ l LB fluid mediums of 37 ℃ of preheatings, the EP pipe is transferred on the shaking table of 37 ℃ of rotating speed 200rpm incubation 45 minutes.

6) from the EP pipe, take out the competent cell that 200 μ l have transformed, transfer to and contain on the corresponding antibiotic LB flat board, smoothen with being coated with the bacterium rod.If transforming DNA is to connect product, need centrifugal concentrating cell (centrifugal 10 minutes of room temperature rotating speed 4000rpm), discard 700 μ l supernatant, utilize remaining 200 μ l supernatant re-suspended cells, and shift evenly to be applied on the LB solid culture flat board and (contain corresponding antibiotic).

7) flat board is just being placed 37 ℃ incubator, incubated overnight.

3, protein vivoexpression and purification

The e. coli bl21 (DE3) that contains expression plasmid is seeded in the LB culture medium that contains 100 μ g/ml ampicillin and increases in 37 degree cultivation shaking tables.When wavelength 600nm light absorption value reaches between the 0.5-0.65, added 25 ℃ of inducing culture of final concentration 0.1mM IPTG 4 hours.The centrifugal collection thalline of room temperature rotating speed 4000rpm.Cell suspension is suspended in an amount of lysate, ultrasonication, ultrasound condition is different and different with cracking condition, ultrasonic after, centrifugal 20 minutes of 4 ℃ of rotating speed 16000rpm, supernatant is soluble protein.Before purification, usually to carry out solubility and identify.If the destination protein solubility is very low, after increasing solubility, condition of culture carries out again purification by changing.

Utilize the protein chromatography system of Bio-Rad that soluble protein is carried out two-step purifying, for the albumen of 6 * His label coupling, the first step is utilized Bio-Scale IMAC cartridge(BIO-RAD 732-4610) carry out affinity purification.Albumen for the coupling of GST label, utilize Bio-Scale Profinity GST cartridge (BIO-RAD, 732-4620) carry out affinity purification, if purity is inadequate, carry out the second step purification: determine to utilize anion-exchange column (column UNO-Q1 according to the albumen isoelectric point, IP, BIO-RAD) or cation exchange column (Column UNO-S1, BIO-RAD) carries out further purification.Should dialyse before the second step purification and behind the first step purification.Usually dialysis twice, each two hours, in the 2L beaker, carry out, what select the bag filter (KF134419, Thermo) of different length per sample.The albumen that purification is good carries out the SDS-PAGE gel electrophoresis at last, detects purity and whether meets antibody preparation or other requirement of experiment.

4, SDS-PAGE electrophoresis

SDS-PAGE adopts rectilinear electrophoresis tank device

The preparation of polyacrylamide gel

1), the preparation of gel slab

A. wash plate:

Clean two glass plates with liquid detergent, then clean with tap water, with 75% ethanol blackboard eraser is done again.

B. matching board:

Two glass plates are stacked neatly, clip with the clip both sides, these two glass plates are fixed on the base.Insert supporting comb, in the line of comb lower edge, with waterproof marking pen labelling encapsulating position.Take out comb.

2), encapsulating:

A. join separation gel (10%) solution 10ml:

B. encapsulating: will utilize pipet that separation gel (avoiding Bubble formation) is splashed between two glass plates behind the mentioned solution mixing, reach comb lower edge 1cm place to liquid level.Slowly add ddH with pipet ₂The not random glue face of communications centre is noted in the O sealing.Leave standstill, after the glue polymerization to be separated, go or suck water layer with filter paper.It can be wrapped preservative film and put into 37 ° of constant incubator 30min.

C. join concentrated glue (5%) solution 6ml:

Be overlying on two separation gels between the glass plate to full at once adding concentrated glue (avoiding Bubble formation) with pipet behind the mentioned solution mixing, insert gently comb.It is wrapped preservative film put into 37 ° of constant incubator 30min.After it condenses, namely make gel slab.Perform mark with pen at the intersection of separation gel and concentrated glue, later on encapsulatings according to this all.Make 2 clotting offset plates.

3), sample treatment:

A. with-20 ℃ of frozen cell pellet, every pipe equal-volume adds 50 μ l, 1 * SDS loading buffer, is placed on incubation 5min in 37 ℃ of water-baths.

B.95 ℃ constant-temperature metal bath heats 15min.

C. with 13,300rpm high speed centrifugation 5min.Shift supernatant to new EP pipe, carry out labelling.

D. get three EP pipes, wherein a pipe adds 10 μ l marker and 10 μ l, 1 * SDS loading buffer, and mixing is for subsequent use; One pipe adds 2 μ l marker and 8 μ l, 1 * SDS loading buffer, mixing; Another pipe adds 10 μ l, 1 * SDS loading buffer.

4), loading;

A. the clip on the gel slab of two glass plates being made sheds.Take out lightly the comb in the gel slab.

B. gel slab is vertically leaned against on the power bay in the electrophoresis tank, make the recessed of gel slab rely on power bay along face.Common two clotting offset plates share a power bay.

C. gel slab and power bay are fixed in the power slot on request.On request respectively in the two clotting offset plate intermediate power supplies framves and add 1 * Tris-Glycine electrophoretic buffer of proper volume in the electrophoresis tank, do not have gel to liquid level.

D. get the sample liquid after the processing, draw 10 μ l sample liquid with liquid-transfering gun, with sample liquid slowly add in the gel slab recess position (sample is clicked and entered the place).Note not breaking up sample.

5), electrophoresis:

Connect electrophoresis tank and electrophresis apparatus with two wires, notice that red plug and socket with black electrodes matches.Energized.Control voltage is 70V in concentrated glue, about 30min, and voltage is adjusted to 120V behind the concentrated glue of passing by, approximately 1h.When the band of the sample bromophenol blue during electrophoresis on the observation gel slab is walked out separation gel, stop electrophoresis.Powered-down.Then in electrophoresis tank, carefully take out gel slab.

6), dyeing

A. pry open gently with blade or thin plate two glass plates that gel slab is outer, gel is pitched therein on the glass plate.

B. use blade junction along separation gel and concentrated glue on gel, will concentrate first the glue cutting-out and abandon, again separation gel is downcut, and cut away Yi Xiaojiao in the upper left corner of separation gel, with labelling sample order.

C. then separation gel is carefully moved in the staining utensil.

D. in staining utensil, add 50ml dyeing liquor (about 5 times of volumes), preservative film sealing, shaking table dyeing 3h.

7), decolouring

Dyeing liquor is gone.The gel of dyeing is with water rinse number time, and draining the water is placed in the staining dish, adds the 100ml destaining solution again, add a cover, the shaking table decolouring to the gel of dyeing till clearly demonstrating protein band after the decolouring.

5, Western hybridization technique

Usually we with the sample degeneration well after on 10%SDS-PAGE glue electrophoresis, albumen is transferred on the pvdf membrane by half-dried transferring film instrument.Through primary antibodie and two anti-labellings, utilize the colour developing of the ECL of GE company chemical luminous substrate, finally with the colour developing of X-ray egative film.

1) carry out electrophoresis according to the method for above-mentioned SDS-PAGE, but just with a clotting glue.

2) transferring film

A. cut one and PAGE glue sizable Immobilon-P Transfer Membrane and 4 3mm Whatman Chromatography paper.First Immobilon-P Transfer Membrane is dipped in about 30min in the methanol, in Transfer buffer, soaks again.Sponge and Whatman Chromatography paper also can be dipped in Transfer buffer during this period.

B. make electricity and turn sandwich, order is as follows:

Positive level (white or other light) sponge

2 Whatman Chromatography paper

Immobilon-P?Transfer?Membrane

PAGE glue

2 Whatman Chromatography paper

Negative level (black) sponge

After being overlying on the glue, drive bubble away with scoop to film.

3) the sandwich clip is put into the electrophoresis tank of the Transfer Buffer that is preinstalled with pre-cooling on ice, be sidelong into ice chest at negative pole one, add a cover energized.Constant voltage 100V, 1h.

4) after transferring film is finished, first Immobilon-P Transfer Membrane shaking table in 1 * TBST wash buffer is soaked 5min.

5) Immobilon-P Transfer Membrane is immersed among the 1 * TBST wash buffer that contains 5% skim milk, deposits in 4 ℃ of refrigerator overnight.

6) Immobilon-P Transfer Membrane is placed in the plastic bag of three side sealing mouth, add 5ml and contain 1 * TBST wash buffer of 5% skim milk and the mixed liquor of 2.5 μ l, 6 * His tag antibody, rotate gently with pipet and drive bubble away.Place and hatch 1h on the shaking table.

7) cut off plastic bag Immobilon-PTransfer Membrane is taken out, clean 3 * 10min with 1 * TBST wash buffer.

8) preservative film is flattened be laid on the laboratory table, with tweezers the edge of film is contacted a handkerchief paper gently water is drained, be tiled on the preservative film.

9) get a 15ml centrifuge tube, respectively get 1ml Detection reagent1 and Detection reagent2, mixing.

10) use the above-mentioned mixing drop of pipette, extract on Immobilon-P Transfer Membrane, timing 1 ~ 5min.

11) with preservative film Immobilon-P Transfer Membrane is wrapped up, be placed among the film cassette.

12) (lamp is turned off) in the darkroom, taken out a slice film, cut one jiao on the upper left side, be placed on the glue among the film cassette, attention will make film only depend on the edge of film cassette, builds lid, exposure 1min.

13) take out film, be put on the developing machine and develop photographic film.

14) take out again second new unexposed film, estimate the current time of exposing according to the effect of first film rinsing, carry out the exposure second time.

15) make a record at film, do contrast with the marker image of standard, estimate the molecular size range of the albumen of expression.

6, be used for the protein sample preparation of mass spectral analysis

About 5 * 10 ⁷The about 10mg total protein of the 293T cell lysate of stably express Flag-GFP and Flag-GFP-ALKBH4 is used for the preparation of protein sample.Use the method for immunoprecipitation, pearl (the anti-FLAG M2 agarose of cell pyrolysis liquid and 100ul coupling FLAG antibody, sigma) hatched 5 hours for 4 ℃, again with the TBS buffer solution for cleaning three times that contains 250mM NaCl, being combined on the pearl with the albumen of FLAG label is glycine (glycine) eluting of 100mM with the final concentration of pH 3.5.The albumen that elutes separates through SDS-PAGE, and silver dyes.Downcut specific band albumen, send company to do the LC-MS/MS mass spectral analysis.

7, cell culture

Freeze-stored cell recovery: in advance with 37 ℃ of water-bath modulation, from liquid nitrogen container, take out frozen cell and put into rapidly 37 ℃ of water-baths, then in water-bath, constantly shake cryopreservation tube, until cells frozen storing liquid just melts.With cell sucking-off from cryopreservation tube, put into the centrifuge tube that adds in advance culture medium with aseptic straw, room temperature rotating speed 1000rpm removed supernatant in centrifugal 3 minutes, used at last complete medium resuspended cell, put into 37 ℃ of incubators and cultivated.

Cell culture: the culture medium of MRC5 cell, 293T cell, OSC-20 cell and TOC2 cell is for containing 10% calf serum, 100U/ml two anti-(mycillins), nonessential aminoacid, the RPMI1640 culture medium of 1mM Sodium Pyruvate (Invitrogen, 31800022).The U2OS cell uses the DMEM high glucose medium to cultivate, and other compositions are identical.All cells contains in the 5%CO2 incubator and cultivates all at 37 ℃.Passage: suck first culture fluid in the culture dish, PBS washes once, add pancreatin at 37 ℃ of peptic cells, after microscopically is seen cell rounding or cell detachment, stop digestion with complete medium, the about 3-10 of digestion process minute, the concrete time decides according to cell type, and piping and druming dispels cell several times gently, takes out a certain amount of cell and be used for other experiment in new culture dish, unnecessary cell sucking-off is abandoned in the waste liquid cylinder, add fresh culture medium in the culture dish and continue to cultivate.

Cell cryopreservation: preparation contains RPMI1640 or the DMEM cryopreserving liquid of 10%DMSO and 20% calf serum, put into 4 ℃ of refrigerator pre-coolings, after attached cell digested centrifugal collection, cryopreserving liquid re-suspended cell with prior 4 ℃ of pre-coolings, by cryopreservation tube of each diameter 10cm culture dish cell packing, cryopreservation tube is put in the program freezing storing box that isopropyl alcohol is housed, placed-80 ℃ of refrigerator overnight, be saved in the liquid nitrogen container next day.

8, the foundation of stable cell lines

Among the present invention respectively with 293T, the MRC5 cell is recipient cell, has made up respectively the stable expression cell line of stably express GFP albumen, GFP-ALKBH4 albumen, 3 * Flag albumen, 3 * Flag-ALKBH4 albumen, HA albumen, HA-β-actin albumen.It is as follows to set up process: first recombiant plasmid is used the restricted enzyme linearisation, the selected restriction enzyme site principle of linearisation: do not affect the expression of its destination protein and resistant gene in eukaryotic cell behind the plasmid linearization, and the linearization plasmid purification is quantitative.When making it in transfection in six orifice plates, front 24 hours of transfection inoculation right quantity cell reaches 60%-70%, and with not containing antibiotic culture medium culturing.With 4 μ l Lipofectamine, 2000 (Invitrogen, 11668-027) with culture medium OPTI-MEM(31985, the Gibco of 2 μ g purpose plasmids respectively at 250 μ l serum-frees) mix, after static 5 minutes, both mixing are shaken up, and static 15 minutes.Suck during this time former culture medium, wash with PBS and once to add again the antibiotic OPTI-MEM culture medium of 500 μ l serum-frees in six orifice plates, quiescent time to after plasmid and Lipofectamine 2000 mixture are added in six orifice plates, change into after 4 hours and do not contain antibiotic culture medium and continue to cultivate.Add neomycin G418 screening positive cell after about 24 hours, the stable cell lines that contains the GFP fluorescin about about ten days screens positive cell with flow cytometer, the positive cell of some is continued to cultivate, after immunoblot experiment checking protein expression, a part is frozen, and a part is used for subsequent experimental.The stable cell lines of other label protein screens with G418 till a large amount of amplifications, and next step is frozen or be used for follow-up test.

9, immunofluorescence technique

1) cell of the about 30-40% of inoculation in six orifice plates adds medicine or transfection DNA, RNA next day, receives cell after 48 hours.

2) wash twice with PBS.

3) fixing: each hole adds 1ml at the methanol of-30 ℃ of refrigerator pre-coolings, fixes about 10 minutes on ice.

4) infiltration punching: PBS washes three times, adds 1ml 0.1% TritonX-100 and 0.5% NP-40 and permeates processing to cell, hatches on ice 10 minutes.

5) sealing: after PBS washes three times, with the TBST solution sealing that contains 5% skim milk 30 minutes.

6) the coverslip taking-up is placed in six orifice plates that are covered with sealed membrane, adds 100 μ l with the primary antibodie that contains 5% defatted milk powder TBST dilution, hatched one hour for 37 ℃.

7) the coverslip taking-up is placed in six orifice plates that do not have sealed membrane, cleans three times each 5 minutes with TBST.

8) coverslip is taken out be placed in six orifice plates that are covered with sealed membrane, it is anti-with the fluorescence two that contains 5% defatted milk powder TBST dilution to add 100 μ l, places it in the magazine 37 ℃ and hatches half an hour.

9) the coverslip taking-up is placed in six orifice plates that do not have sealed membrane, cleans three times with TBST, each 5 minutes, wash once with PBS again.

10) at last with the mountant transfect cell nuclear that contains DAPI (Vector H-1200), with transparent nail polish mounting.With Leica TCS SP5 confocal fluorescent microscope celluar localization is observed.

10, Immunoprecipitation

1) cell of the about 30-40% of inoculation in the 10cm culture dish, transfection next day plasmid, 48 as a child after collecting cell, centrifugal, twice of PBS cleaning.

2) add the long-pending 0.1%NET cell pyrolysis liquid of cell precipitation pentaploid, placed on ice 30 minutes.

3) ultrasonic degradation cell is placed on the EP pipe on ice and with cursory fixing, ultrasound condition: 10% output, ultrasonic time 1 minute each ultrasonic 10 seconds, stopped 20 seconds.

4) ultrasonic rear centrifugal in 4 ℃ of centrifuges, centrifugal 10 minutes of rotating speed 14800rpm.Take out supernatant solution, with the quantitative albumen of Bradford, take out 200 μ g as total protein, add 5 * the albumen sample-loading buffer, 95 ℃ of degeneration 10 minutes.

5) get the anti-Flag of 35 μ l, HA or GFP pearl and be added in the 1.5ml EP pipe, with the TBS buffer solution for cleaning three times that contains 150mM NaCl.

6) get the 1.5mg total protein and be added in the pearl that has cleaned, add again 0.1%NET lysis buffer polishing to 1ml, the EP pipe is put on the rotary incubator 4 ℃ hatched 5 hours.

7) with centrifugal 1 minute of 4 ℃ of centrifuge speed 5000g, supernatant discarded adds TBS buffer that 1ml contains 150mM NaCl and is put into rotary incubator and cleaned 5 minutes, centrifugal 1 minute of 4 ℃ of rotating speed 5000g, and supernatant discarded repeats to wash three times.

8) after the centrifugal supernatant discarded, once centrifugal again, with syringe liquid is blotted only, add 30 μ l 2 * albumen sample-loading buffers and 70 μ l, 1 * albumen sample-loading buffer, mixing, 95 ℃ of degeneration 10 minutes.Be used for that SDS-PAGE, follow-up silver dye, the Western experiment.

11, plasmid transfection

1) the previous day is inoculated 30% cell in 10ml antibiotic-free culture medium in transfection in the 10cm culture dish.

2) for each transfection hole, dilute 5 μ g plasmids in 500 μ l serum-frees and antibiotic OPTI-MEM culture medium, mixing, the PEI that gets 30 μ l 1mg/ml is added to the inside, mixing, static 15 minutes of room temperature.

3) culture medium in the culture dish is absorbed; clean once with PBS; add again 4.5ml serum-free and antibiotic OPTI-MEM culture medium; time to after the plasmid mixture of front is added in the cell; being put into 37 ℃ of incubators continues to cultivate; 4-6 as a child absorbed and contained the transfection reagent culture medium, changed fresh complete medium and continued to cultivate, and detected after 48 hours.

12, siRNA transfection

1) for the mRNA sequence of people ALKBH4, we entrust Shanghai Ji Ma company to design and synthesize three rules for the siRNA of different target spots.

2) the previous day is inoculated 30% cell in 2ml antibiotic-free culture medium in transfection in six orifice plates.

3) for each transfection hole, dilute 60pmol siRNA in 250 μ l serum-frees and antibiotic OPTI-MET culture medium, mixing.Add again 6 μ l Lipofectamine RNAiMAX (Invitrogen, 13778150), mixing, static 15 minutes of room temperature.

4) in the quiescent period, culture medium in six orifice plates is absorbed, clean once with PBS, in the transfection hole, add 750 μ l serum-frees and antibiotic OPTI-MEM culture medium.

5) arrive quiescent time after, mixture is added in the transfection hole.Cultivate in 37 ℃ of incubators to change in 4-6 hour and do not contain antibiotic complete medium.Experiment detects after 48 hours.

13, Flow Cytometry detects cell cycle

1) the previous day is inoculated 30% cell in 10ml antibiotic-free culture medium in transfection in the 10cm culture dish.After 24 hours, transfection siRNA changed liquid in 4-6 hour, put 37 ℃ of incubators and cultivated.

2) digest collecting cell after 48 hours, centrifugal 5 minutes of room temperature 1000rpm washes once with PBS, use again the middle buffer solution of cell cycle test kit (CycleTest Plus DNA regent kit, BD, Cat:340242) to clean once, centrifugal, abandon supernatant.

3) each sample adds 100 μ l buffer A, hatches 10 minutes for 37 ℃.

4) add 100 μ l buffer B, hatched 10 minutes for 37 ℃.

5) add 100 μ l buffer C, lucifuge incubated at room 10 minutes.

6) flow cytometer detects.

14, Flow Cytometry detects M phase cell

2) digest collecting cell after 48 hours, centrifugal 5 minutes of room temperature rotating speed 1000rpm washes once with PBS, with adding 1ml4% paraformaldehyde fixed cell, fixes 10 minutes on ice again.

3) add the PBS that 10ml contains 1%FBS and wash once, centrifugal 5 minutes of room temperature rotating speed 1000rpm abandons supernatant.

4) slowly add 90% methanol of 1ml-30 ℃ of pre-cooling, make the Premeabilisation of cells perforation, be placed on static 30 minutes on ice.

5) add the PBS that 10ml contains 1%FBS and wash once, centrifugal 5 minutes of room temperature rotating speed 1000rpm abandons supernatant.

6) add 100 μ l 1%BSA sealing, 37 ℃ were sealed 30 minutes.

7) room temperature room temperature 1000rpm is centrifugal 5 minutes, abandons supernatant, adds 100 μ l with the primary antibodie that 1%BSA dilutes good anti-Histone H3-S10P, hatches 1 hour at 37 ℃.

8) room temperature 1000rpm is centrifugal 5 minutes, abandons supernatant, adds 10ml PBST and cleans the centrifugal supernatant of abandoning.

9) add 100 μ l and dilute good two anti-ly with 1%BSA, hatched 30 minutes at 37 ℃.

10) room temperature 1000rpm is centrifugal 5 minutes, abandons supernatant, adds 10ml PBST and cleans the centrifugal supernatant of abandoning.

11) with 200 μ l PBS re-suspended cells, adding 10 μ l concentration is the RNase A of 10mg/ml again, and mixing was hatched 30 minutes at 37 ℃.

12) add propidium iodide (PI) solution that 20 μ l concentration are 1mg/ml, lucifuge was hatched 10 minutes.

13) flow cytometer detects.

15, Flow Cytometry detects apoptosis

2) digest collecting cell after 48 hours, centrifugal 5 minutes of room temperature rotating speed 1000rpm washes once with PBS,

3) next use the apoptosis test kit Annexin V-FITC ﹠amp of Beijing Jiamei company; PI Detection Kit labelling apoptotic cell, back are pressed the kit method operation.

4) flow cytometer detects.

16, separation of shrink ring and middle body protein.

1) at the MRC5 Growth of Cells during to 50% left and right sides, the adding final concentration is that the thymidine (thymidine) of 2mM was cultivated 16 hours, wash once with PBS, add fresh culture and continue to cultivate 4-5 hour, the nocodazole that adds final concentration again and be 0.1 μ g/ml continues to cultivate 5 hours.

2) the drug treating time begins to collect division cells after reaching, the cell that is in division stage can shrink that to become circle adherent insecure, so we adopt and to rock culture bottle the cell of division stage is rocked, there are 37 ℃ of fresh culture medium to wash twice the division cells of collecting, add 37 ℃ of fresh culture medium again and continue to cultivate 0.5-1 hour, purpose is in order to make cell be in the cytokinesis phase.

3) cell that obtains is divided into two parts, a part is extracted total protein with the cracking of protein cleavage buffer, another part adding final concentration is that taxol and the phalloidin of 5 μ g/ml stablizes spindle microfilament micro-tubular structure, hatched 0.5-1 minute, centrifugal 1 minute of room temperature rotating speed 1000rpm, supernatant discarded slowly adds aquesterilisa along tube wall and cleans cell, sucks moisture content.

4) the hypotonic lysis buffer (2mM Pipes at pH6.9,0.25% Triton X-100,20ug/ml taxol) of ten times of cell precipitation volumes of adding, re-suspended cell, incubated at room 20 minutes,

5) room temperature rotating speed 2000rpm is centrifugal 20 minutes, and supernatant discarded is placed on cooled on ice.

6) add 1ml 50mM pH6.3MES lysis buffer is cleaned up, use the resuspended precipitation of 100 μ l 50mM pH6.3 MES again, resuspended precipitation is layered on 40% the glycerol, centrifugal 20 minutes of room temperature rotating speed 2000g is precipitated albumen.Add 50 μ l albumen sample-loading buffers, 95 ℃ of Denatured proteins.

Embodiment two: purification ALKBH4 fusion rotein prepares anti-ALKBH4 albumen rabbit source antibody

1, ALKBH4 protein structure domain and possible active mechanism

Escherichia coli AlkB albumen is monokaryon non-heme Fe ²⁺Dioxygenase superfamily member with the α-ketoglutaric acid dependence, it is take metal ion as prothetic group take oxygen molecule as cosubstrate, activate the contacted Me of nitrogen-atoms on dioxygen Journal of Molecular Catalysis oxidation and the stable heterocycle, make it conformation and change, thereby remove Me by the form of release formaldehyde.ALKBH albumen is human dioxygenase AlkB protein family a member, and the general character of this family protein is to have escherichia coli AlkB protein function domain: the ferrous ion binding structural domain is HxDx _nThe H domain, α-ketoglutaric acid and Binding Capacity domain are the RxxxxxR domain.And ALKBH4 albumen also has such domain: iron ion binding structural domain H169-D171-H254, and α-ketoglutaric acid and Binding Capacity domain R265-R271, as shown in Figure 1.Histone demethylase JHDM family protein also belongs to the dioxygenase albumen of iron ion and α-ketoglutaric acid dependence, they are specific protein demethylases, and dioxygenase AlkB family protein has identical demethylation mechanism with the JHDM family protein, as shown in Figure 2, the effect substrate of this explanation AlkB family protein also may be protein, and namely ALKBH4 albumen is potential protein demethylase.

2, purification 6 * His-ALKBH4 wild type and mutant fusion protein.

According to the domain of ALKBH4 and the demethylation mechanism similar to histone demethylase, we predict that ALKBH4 albumen has the activity of protein demethylation, therefore to study the activity of ALKBH4, at first to analyze ALKBH4 albumen at external biochemical activity, we have made up the recombiant plasmid pDEST17-ALKBH4 of escherichia coli expression, he can express 6 * His-ALKBH4 fusion rotein, the people ALKBH4 cDNA sequence that expression obtains is seen sequence table SEQ ID NO.1, and the people ALKBH4 protein sequence that translation obtains is seen sequence table SEQ ID NO.6.We use the rite-directed mutagenesis test kit of Stratagene company to make up pDEST17-ALKBH4 H169A-D171A-H254A mutant plasmid, used point mutation primer has: H169A-D171A mutant primer SEQ ID NO.18 and two point mutation primers of H254A mutant primer SEQ ID NO.19, the people ALKBH4 HDH mutants cDNA sequence that expression obtains is seen sequence table SEQ ID NO.2, and the people ALKBH4 HDH mutant protein sequence that translation obtains is seen sequence table SEQ ID NO.7.

Purification 6 * His-ALKBH4 wild-type protein and HDH mutant fusion protein albumen: wild type and mutant recombinant plasmid transformed are in protease-deficient BL21 competent cell, be coated with flat board, the picking monoclonal, be seeded in the LB culture medium that contains 100 μ g/ml ampicillin, in 37 degree shaking tables, cultivate amplification.When wavelength 600nm place light absorption value reaches between the 0.5-0.6, added 25 ℃ of inducing culture of final concentration 0.1mM IPTG 4 hours.At 4 ℃ of centrifugal collection thalline of rotating speed 4000rpm, bacterial precipitation is resuspended in the long-pending lysate of decaploid, ultrasonication, ultrasound condition is different and different with cracking condition, ultrasonic after, centrifugal 20 minutes of 4 ℃ of rotating speed 16000rpm, supernatant was soluble protein.

Utilize the quick protein purification system of Bio-Rad that soluble protein is carried out purification, albumen for 6 * His label, the first step, utilize Bio-ScaleIMAC cartridge(BIO-RAD 732-4610) carry out affinity purification, dye to identify again the purity of gained albumen with SDS-PAGE electrophoresis and Coomassie brilliant blue, purification result as shown in Figure 3.Among the figure, M represents the molecular weight of albumen standard substance, and S represents soluble protein, and F represents the composition that complete pillar flows out on the soluble protein, digitized representation collecting pipe numbering.

Can find out that from the result collecting pipe purity of front is not high, the purity of back is high, so we are collected together the 12-20 pipe of wild-type protein, and the 8-12 pipe of mutant is collected together, and finds that with Bradford reagent quantitative albumen concentration is lower.Next step uses albumen concentration tube protein concentrate, and the albumen concentration tube that we use is VIVASPIN 20 concentration tubes of Sai Duolisi company, can hold back the above protein molecular of 10KD, so not only can protein concentrate but also can remove small molecular weight impurity.Protein quantification after concentrated also detects purity with SDS-PAGE electrophoresis, coomassie brilliant blue staining, immunoblot experiment, the result as shown in Figure 4, Fig. 4 a is the coomassie brilliant blue staining result, Fig. 4 b, c are the immunoblot experiment results.The result shows that we surpass 95% by resulting purity of protein, have reached the purity of biochemical analysis.

3, purification GST-ALKBH4 fusion rotein reaches the antibody for the preparation of immunofluorescence experiment

The function antibody of an albumen of research is very crucial experiment material, owing to there is not business-like ALKBH4 antibody, so we want own Dispersal risk, at first we will study ALKBH4 at thin inner cellular localization and need look for ALKBH4 effect substrate and interaction factor thereof, so just need one of preparation can identify the antibody of the three-dimensional epi-position of ALKBH4 molecule, we just need one of purification to have the ALKBH4 molecule of nature conformation as immunogen, because the purity of 6 * His-ALKBH4 fusion rotein of purification is done the standard of antibody not before, so we select GST label plasmid as expression system.At first we make up the pGEX-5X-2-ALKBH4 recombiant plasmid, select restriction enzyme site, the design primer, forward primer is SEQ ID NO.11, reverse primer is SEQ ID NO.12, from the 293T cell, extract mRNA, reverse transcription PCR amplification ALKBH4 gene, the ALKBH4 cDNA sequence that increases is SEQ ID NO.1, enzyme action connects, choose monoclonal upgrading grain order-checking, verify errorless after, plasmid increases.The ALKBH4 protein sequence that plasmid expression obtains is SEQ ID NO.6.

Purification GST-ALKBH4 wild type fusion rotein: at first will carry out solubility and identify, recombinant plasmid transformed is in the BL21 competence antibacterial of protease-deficient, be coated with flat board, the picking monoclonal is seeded in the LB culture medium that contains 100 μ g/ml ampicillin amplification cultivation in 37 ℃ of shaking tables.When wavelength 600nm light absorption value reaches between the 0.5-0.6, added 25 ℃ of inducing culture of 0.1mM IPTG 4 hours.The centrifugal collection thalline of room temperature rotating speed 4000rpm.Bacterial precipitation is resuspended in the long-pending lysate of decaploid, ultrasonication, ultrasonic rear taking-up 1/5th is as total protein, centrifugal 20 minutes of 4 ℃ of rotating speed 16000rpm, supernatant is soluble protein, again total protein (T), supernatant (S) and precipitation (P) are added the albumen sample-loading buffer, 95 ℃ of degeneration 10 minutes.With the BL21 of Pignus pignoris grain not in contrast, processing method as above.The sample processed in two groups of samples on the identical ratio, is done SDS-PAGE electrophoresis coomassie brilliant blue staining for one group, and another group is done immunoblot experiment checking solubility and expression.The result is shown in Fig. 5 a, and GST-ALKBH4 fusion protein expression height and solubility are fine.

Next step utilizes the quick protein purification system of Bio-Rad that soluble protein is carried out purification, albumen for the GST label, the first step, utilize Bio-Scale Profinity GST cartridge (BIO-RAD, 732-4620) carry out affinity purification, the purifying protein amount is very large but purity is not high as a result, shown in Fig. 5 b.This moment, purity of protein was fewer than Dispersal risk, therefore the lower step will take ion-exchange chromatography to be further purified, the isoionic point pI value that software analysis obtains the GST-ALKBH4 fusion rotein is 6.86, be difficult to determine near neutral ion exchange effect, we carry out further purification by choice for use cation exchange column (Column UNO-S1, BIO-RAD).Purification effect is fine as a result, and the purity of protein of all collecting pipes has all reached the standard of making antibody, and purity reaches more than 98%, and purification result is shown in Fig. 5 c.Among the figure, M represents protein standard substance, and S represents soluble protein, and F represents the composition that complete pillar flows out on the soluble protein, digitized representation collecting pipe numbering.It is concentrated that gained albumen is collected rear VIVASPIN 20 concentration tubes with Sai Duolisi company of mixing, delivers to the system in Beijing Jing sky and become Bioisystech Co., Ltd's Dispersal risk.Antibody purification: the rabbit that company finishes immunity kills blood-letting, centrifuging and taking serum, the Protein A Sepharose affinitive layer purification rabbit source antibody of use sigma company.We make final concentration reach 15mM the Hydrazoic acid,sodium salt that the ALKBH4 antibody that obtains adds 1.5M, and adding the Hydrazoic acid,sodium salt purpose is in order to prevent that antibody is by bacterial decomposition.

Antibody checking: in the MRC5 cell, use the reticent ALKBH4 gene of siRNA, concrete RNA silencing methods is seen embodiment one, used ALKBH4siRNA sequence is seen sequence table SEQ ID NO.27, SEQ ID NO.28 and SEQ ID NO.29, we reduce the ALKBH4 protein expression with these three siRNA sequence mixing transfectional cells.Adopt the specificity of immunofluorescence method detection ALKBH4 antibody again, find the middle body structure and the centrosome that are positioned at cytokinesis of this antibody specificity, as shown in Figure 7, follow-up also have immunofluorescence experiment checking ALKBH4 in intracellular location.

4, for the preparation of the rabbit source ALKBH4 antibody of immunoblot experiment

Prepare the antibody that can be used in immunoblot experiment, in order to improve the specificity of antibody, polypeptide is optimum selection as immunogenic antibody.We cooperate with Kang Wei ShiJi Co., Ltd, and the upper much higher peptide 101-QSGRKKQDYGPK-112 of immunogenicity of the synthetic ALKBH4 of company is shown in Fig. 8 a.Three immune rabbits, concrete experiment process and use reagent company maintain secrecy.The rabbit that kills that immunity is good is got the centrifugal acquisition serum of blood, with the Protein A antibody purification of Sigma company.The antibody that purification is good is with the specificity of immunoblot experiment checking ALKBH4 antibody.GST-ALKBH4 albumen and the GST albuminous degeneration of front purification are processed, upper two groups of sample SDS-PAGE electrophoresis, transferring film, use respectively ALKBH4 antibody and GST antibody hybridization checking, found that ALKBH4 antibody can identify GST-ALKBH4 albumen, although below several assorted bands are arranged, find it is the albumen of degraded after the hybridization of GST antibody, so this antibody can be used for immunoblot experiment, shown in Fig. 8 b.We also detect ALKBH4 antibody specificity and protein expression level in eukaryotic cell, use ALKBH4 siRNA reticent ALKBH4 gene in the MRC5 cell, used ALKBH4 siRNA sequence is seen sequence table SEQ ID NO.27, SEQ ID NO.28 and SEQ ID NO.29, cell lysis extracts albumen and does the immunoblot experiment detection, found that the ALKBH4 expression is starkly lower than matched group in the cell of transfection siALKBH4, shown in Fig. 8 c, the ALKBH4 albumen of the identification eukaryotic cell expression that this explanation ALKBH4 can be specially.

Sum up, our purification be used for 6 * His-ALKBH4 wild type and the HDH mutant fusion protein that biochemical activity is analyzed, to analyze the ALKBH4 protein active ready for next step.Also prepared simultaneously two kinds of antibody that can be used for immunofluorescence experiment and immunoblot experiment, and by the gene silencing experimental verification specificity of these two antibody, for the functional study of back lays the first stone.

Embodiment three: checking ALKBH4 gene is in intracellular location and expression

1, the ALKBH4 protein localization is on centrosome (centrosome).

This experiment verifies that by immunofluorescence technique ALKBH4 is at thin inner cellular localization, the MRC5 cell is inoculated in six orifice plates that are covered with coverslip, inoculum density 30-40%, the Nocodazole that adds final concentration 0.04 μ g/ml evening next day processed 16 hours, and adding the Nocodazole purpose is to make cell block in mitotic phase.Wash once with PBS after 16 hours, change fresh complete medium into and continue to cultivate 1 hour, PBS washes twice, fixing infiltration punching, and concrete grammar is with embodiment one.Primary antibodie uses centrosome label γ-tubulin and spindle label α-tubulin and ALKBH4 antibody jointly to hybridize, and the anti-Mus two of two anti-use FITC couplings resists the anti-rabbit two anti-hybridization with the Cy3 coupling.Use Laser Scanning Confocal Microscope, take the cell cycle ALKBH4 celluar localization in each period, from the interphase cell to the mitosis telophase, see among the result that ALKBH4 locates altogether with centrosome label γ-tubulin each period, shown in Fig. 9 a, this explanation ALKBH4 protein localization is at centrosome.Simultaneously we also find the anaphase of cell division and latter stage, ALKBH4 albumen is located at retraction ring (contractile ring) and middle body (midbody), shown in Fig. 9 b, the below will describe in detail.But do not find that ALKBH4 and spindle label α-tubulin locate altogether, just locate altogether at middle body in mitosis telophase, the ALKBH4 delocalization is described on spindle, shown in Fig. 9 b.

Locate at centrosome in order further to verify ALKBH4 albumen, we make up MRC5/3 * Flag and MRC5/3 * Flag-ALKBH4 stable cell lines, purpose identifies that the ALKBH4 of heterogenous expression is in intracellular location, at first make up the ALKBH4 plasmid of 3 * Flag label, the primer is seen sequence table forward primer SEQ IDNO.14 and reverse primer SEQ ID NO.15, amplification obtains people ALKBH4 cDNA and sees sequence table SEQ ID NO.1, expresses people ALKBH4 wild-type protein and sees sequence table SEQ ID NO.6.Also make up simultaneously the ALKBH4 H169A-D171A-H254A mutant plasmid of 3 * Flag label, used point mutation primer has: H169A-D171A mutant primer SEQ ID NO.18 and two point mutation primers of H254A mutant primer SEQ ID NO.19, and express people ALKBH4 HDH mutant protein and see sequence table SEQ ID NO.7.Again with the plasmid transfection MRC5 cell construction stable cell lines that builds.We hybridize jointly with Flag and γ-tubulin antibody, and with corresponding fluorescence two anti-hybridization.The ALKBH4 albumen that found that external source is also located altogether with γ-tubulin, and the cell of expressing 3 * Flag empty carrier location altogether not, as Figure 10 a just further proof ALKBH4 be positioned on the centrosome.We have also adopted the method separation center body of sucrose concentration gradient centrifugation, and detect the expression of ALKBH4 in centrosome with the immunoblot experiment method, with the intrinsic albumen γ-tubulin of centrosome and CEN1 as positive control, it is identical to find that ALKBH4 expression trend and CEN1 are same as γ-tubulin, shown in Figure 10 a, this as a result let us be sure of the ALKBH4 protein localization in center prompting and be the proper constituent of centrosome.

2, ALKBH4 is positioned on retraction ring (contractile ring) and the middle body (midbody).

The immunofluorescence experiment of front is tentatively found ALKBH4 when mitosis anaphase and cytokinesis and α-tubulin locates altogether, and shown in Fig. 9 b, we guess that ALKBH4 is positioned on the middle body.In order to verify conjecture, use chemical markers phallotoxins-Texas Red and the ALKBH4 antibody cohybridization cell of F-actin, F-actin can the visible marking go out retraction ring and middle body structure, found that ALKBH4 albumen and F-actin have significantly altogether location at retraction ring and middle body in the MRC5 cell, shown in Figure 11 a, external source 3 * flag-ALKBH4 also has significantly altogether location in F-actin at retraction ring and middle body simultaneously, shown in Figure 11 b.Another molecular marked compound anillin with ALKBH4 antibody and retraction ring and middle body does immunofluorescence dyeing jointly again, and the result shows that ALKBH4 and anillin locate fully altogether on retraction ring and middle body, shown in Figure 11 c.These results prove that ALKBH4 is positioned on retraction ring and the middle body.

For checking ALKBH4 molecule is retraction ring and middle body component, we are with chemical method separation of shrink ring and middle body protein from the MRC5 cell, stablize spindle microfilament microtubule with taxol and phalloidin, hypotonic processing cell lysis, obtain retraction ring and middle body protein, whether western blotting method checking ALKBH4 expresses in the above, we use retraction ring and middle body tag albumen NM II, Plk1, actin and α-tubulin are as positive control albumen, p53 is as negative control albumen, the result is shown in Figure 11 d, and ALKBH4 and positive control molecule are all expressed in the body component in the retraction ring that we are separated to, and negative control molecule p53 does not express in the above, this illustrates our separation method success, and proof ALKBH4 is retraction ring and middle body protein.

Sum up, immunofluorescence experiment proof ALKBH4 is positioned on centrosome, retraction ring and the middle body, and centrosome and retraction ring and middle body separating experiment proof ALKBH4 are the components of these organelles.

Embodiment four: checking ALKBH4 interaction protein Pseudobulbus Bletillae (Rhizoma Bletillae) effect substrate

1, research ALKBH4 latent effect substrate or interaction factor

Learn that in the face of the result ALKBH4 is positioned on centrosome, retraction ring and the middle body in the past, so we predict that ALKBH4 is relevant with cell division, may participate in the demethylation of some albumen in the fission process.Although existing article shows that ALKBH4 albumen has biochemical activity in experiment in vitro, its concrete effect substrate and interaction protein are not clear.We adopt the method for immunoprecipitation to seek interaction factor or the demethylation substrate of ALKBH4 albumen, at first make up the pEGFP-C1b-ALKBH4 plasmid, the primer such as sequence table: forward primer SEQ ID NO.13 and reverse primer SEQ ID NO.12, amplification obtains ALKBH4 cDNA sequence such as sequence table SEQ ID NO.1, it is connected into plasmid order-checking amplification, expresses people ALKBH4 albumen and see sequence table SEQ ID NO.6.Also make up simultaneously pEGFP-C1b-ALKBH4 H169A-D171A-H254A mutant plasmid, used point mutation primer has: H169A-D171A mutant primer SEQ ID NO.18 and two point mutation primers of H254A mutant primer SEQ ID NO.19, this plasmid expression people ALKBH4 HDH mutants cDNA is seen sequence table SEQ ID NO.2, and interpreter ALKBH4 HDH mutant protein is seen sequence table SEQ ID NO.7.Be transfected into 293T cell construction stable cell lines.293T/Flag-GFP and the 293T/Flag-GFP-ALKBH4 stable cell lines cultivated were processed cell 16 hours with 0.04 μ g/ml nocodazole, it is synchronized to mitotic phase, again lysis is collected Flag-GFP, Flag-GFP-ALKBH4 albumen and and their mutual protein samples with the method for immunoprecipitation.With two groups of sample degenerative treatments, the SDS-PAGE electrophoresis, with silver-colored transfection reagent box glue is dyeed, also with the efficient of immunoblot experiment checking co-immunoprecipitation method, result such as Figure 12 a are shown in the b simultaneously, our sample sets is compared with matched group has many specific bands, Beijing collection Si Jiayang biotechnology company is delivered in these bands cutting-outs do mass spectral analysis, the detection method of use is the analysis of the online LC-MS/MS second order ms of chromatograph mass spectrum, also detects simultaneously the methylation state of protein.After obtaining analysis result, we therefrom screen with a high credibility and are the albumen relevant with cell division, from the result, find the albumen such as actin (actin), non-muscle two type myosins (NM II), wherein the credibility of actin is the highest, and has a monomethylation site and namely the 84th modify for lysine monomethylation (K84me1).Detecting actin, to have methylated peptide section be 69-YPIEHGIVTNWDDME _mKIWHHTFYNELR-95, karyoplasmic ratio m/z=1153.22, charge number 3, molecular weight is MH+ (Da)=3457.661106, and it is than the large 14.02Da of peptide segment molecule amount that does not normally have to modify, and this molecular size range just in time is the size of a methyl group, the mass spectrometric data software analysis, the search Protein Data Bank learns that this modification that methylates is sitting at the position of actin K84, and result such as Figure 12 c are shown in the d.

2, whether checking ALKBH4 interacts with actin

For verifying whether ALKBH4 and actin have interaction, we have made up the β of HA label-actin recombiant plasmid, the primer sequence is seen sequence table: forward primer SEQ ID NO.16 and reverse primer SEQ ID NO.17, amplification obtains β-actin cDNA and sees sequence table SEQ ID NO.4, is connected to express β-actin wild-type protein in the pcDNA3-HA plasmid and see sequence table SEQ ID NO.9.At first whether the ALKBH4 of Study of Exogenous interacts with the β of external source-actin, whether be co-immunoprecipitation experiment detection Flag-GFP-ALKBH4 with the agarose gel pearl of anti-Flag label interacts with HA-β-actin, the result shows that Flag-GFP-ALKBH4 can interact with HA-β-actin, shown in Figure 13 a.We verify again endogenous ALKBH4 and the interaction between β-actin for next step, use respectively β-actin and ALKBH4 antibody to do the co-immunoprecipitation experiment, the endogenous ALKBH4 albumen of result and β-actin mutually pull down get off, result such as Figure 13 b, shown in the c, has interaction between this explanation ALKBH4 and the actin.

Embodiment five: actin K84 is the critical sites of ALKBH4 and NM II combination.

1, the 84th of acitn the lysine plays a key effect to the combination of ALKBH4

The result of front shows that ALKBH4 albumen and actin interact, and in the mass spectrum result, obtain interactional actin albumen and have the site K84me1 that methylates, so we guess that this site that methylates probably is exactly the binding site of ALKBH4.In order to prove our conjecture, we become alanine with the rite-directed mutagenesis test kit of Sratagene company with the 84th lysine mutation of β-actin of HA-β-actin plasmid is K84A, used point mutation primer is seen sequence table SEQ ID NO.20, express β-actin K84A mutants cDNA and see sequence table SEQ ID NO.5, translation β-actin K84A mutant protein is seen sequence table SEQ ID NO.10.Whether the method detection actin K84A sudden change with same co-immunoprecipitation interacts with ALKBH4.With Flag-GFP-ALKBH4 and the common transfection 293T of HA-β-actin cell, Flag label co-immunoprecipitation found that Flag-GFP-ALKBH4 can get off the HA-β of external source wild type-actin pull down, but HA-β-actin K84A mutant pull down can not be got off, with the endogenous actin of actin antibody test whether can in conjunction with, we find that endogenous actin can be by under the Flag-GFP-ALKBH4 pull down in two groups of samples, shown in Figure 14 a, this explanation actin K84 plays a key effect to the combination of ALKBH4.For this conclusion of sufficient proof, we have and have done reverse co-immunoprecipitation, namely draw 3 * Flag-ALKBH4 with HA-β-actin, found that HA-β-actin can pull down 3 * Flag-ALKBH4, but HA-is β-and actin K84A mutant but cannot, shown in Figure 14 b, this two experimental evidences explanation actin K84 be ALKBH4 in conjunction with critical sites.

Actin K84 is the binding site of ALKBH4, and our mass spectrum found that actin K84me1 modifies, ALKBH4 or potential protein demethylase, so we guess that ALKBH4 may be the demethylase of actin K84me1, the iron ion binding site of ALKBH4 has been proved to be to determine the critical sites of its biochemical activity, so if ALKBH4 is the demethylase of actin K84me1, so the enzymatic activity critical sites sudden change of ALKBH4 can be made the binding ability of it and substrate strengthen.Imagining our contrived experiment according to this suddenlys change the HDH domain of ALKBH4 fall, see whether this sudden change affects the interaction ability between ALKBH4 and the actin as our imagination, used point mutation primer has: H169A-D171A mutant primer SEQ ID NO.18 and two point mutation primers of H254A mutant primer SEQ ID NO.19, this plasmid expression people ALKBH4HDH mutants cDNA is seen sequence table SEQ ID NO.2, and interpreter ALKBH4HDH mutant protein is seen sequence table SEQ ID NO.7.This mutant and the common transfection 293T of wild type cell are done the co-immunoprecipitation experiment, found that the binding ability between Flag-GFP-ALKBH4HDH mutant and the HA-β-actin has strengthened much than wild type, be that Flag-GFP-ALKBH4 HDH pulls down more HA-β-actin, shown in Figure 14 c, this presentation of results ALKBH4 probably is the demethylase of actin K84me1.

2, ALKBH4 and non-muscle two type myosins (NM II) interact

From the mass spectrometric data result obtain ALKBH4 albumen may and non-muscle two type myosins (NM II) between combination is arranged, so we will be with between them whether interaction being arranged under the immunoblot experiment checking, so the co-immunoprecipitation that we just do Flag-GFP-ALKBH4 transfection 293T cell experiment, the result shows that ALKBH4 can pull down NM II, shown in Figure 15 a, this explanation NM II also may be interaction factor or the substrate of ALKBH4.

Interaction between Actin and the NM II has been found that for a long time, if ALKBH4 can be with actin K84me1 demethylation, this demethylation has function certainly in cell so, can that actin K84 affect the interaction between NM II? find that by searching document existing scientist did crystal structure analysis, the result shows that actin K84 site is positioned at the calmodulin binding domain CaM of NM II, so we guess that the modification of actin K84 or change may affect NM II combination.We adopt anti-HA co-immunoprecipitation method to detect the binding ability of HA-β-actin wild type and K84A mutant and NM II in the 293T cell, the binding ability that experimental result shows HA-β-actin K84A and NM II is weak more a lot of than wild type, shown in Figure 15 b, this explanation actin K84 is the binding site of NM II.We also detect with reverse co-immunoprecipitation method whether whether GFP-NM II can be in conjunction with HA-β-actin K84A mutant, the result shows that GFP-NM II can not be in conjunction with HA-β-actin K84A mutant, but can be in conjunction with wild type HA-β-actin and endogenous actin, shown in Figure 15 c, this explanation actin K84 is the crucial binding site of NM II.

Embodiment six: the interaction between ALKBH4 and the NM II mediates by actin.

According to above result, we have known that ALKBH4 and actin and NM II interact, interaction between actin and the NM II is delivered, we want to understand how these three protein moleculars mutually combine now, that three albumen mutually combine or certain albumen connects two other albumen as intermediate? verify at first whether ALKBH4 can affect the combination of actin and NM II, in the 293T cell, the ALKBH4 gene silencing is fallen, used three ALKBH4 siRNA sequences are seen sequence table: SEQ ID NO.27, SEQ ID NO.28 and SEQ ID NO.29, suppress the ALKBH4 protein expression and see sequence table SEQ ID NO.6, the result shows that the disappearance of ALKBH4 can not have influence on the interaction between actin and the NM II, as shown in figure 16, this explanation ALKBH4 does not mediate the combination of actin and NM II.Second, whether checking NM II gene can have influence on the interaction between ALKBH4, we fall NM II gene silencing in the 293T cell, used three NM II siRNA sequences are seen sequence table: SEQ ID NO.30, SEQ ID NO.31 and SEQ ID NO.32, the result shows that NM II disappearance can not have influence on the interaction between ALKBH4 and actin, the result as shown in figure 17, this explanation NM II does not mediate the interaction between ALKBH4 and actin yet.This result also is verified by adding NM II inhibitor B lebbistatin, the Blebbistatin that adds final concentration and be 5 μ M when cultivating the 293T cell processed cell 3 hours, receive cell after the drug treating and do the co-immunoprecipitation experiment, the result shows that NM II inhibitor is on not impact of the interaction between ALKBH4 and actin, just destroyed the combination between NM II and actin, as shown in figure 18, these two experiment show NM II can not affect the interaction between ALKBH4 and actin.The 3rd, whether checking actin can have influence on the interaction between ALKBH4 and NM II, because so the actin kind is many and low actin polymerization inhibitor cytochalasin D (the Cytochalasin D that selects of gene silencing efficient, CCD), this medicine can suppress actin and aggregates into fibrous actin(F-actin).Be that 1 μ g/ml CCD is added in the 293T cell culture medium with final concentration, cultivate and receive lysis after 1.5 hours, also will add the CCD of 1 μ g/ml in lysis buffer, the back is identical with normal co-immunoprecipitation method.The result shows that the adding of actin inhibitor causes the interaction between ALKBH4 and NM II and actin to destroy, and as shown in figure 19, this explanation actin is the interactional middle element between ALKBH4 and the NM II.Be combined in simultaneously on the actin fiber according to above as a result our inference ALKBH4 and NM II, the actin fiber has mediated the interaction between ALKBH4 and NM II.

Embodiment seven: ALKBH4 is the demethylase of actin K84me1.

It is existing that we know that ALKBH4 and actin mutually combine as a result, actin K84 be ALKBH4 in conjunction with critical sites, ALKBH4 enzymatic activity domain inactivation causes strengthening with the combination of actin, and actin K84me1 has a monomethylation site among the mass spectrum result, and all these evidences show that ALKBH4 probably is the demethylase of actin K84me1.In order to verify that this conjecture has at first prepared the antibody for actin K84me1, look for the preparation of U.S. New England Peptide company for the antibody of actin K84me1, they obtain antiserum with the upper 77-TNWDDMEmKIWHHTFY-91 of the actin peptide section immune rabbit of modifying that methylates, with Protein A antibody purification, again with the methylate antibody for actin K84me1 of chromatographic column purification specificity of polypeptide of coupling.

Checking antibody: what we will methylate and modify contains the K84me1 polypeptide and does not methylate the K84 polypeptide point modified to nitrocellulose filter, and with the hybridization of this antibody, the result shows the polypeptide that the identification of actin K84me1 antibody specificity methylates and modifies, the polypeptide that nonrecognition does not methylate and modifies, identical with Ponceau S dyeing proof applied sample amount, the result is shown in Figure 20 a, we also verify the specificity of antibody with heterogenous expression HA-β-actin wild type and K84A transfection with mutant 293T cell simultaneously, the result proves that this antibody can not identify HA-β-actin K84A but can identify wild type, shown in Figure 20 b, these two results prove that the antibody of anti-actin K84me1 has very special identification ability, can be used for verifying that the expression of actin K84me1 changes.

Verify that with immunofluorescence technique actin K84me1 is in intracellular location, we hybridize as label and the actinK84me1 of retraction ring and middle body jointly with a-tubulin, and with two kinds of primary antibodies of the anti-hybridization identification of coupling Cy3 and FITC molecule two kind two, the result shows that actin K84me1 is positioned on retraction ring and the middle body, as shown in figure 21.

Checking ALKBH4 is actin K84me1 demethylase: we verify first the whether demethylase of actin K84me1 of ALKBH4 in vivo, at first, the ALKBH4 gene is reticent in the U2OS cell, used three ALKBH4 siRNA sequences are seen sequence table: SEQ ID NO.27, SEQ ID NO.28 and SEQ ID NO.29, suppressing endogenous ALKBH4 Protein S EQ ID NO.6 expresses, detect the ALKBH4 gene silencing and cause that actin K84me1 expression increases considerably, shown in Figure 21 a, crossing simultaneously expression external source 3 * Flag-ALKBH4 causes actin K84me1 expression to reduce in a large number, excessively expressing 3 * Flag-ALKBH4 HDH point mutation in the U2OS cell then causes actin K84me1 expression to increase, shown in Figure 21 b, these two presentation of results ALKBH4 wild-type proteins in vivo can be with actin K84me1 demethylation, and the HDH mutant does not have this activity.Crossing simultaneously the insensitive 3 * Flag-ALKBH4 of expression ALKBH4 siRNA in the U2OS cell can make actin K84me1 get back to normal level, and 3 * Flag-ALKBH4 HDH of enzymatic activity domain sudden change can not, shown in Figure 21 c, this explanation 3 * Flag-ALKBH4 wild type has the demethylation activity, and the HDH mutant does not have activity.The co-immunoprecipitation experiment is found in addition, ALKBH4 and NM II can both pull down actin, but the actin majority that ALKBH4 is left behind is methylated, and the actin that NM II pulls down does not methylate to modify, shown in Figure 21 d, this explanation actin K84me1 disturbs the combination of NM II, and above NM II can be combined in after only having ALKBH4 with actin K84me1 demethylation, the demethylation activity of ALKBH4 was the key factor that NM II slides along the actin fiber.Above presentation of results in vivo ALKBH4 albumen is the demethylase of actin K84me1, ALKBH4 provides binding site with actin K84me1 demethylation on the actin for NM II is combined in, also for sliding at the actin fiber, NM II provides condition, and ALKBH4 is positioned on the retraction ring, the major impetus source that retraction ring shrinks is exactly that the slip effect of NM II on the actin fiber produces, therefore the decisive molecule that slides at actin of ALKBH4 thing NM II, it is determining that can retraction ring shrink and is finishing cytokinesis

Embodiment eight: ALKBH4 regulates and control cytokinesis, and the ALKBH4 disappearance causes the cytokinesis failure.

The interaction protein Pseudobulbus Bletillae (Rhizoma Bletillae) demethylation substrate of the existing known ALKBH4 of result, but we do not know also which type of cytobiology is its these mechanism can cause change, in order to verify that controlling retraction ring about ALKBH4 among the upper embodiment shrinks the guess that determines cytokinesis, we adopt immunofluorescence, Flow Cytometry to go checking.Research in front finds that ALKBH4 is positioned on retraction ring, middle body and the centrosome, so we concentrate on the emphasis of research on the fissional phenomenon.At first we are with ALKBH4 gene silencing in the MRC5 cell, used three ALKBH4 siRNA sequences are seen sequence table: SEQ ID NO.27, SEQ ID NO.28 and SEQ ID NO.29, suppressing endogenous ALKBH4 Protein S EQ ID NO.6 expresses, body structure changes in detecting with the label Aurora B of middle body and Plk1, find in the MRC5 cell that obvious change has all occured in the celluar localization of Aurora B and Plk1 after the ALKBH4 silence, such as Figure 23 a, shown in the b, middle body structure abnormal behind this explanation ALKBH4 gene silencing.Detect ALKBH4 gene silencing rear center body over-replicate with centrosome label γ-tubulin, compare ALKBH4 gene silencing rear center body over-replicate with matched group and surpass more than five times, shown in Figure 23 c.We detect ALKBH4 gene silencing after-contraction ring structure with the label NM II of retraction ring and anillin and also occur unusually, and main manifestations is that the anillin location unusually can't form retraction ring and form the contracting ring in a plurality of positions of cell, such as Figure 23 d, shown in the e.Behind this explanation ALKBH4 gene silencing, cell division is the cytokinesis abnormal especially.

Retraction ring and middle body play a key effect in cytokinesis, if they cytokinesis time lengthening or cytokinesis failure occurs unusually may causing, whether the splitting time of at first verifying cell prolongs, if the most obvious feature of cell division time lengthening is that division cells quantity increases, therefore dye DNA with propidium iodide (PI), whether increase with G2/M phase cell behind the ALKBH4 gene silencing in the flow cytometer detection MRC5 cell again.The G2/M cell obviously increased after experimental result showed the ALKBH4 gene silencing, saw that from statistical result the ALKBH4 gene silencing causes G2/M phase cell to increase by one times, shown in Figure 24 a.In order further to determine whether M phase cell increases, and we come labelling M phase cell with the antibody of the specific marker thing histone H 3-S10p of anti-M phase cell, it is above that the result shows in the MRC5 cell behind the ALKBH4 gene silencing that M phase cell doubles, shown in Figure 24 b.Found also simultaneously that expression 3 * Flag-ALKBH4 HDH and HA-β-actin K84A mutant caused that also the MRC5 cell M phase significantly increases, as shown in figure 25, show that 3 * Flag-ALKBH4 HDH compares afunction with HA-β-actin K84A mutant with wild type, the overexpression mutant causes endogenous wild-type activity to suppress.This explanation ALKBH4 gene silencing can cause the retardance of cell cycle, especially in division stage, the front found that the ALKBH4 gene silencing affects retraction ring and forms and middle body structure, these presentation of results ALKBH4 gene delection causes cell division to be arrested in the cytokinesis phase, so ALKBH4 plays a key effect in the regulation and control cytokinesis.How can the result of back be so since the ALKBH4 gene silencing can cause cell block in the cytokinesis phase? being interfered according to bibliographical information cytokinesis process to cause cytokinesis failure, finally can cause apoptosis or form apocyte.Therefore we imagine the ALKBH4 gene silencing and whether have same consequence, detect with the method for immunofluorescence, with the label of α-tubulin as cytoskeleton.Experimental result shows in the MRC5 cell and to produce a large amount of apocytes behind the ALKBH4 gene silencing that the quantity that apocyte produces is more than five times of matched group, shown in Figure 26 a.We are also with apoptosis test kit labelling and use apoptosis situation after flow cytometer detects the ALKBH4 gene silencing, the result shows in the MRC5 cell that a large amount of apoptosis have occured cell behind the ALKBH4 gene silencing, see that from statistical result ALKBH4 gene silencing group is three times of matched group, shown in Figure 26 b.The phenomenon of the cytokinesis failure that above ALKBH4 gene silencing causes is verified in the living cells imaging experiment, we use the Laser Scanning Confocal Microscope of come card company to observe the process that cell cytoplasm divides behind the ALKBH4 gene silencing in the MRC5 cell, two final results have appearred in cytokinesis after found that the ALKBH4 gene silencing: the one, and cytokinesis is not finished two daughter cells and is merged again that this is corresponding with the apocyte phenomenon, another phenomenon is that cytokinesis continues to finish last apoptosis, shown in Figure 26 c.Retraction ring that the ALKBH4 gene silencing produces location is unusual, M phase cytosis and apocyte can be repaired by the insensitive Flag-GFP-ALKBH4 of heterogenous expression siRNAture, but Flag-GFP-ALKBH4 HDH mutant can not, as shown in figure 27.This makes us reason out the action model of ALKBH4 albumen in the cytokinesis process, in the cytokinesis stage, ALKBH4 and NM II are combined on the actin fiber simultaneously, ALKBH4 is combined on the 84th methylated actin of lysine in the place ahead of NM II glide direction, and the actin of NM II combination does not methylate to modify, ALKBH4 albumen in NM II the place ahead constantly with actin K84me1 demethylation, this provides condition along the actin fiber to front slide for NM II, so that the retraction ring take actin fiber and NM II as the basis can produce contractility, impel cytokinesis to finish, as shown in figure 28.

Since the ALKBH4 gene silencing can cause the cytokinesis failure in the normal MRC5 cell of people, how which type of reaction can be so in tumor or cancer cell? in order to identify the reaction of ALKBH4 gene silencing in tumor cell, we have selected several tumor cells, such as human osteosarcoma cell U2OS, oral squamous cell carcinoma cell OSC20 and ovarian cancer cell TOC2.At first, reticent ALKBH4 gene in the U2OS cell, (PI) dyes DNA with propidium iodide, whether G2/M phase cell increases after detecting the ALKBH4 gene silencing with flow cytometer again, the result shows in the U2OS cell that the G2/M cell obviously increases behind the ALKBH4 gene silencing, see that from statistical result the ALKBH4 gene silencing causes G2/M phase cell to increase by one times, shown in Figure 29 a.In order further to determine whether M phase cell increases, come labelling M phase cell with the antibody of the specific marker thing histone H 3-S10p of anti-M phase cell, the result shows in the U2OS cell that M phase cell doubles behind the ALKBH4 gene silencing, shown in Figure 29 b.We are also with apoptosis test kit labelling and use apoptosis situation after flow cytometer detects the ALKBH4 gene silencing, and the result shows in the U2OS cell that a large amount of apoptosis have occured cell behind the ALKBH4 gene silencing, shown in Figure 29 c.In oral squamous cell carcinoma cell OSC20 and ovarian cancer cell TOC2 cell, also produce a large amount of apoptosis behind the ALKBH4 gene silencing equally, as shown in figure 30.These presentation of results ALKBH4 gene silencing can cause tumor and cancer cell cytokinesis failure finally to cause a large amount of apoptosis.

In sum, all antibody of the human actin actin K84me1 that the 84th lysine monomethylation of all antisense RNA sequences, people of the human actin actin K84me1 that the 84th lysine monomethylation of human actin actin K84me1 siRNA sequence, people that the 84th lysine monomethylation of people modified modified modified all can prevent or treat cancer, and described cancer comprises human osteosarcoma, oral squamous cell carcinoma and ovarian cancer etc.

Embodiment nine: ALKBH4 knock out mice death during embryonic period, ALKBH4 knock out mice cell cytoplasm divide and unsuccessfully produce apocyte and follow apoptosis

In order to study ALKBH4 gene function in animal body, we make up knock out mice, mice ALKBH4 gene has three exons, wherein 2,3 exons have comprised the enzymatic activity key structure territory of ALKBH4 gene, shown in Figure 31 a, namely produce the ALKBH4 knock out mice so these two key structure territory knock-out mice ALKBH4 albumen can not be expressed.Traditional ALKBH4 knock out mice causes death the period of embryo, and we are with ALKBH4 ^+/-There is not ALKBH4 in the mice of hybridization birth ^-/-Mouse genotypes, birth mice ratio meet Mendel's law namely 1 (+/+): 2 (+/-): 0 (1,-/-), shown in Figure 31 b, this explanation ALKBH4 gene is extremely important at Embryonic Stages.This result and actin gene knockout come to the same thing, and now existing bibliographical information causes death the mice of actin gene knockout the period of embryo.

For the ALKBH4 knock out mice that obtains to survive, but we make up the ALKBH4 knock out mice of induction type, equally with 2,3 exons knock out, when making up gene knockout carrier 2,3 exon both sides add the LoxP site of two recombinase Cre identifications, shown in Figure 32 a, used PCR primer is seen sequence table forward primer SEQ ID NO.21 and reverse primer SEQ ID NO.22 amplification leading portion homologous recombination exons 1 sequence, the exon 2 that forward primer SEQ ID NO.23 and reverse primer SEQ ID NO.24 amplification gene knock out, 3 sequences, forward primer SEQ ID NO.25 and reverse primer SEQ ID NO.26 amplification exon 3 back homologous recombination sequence, such segmentation amplification mice ALKBH4 genomic dna sequence, see sequence table SEQ ID NO.3, this fragment gene group sequence obtains mice ALKBH4 albumen through behind the transcription and translation, sees sequence table SEQ ID NO.8, and knock out mice can not be expressed this section protein sequence.The ALKBH4 gene knockout carrier electricity that builds is forwarded in the embryonic stem cell, and southern blotting experiment detects gene knockout carrier and is incorporated in the embryonic stem cell, shown in Figure 32 b.The embryonic stem cell microinjection is brought out ALKBH4 to C57BL/6N mice ascus embryo ^+/LMouse genotypes obtains ALKBH4 with this mouse genotypes hybridization again ^L/LMouse genotypes.With this mouse genotypes with contain the Cre zymophore the mice copulation of isozygotying be ALKBH4 to genotype ^+/L/CreMice, feed mice with TAM and can produce ALKBH4 ^+/-/CreGenotypic mice is verified this heterozygote knock out mice with RT-PCR, again shown in Figure 32 c.ALKBH4 ^+/-/CreGenotypic mice copulation obtains ALKBH4 ^-/-/Cre, use the RT-PCR method validation, shown in Figure 32 d.Get ALKBH4 ^-/-/Cre3.5 days embryos of mouse genotypes separate the MEF fibroblast, add 4-OHT and induce the ALKBH4 gene knockout, and detect the expression of ALKBH4 and actin K84me1 with immunofluorescence and immunoblot experiment, the result shows that ALKBH4 gene knockout efficient is very high, the expression of actin K84me1 obviously raises in the MEF of ALKBH4 gene knockout cell, the result is consistent with the ALKBH4 gene silencing, as shown in figure 33.Immunofluorescence experiment finds that also the MEF cell behind the ALKBH4 gene knockout produces a large amount of apocytes, and the phenomenon of over-replicate has appearred in centrosome, as shown in figure 34.We find that also MEF cell proliferation and transfer ability die down behind the ALKBH4 gene knockout, ALKBH4 gene knockout cell and cellular control unit are marked a white space, cellular control unit fills up this sheet white space after 20 hours, and the white space of ALKBH4 gene knockout group size does not change, this explanation ALKBH4 also plays very important effect in cell proliferation and transition process, as shown in figure 35.

Sequence table

＜110〉Beijing Institute of Gene Science, Chinese Academy of Sciences

＜120〉a kind of gene and encoding proteins thereof promote cell cytoplasm division, cell proliferation and use in medicament research and development

<160>32

<170>

<210>1

<211>909

<212>DNA

＜213〉people (Homo Sapiens)

<220>Homo?sapiens?ALKBH4?cDNA?sequence

<400>1

atggcggcgg?ctgccgccga?gacccccgaa?gtccttcggg?aatgcggttg?caagggcatc 60

cggacctgtc?tgatctgcga?gcggcagcgc?ggcagtgacc?cgccctggga?gctgccccca 120

gcgaaaacat?accgtttcat?ttactgctcc?gacaccggct?gggccgtggg?cacagaggag 180

tctgactttg?agggctgggc?cttccccttc?ccaggagtga?tgctgatcga?ggactttgtg 240

acccgggagg?aagaagccga?gttggtgcgg?ctcatggacc?gtgacccctg?gaagctctcc 300

cagtctggac?ggaggaagca?ggactatggc?cccaaagtca?actttcggaa?acagaagcta 360

aagaccgagg?gcttctgcgg?cctccccagc?ttcagccggg?aggtggtgcg?gaggatgggc 420

ctctacccgg?ggctggaggg?cttccggccc?gtcgagcagt?gcaacctgga?ctactgcccc 480

gagcggggct?ctgccattga?cccccacctg?gacgacgcct?ggctgtgggg?ggagcggctg 540

gtcagcctca?acctcctgtc?ccccaccgtg?ctgtccatgt?gtcgggaggc?gcccgggagc 600

ctgctcctct?gctcggcccc?gtcggctgcc?ccggaggcct?tggtggacag?cgtgatagca 660

cccagccggt?cggtgctatg?ccaggaggtg?gaggtggcca?tccccttacc?cgcccgctcc 720

ctgctggtcc?tcaccggggc?ggcacggcac?cagtggaagc?atgccatcca?ccgcagacac 780

atcgaggccc?gccgcgtctg?cgtcactttc?cgggagctgt?cggctgagtt?tggccctgga 840

gggaggcagc?aagagctggg?ccaggaactg?ctgcggatcg?ccctctcctt?ccagggaaga 900

cccgtgtga 909

<210>2

<211>909

<212>DNA

＜213〉people (Homo Sapiens)

<220>Homo?sapiens?ALKBH4?H169A-D171A-H254A?mutation?cDNA?sequence

<400>2

atggcggcgg?ctgccgccga?gacccccgaa?gtccttcggg?aatgcggttg?caagggcatc 60

cggacctgtc?tgatctgcga?gcggcagcgc?ggcagtgacc?cgccctggga?gctgccccca 120

gcgaaaacat?accgtttcat?ttactgctcc?gacaccggct?gggccgtggg?cacagaggag 180

tctgactttg?agggctgggc?cttccccttc?ccaggagtga?tgctgatcga?ggactttgtg 240

acccgggagg?aagaagccga?gttggtgcgg?ctcatggacc?gtgacccctg?gaagctctcc 300

cagtctggac?ggaggaagca?ggactatggc?cccaaagtca?actttcggaa?acagaagcta 360

aagaccgagg?gcttctgcgg?cctccccagc?ttcagccggg?aggtggtgcg?gaggatgggc 420

ctctacccgg?ggctggaggg?cttccggccc?gtcgagcagt?gcaacctgga?ctactgcccc 480

gagcggggct?ctgccattga?ccccgccctg?gccgacgcct?ggctgtgggg?ggagcggctg 540

gtcagcctca?acctcctgtc?ccccaccgtg?ctgtccatgt?gtcgggaggc?gcccgggagc 600

ctgctcctct?gctcggcccc?gtcggctgcc?ccggaggcct?tggtggacag?cgtgatagca 660

cccagccggt?cggtgctatg?ccaggaggtg?gaggtggcca?tccccttacc?cgcccgctcc 720

ctgctggtcc?tcaccggggc?ggcacggcac?cagtggaagg?ctgccatcca?ccgcagacac 780

atcgaggccc?gccgcgtctg?cgtcactttc?cgggagctgt?cggctgagtt?tggccctgga 840

gggaggcagc?aagagctggg?ccaggaactg?ctgcggatcg?ccctctcctt?ccagggaaga 900

cccgtgtga 909

<210>3

<211>6635

<212>DNA

＜213〉Mus (Mus Sapiens)

<220>Mouse?mALKBH4?genome?DNA?sequence

<400>3

cccgttccgt?gctacacagg?atccctcaac?atcccttagt?atctcatcag?tctttccact 60

ccgcgcaagg?ctaagggcgt?tcgctccaag?tttatctgac?gccgggcgtt?ggctgccaat 120

ctcccacatc?tccgtttggc?gcgagattcg?actggggctc?gaatcccgga?taacagaata 180

acccgggcag?gaggaggaga?cggaggggtc?tgagccttgc?attccgccca?tcaaaccacc 240

ctggcgggga?agaaccccac?gccccggatc?cgcttcaacc?ccacatgctc?ttacttcaaa 300

ctctgaatct?tccccagctt?atccgtcttg?ggtcgcccac?gttgcaggag?cagttgcggc 360

gtgagaggag?ccatgggtgg?ccgagggctc?aaccgaaccc?gcgcctccac?gaagtccggt 420

cgctaaggcc?cgctgccggg?gagcccagga?ggtggcgcac?aacaaaccct?ttgcgagtcc 480

gttgcgaccg?gaaggaagta?gaacgccagc?cttacgcccc?acctcctgct?tctgcgatga 540

ctacaactcc?cagcggcccc?tgcgtctcgc?gcctgcgctc?ttaactgatc?ggaggacgcg 600

atggcggcgg?cggctgaagt?ttctcttttg?caggagtgcg?gctgtaaggg?catccggacc 660

tgtcttatct?gcgagagaca?acgccacagg?gacccgccct?ggcagatctg?ccttcaggta 720

cggactagga?aaagagtcat?agccagaaaa?tctattcatc?ttaatgggaa?actaaggccc 780

agcttgcctg?taaaacagcc?aaggaccaaa?gcctcgcggt?aggtgagttg?tttggagcgc 840

ttatatcttc?aatattcaca?aaacccaaaa?ggtggaccaa?gtgccatcgg?ctgattaatg 900

gaagggcggg?gaaatgctgg?tgcacgccga?gatctctgca?tttgaaaggc?agagaggctg 960

gagaacggac?ctcagccgcc?cagcaggttt?taggagttac?cttggcagta?gggaagcggc?1020

tgtcacacat?catctctgtg?actttggggg?gtgaggggtg?ggggtggggg?gcagtggtaa?1080

ataacttgga?ctgaacgggt?ctggttttga?gtgagcttcc?ggagcacaag?ggagactgca?1140

tggaaatggt?agggagtgct?gaacactagg?ccgcctgtat?tagacaggga?atgagcgact?1200

taagacagca?caggcagccg?ggcagtggtg?gcgcatgcct?ttaatcccag?cactcgggag?1260

acaagaggca?ggtggaattc?cgagttcgag?gccagcctgg?tctacagagt?gagttccagg?1320

acagccagga?ctacactaca?gagaaacctg?tctccaaaac?aggctttgat?ttgggggaaa?1380

tttttttggg?aaaacaaacc?tgtatgaatc?agctttacag?ccgggcagtg?gtggtgcatg?1440

ccattagact?tagcacttgg?gatgcagagg?caggcagatc?tctgtgagtc?ccaggctagc?1500

ctgatctaca?tagggagttc?caggaaagcc?catcttgaaa?aacaaaaaca?aatctgtctt?1560

acaagatact?aataggatca?ggagtcaggt?aggccaggaa?gaatgttaaa?atgtttccct?1620

tctagctctc?tgttgaccag?gctaacacct?tccatcaaaa?tgggcaatgg?atggatgaat?1680

gaatgaatga?atgaatgaaa?aataacttca?gagcatttgt?atggccctgg?cagtgctgta?1740

gcaagttgct?gggatgcata?gccaggggaa?tgcttgagta?gaggcctgag?ataggagctg?1800

tgggtggctg?aggcgacaga?cacttaaaga?gatcaaaggg?gcctgagcca?agttttttgt?1860

tttagttatt?ttctttagtt?agaggcccca?gggcgccccc?tccataagct?aagattgcaa?1920

gcatatgtca?ctatgtctgg?atcatggcag?cattcagagt?gaccaaacac?ccaagtgttt?1980

attatatcaa?ctggtgaact?gaagagtggg?cagtgttggt?gctggcttga?gggaggtcaa?2040

agatatctac?atagcaagtt?tcaaaccaga?ctaaataaaa?gcctgtctcg?acaggaaaga?2100

aagaggcaaa?ccataaacta?ataagagatt?tttaaaaatc?tcggatatcc?atgcagtaga?2160

tataacctta?gaaaggaagg?aaattctgac?gcgagttcca?tatggattca?ccttgaagat?2220

gtgctgctaa?aagaaggaag?ccagtctcta?gctggaggcg?tggtctggag?atagtgcacc?2280

tgcctagcac?cgcccaggct?ggagagatgg?ctctacactt?aagaacactg?actgcttcgg?2340

gcgtgctggc?gcaggccttt?aatcccagca?ctcgggaggc?agaggcaggc?ggatttctga?2400

gttcgaggcc?agcctggtct?acagagtgag?ttccaggaca?gccagggcta?cacagaaaaa?2460

ccctgtctca?gaaaaaaaaa?accaaagacc?taagtttgcc?tcccaacacc?caagtcactg?2520

gcgccctctt?ctggccttgg?agggcacatg?tgcatgccac?acacagattc?aaacatagaa?2580

agaaagaact?gccctagtga?ggggcttggg?atggacctct?gtggtagagt?gcttacctaa?2640

catgctaagg?cctggctcat?gtagcccagg?ctggccttat?tcactatata?gtgaaagatg?2700

accatgaact?cttaatggtc?ctgaagacca?ggattacaga?cctctgccgc?cacacaggtt?2760

tttttgcagt?gctggggaag?gaacccatgg?cttcatgcat?gtcgggcagg?cctataccat?2820

ctgagctaca?gccacagatt?tatgatgccc?tacattttat?gtacattggt?gttttgcctg?2880

catgtgtgtc?tgtgtgaggg?tgttggatct?cctggaactg?aagttaatgg?acagtcgtga?2940

gctctcccgg?ttggttgtct?ggaagagcgg?ccagtgcctt?tattcgccga?gccttctctc?3000

cagccctaag?atggcgtttc?tactactgca?tctcttagtc?tcagaggagg?caggagcagg?3060

gctgaggaag?acacacatct?gtggcttcca?ataagcattg?gccagcccct?ggccacccag?3120

accacagcct?tacggttagc?cctgcttctc?agactcctgg?tgcaggctcc?tgtcctttat?3180

ctttttgctc?ctgaggggtc?ggtgatagtc?acagtgccaa?aggaatagtg?cccacatccc?3240

ccagcctcag?gccaggtcct?cagagaagaa?aaacacaaat?gagagaatga?gaatcccatg?3300

ccctgaggcc?tgaggccagg?ttcaggctgc?atcgcccctg?cgactccagg?ctcctctcca?3360

agttgcttta?gttccaagaa?gagcatcgga?atcccagagg?ctcctggtgg?gtcccgggca?3420

catgtggcta?ttgtgggtct?ttgctggttc?cagggcactt?ctgtttgggg?tgtatgcgtg?3480

tacaggtgta?tgtgtataca?ggtagagggc?agaggataac?ccaggtgccc?accttggtgt?3540

tttgagagag?tctcactggc?ctggaatttt?ctaagaggcc?aggctagctt?gcccttggtc?3600

tgacctttgc?ctccctcccc?agctctagga?tacaggcatc?catgaccaca?cccagcttat?3660

tacatttggg?ttttagggga?tggagctcag?atctctgtgc?ttcttgcagg?ttaagcacgt?3720

cagcagctca?cccactctgc?cccatctctg?tcttttacag?aaaaaatgct?gtttcctcta?3780

ctgcccagac?acaggctggg?ccgcaggggc?cgagggctct?gacttggagg?gttgggcatt?3840

ccccttccca?ggagtgacac?tgatacagga?ctttgtgacc?ccagaggaag?aagctgagat?3900

ggtgcgtctg?atggactgcg?acccctggaa?gctctcacag?tctgggagga?agaagcaggt?3960

acggtggcct?gagctgagcc?gaggtatggt?ccctttgcca?gtggccccgg?ctacctcctg?4020

tagccacacc?ctagggatct?ttggtcacag?tgggtgtgga?cttcctcatc?aagcgtggct?4080

gccgcgtctc?tgtgcggctg?tctctgcggc?tgtctcgttg?gtgaggggat?gccaagctct?4140

aggttggatt?tctatcctgt?gtgctgctag?aggctgccgg?gcatcacccg?tttctattgt?4200

gactctcact?cctcacctgt?atgtctcacc?ttctatcttt?tcccttcctc?gttatctctc?4260

ccttgccaca?atgtagtcag?tgccttagta?gcttcaaagg?tgcccctcac?cctttgctcc?4320

tggcaccata?gtgctgggtt?agagttctgg?cgacatcagc?cagttggggg?tcccttcaag?4380

cttcgtcctg?tgctgggaca?gccccagcca?cccactctgc?ccctgacctc?tgaacagatg?4440

gagcagtcct?cctacctagg?ctttctgggt?cctgggattt?catgcacaca?ccagccatgc?4500

ccagtttgtg?gttgccatgg?cttaagctgg?gccacttctc?cttcctgtct?ccactgtagg?4560

actatggccc?taactgcttc?tccttcctgt?ctccactgca?ggactatggc?cctaaagtta?4620

attttcggaa?gcagaagctg?aagatggcag?gcttccaggg?tctccctggc?tttagccaga?4680

aggtagtcca?gagaatgggc?ctttacccgg?ggctggagga?cttccagcct?gtggaacagt?4740

gcaatctgga?ctacagccct?gagcggggct?ccgccatcga?cccccacttg?gacgacgcct?4800

ggctgtgggg?cgagcggctg?gtgagcctca?acctcctgtc?agccacagtg?gtgtccatgt?4860

ctccagaggc?ccctggcagc?ctgcttctct?gctcagcccc?ctccgtcaga?cctgatgctt?4920

ttgaggacag?ccttgtggct?cctagcaggt?ctgtcccctg?ccaggaggtg?gaggtggcca?4980

tcacagtacc?ccgccgctcc?ttgctggtgc?ttacaggggc?cgcgaggcac?cagtggacac?5040

acgccatcca?ccgcagacac?atcaaggccc?gccgtgtgtg?cgccaccttc?agggagctgt?5100

ccagtgagtt?cctgcctgga?gggaagcagc?aagaactggg?ccaagaactg?ctgcaggctg?5160

cactctcgtt?ccaggggaga?ccggtgtgat?gcttcccagg?gcccaggagc?tgtcactggc?5220

ctggccaaaa?gcttggctcc?agcacaacca?tcggaggagc?taacactgag?gtctccccac?5280

agcagtagat?tcgtggggtt?tttttgagac?aaggtctcat?gtagcccagg?ctagcctcca?5340

attaattgtg?tagctaagga?tgaccttgga?ctcttgcctt?ttctacctcc?tcttcccaag?5400

ctctggcttg?attattttgt?tttgtttctc?tttttgggac?agggtctccg?gcctagactg?5460

gcctcagact?ctgtttccag?ccaaggatga?ctttgaactc?cggatcctcc?tgcctctacc?5520

tcttgaatgc?tgggattgcc?agcgtgcacc?atcatatgca?atttttgtct?gtgctgggat?5580

ggcagcaagc?gttctgccag?ctgagctacc?ccacccccct?agcctgttgg?gggtttttga?5640

gacaaggcct?cacatgggct?agactggcct?ggaactcccc?atcctcctgc?ctcagcctcc?5700

cagtcgctga?ggtgacagtg?tactggtgag?gttttaggag?gagccatctg?acccttgacg?5760

tcatgagcat?cgtatgtcct?gcccggagct?ggttctgctg?ggcctgggct?gcggccattc?5820

ctcagctcac?tgagtgtcat?atgtggaggg?attgagtctt?ttagaacttc?agtacttggg?5880

acgagtaagg?tggctcagta?gctaaaggtg?ctgccaccaa?gcctgatgtt?cagtctctgc?5940

aatccacgtg?gtaaaaggag?tgtcccctga?tctccacacg?cacatcaccc?attttgataa?6000

aattcataat?aaaagaaaaa?ccttggtctc?atgtgaaatg?aatttctcct?tttcccatcc?6060

ctgtgtgaag?tagttgtagt?tattttgttt?tgttttaaaa?cagggtctca?ctttgtagcc?6120

ttggctgtct?tggaactcgc?tttatagacc?aggctggccc?ttaactcata?aagatctcta?6180

cctctgccgc?tgagtaagtg?ccgggattaa?agatatgcac?caatccacag?agcccaactc?6240

tttcttttct?tttctttttt?tttttttttt?tgagataagc?ttcccatttg?tagtacaggc?6300

tggcctcaaa?atttgaccag?tcaggaccca?aggattaaac?ttagttttaa?aaattacatt?6360

gacttagtta?tttagctatg?gaagcaggca?cagctctgtg?tatggaggac?agaagaccat?6420

gcaggccaag?gtggaaggtg?gagttgtgtg?gctggcctgc?atgacagcct?tgtacctcca?6480

ggaaagggtc?acagcctcgg?ggtttgtgat?accaagtttt?gggaggcttg?tgtttctgtg?6540

tgcagattgc?agacttatgt?gggtgcagtg?cacttgctct?gtgcatgcat?cagggggcca?6600

gctgcaatcg?catgcacgtg?gtatccgtga?ggtca?6635

<210>4

<211>1128

<212>DNA

＜213〉people (Homo Sapiens)

<220>Homo?sapiens?β-actin?cDNA?sequence

<400>4

atggatgatg?atatcgccgc?gctcgtcgtc?gacaacggct?ccggcatgtg?caaggccggc 60

ttcgcgggcg?acgatgcccc?ccgggccgtc?ttcccctcca?tcgtggggcg?ccccaggcac 120

cagggcgtga?tggtgggcat?gggtcagaag?gattcctatg?tgggcgacga?ggcccagagc 180

aagagaggca?tcctcaccct?gaagtacccc?atcgagcacg?gcatcgtcac?caactgggac 240

gacatggaga?aaatctggca?ccacaccttc?tacaatgagc?tgcgtgtggc?tcccgaggag 300

caccccgtgc?tgctgaccga?ggcccccctg?aaccccaagg?ccaaccgcga?gaagatgacc 360

cagatcatgt?ttgagacctt?caacacccca?gccatgtacg?ttgctatcca?ggctgtgcta 420

tccctgtacg?cctctggccg?taccactggc?atcgtgatgg?actccggtga?cggggtcacc 480

cacactgtgc?ccatctacga?ggggtatgcc?ctcccccatg?ccatcctgcg?tctggacctg 540

gctggccggg?acctgactga?ctacctcatg?aagatcctca?ccgagcgcgg?ctacagcttc 600

accaccacgg?ccgagcggga?aatcgtgcgt?gacattaagg?agaagctgtg?ctacgtcgcc 660

ctggacttcg?agcaagagat?ggccacggct?gcttccagct?cctccctgga?gaagagctac 720

gagctgcctg?acggccaggt?catcaccatt?ggcaatgagc?ggttccgctg?ccctgaggca 780

ctcttccagc?cttccttcct?gggcatggag?tcctgtggca?tccacgaaac?taccttcaac 840

tccatcatga?agtgtgacgt?ggacatccgc?aaagacctgt?acgccaacac?agtgctgtct 900

ggcggcacca?ccatgtaccc?tggcattgcc?gacaggatgc?agaaggagat?cactgccctg 960

gcacccagca?caatgaagat?caagatcatt?gctcctcctg?agcgcaagta?ctccgtgtgg?1020

atcggcggct?ccatcctggc?ctcgctgtcc?accttccagc?agatgtggat?cagcaagcag?1080

gagtatgacg?agtccggccc?ctccatcgtc?caccgcaaat?gcttctag 1128

<210>5

<211>1128

<212>DNA

＜213〉people (Homo Sapiens)

<220>Homo?sapiens?β-actin?K84A?mutation?cDNA?sequence

<400>5

atggatgatg?atatcgccgc?gctcgtcgtc?gacaacggct?ccggcatgtg?caaggccggc 60

ttcgcgggcg?acgatgcccc?ccgggccgtc?ttcccctcca?tcgtggggcg?ccccaggcac 120

cagggcgtga?tggtgggcat?gggtcagaag?gattcctatg?tgggcgacga?ggcccagagc 180

aagagaggca?tcctcaccct?gaagtacccc?atcgagcacg?gcatcgtcac?caactgggac 240

gacatggagg?caatctggca?ccacaccttc?tacaatgagc?tgcgtgtggc?tcccgaggag 300

caccccgtgc?tgctgaccga?ggcccccctg?aaccccaagg?ccaaccgcga?gaagatgacc 360

cagatcatgt?ttgagacctt?caacacccca?gccatgtacg?ttgctatcca?ggctgtgcta 420

tccctgtacg?cctctggccg?taccactggc?atcgtgatgg?actccggtga?cggggtcacc 480

cacactgtgc?ccatctacga?ggggtatgcc?ctcccccatg?ccatcctgcg?tctggacctg 540

gctggccggg?acctgactga?ctacctcatg?aagatcctca?ccgagcgcgg?ctacagcttc 600

accaccacgg?ccgagcggga?aatcgtgcgt?gacattaagg?agaagctgtg?ctacgtcgcc 660

ctggacttcg?agcaagagat?ggccacggct?gcttccagct?cctccctgga?gaagagctac 720

gagctgcctg?acggccaggt?catcaccatt?ggcaatgagc?ggttccgctg?ccctgaggca 780

ctcttccagc?cttccttcct?gggcatggag?tcctgtggca?tccacgaaac?taccttcaac 840

tccatcatga?agtgtgacgt?ggacatccgc?aaagacctgt?acgccaacac?agtgctgtct 900

ggcggcacca?ccatgtaccc?tggcattgcc?gacaggatgc?agaaggagat?cactgccctg 960

gcacccagca?caatgaagat?caagatcatt?gctcctcctg?agcgcaagta?ctccgtgtgg?1020

atcggcggct?ccatcctggc?ctcgctgtcc?accttccagc?agatgtggat?cagcaagcag?1080

gagtatgacg?agtccggccc?ctccatcgtc?caccgcaaat?gcttctag 1128

<210>6

<211>302

<212>PRT

＜213〉people (Homo Sapiens)

<220>Homo?ALKBH4?protein

<400>6

10 20 30 40 50 60

MAAAAAETPE?VLRECGCKGI?RTCLICERQR?GSDPPWELPP?AKTYRFIYCS?DTGWAVGTEE

70 80 90 100 110 120

SDFEGWAFPF?PGVMLIEDFV?TREEEAELVR?LMDRDPWKLS?QSGRRKQDYG?PKVNFRKQKL

130 140 150 160 170 180

KTEGFCGLPS?FSREVVRRMG?LYPGLEGFRP?VEQCNLDYCP?ERGSAIDPHL?DDAWLWGERL

190 200 210 220 230 240

VSLNLLSPTV?LSMCREAPGS?LLLCSAPSAA?PEALVDSVIA?PSRSVLCQEV?EVAIPLPARS

250 260 270 280 290 300

LLVLTGAARH?QWKHAIHRRH?IEARRVCVTF?RELSAEFGPG?GRQQELGQEL?LRIALSFQGR

302

PV

<210>7

<211>302

<212>PRT

＜213〉people (Homo Sapiens)

<220>Homo?ALKBH4?H169A-D171A-H254A?mutation?protein

<400>7

10 20 30 40 50 60

MAAAAAETPE?VLRECGCKGI?RTCLICERQR?GSDPPWELPP?AKTYRFIYCS?DTGWAVGTEE

70 80 90 100 110 120

SDFEGWAFPF?PGVMLIEDFV?TREEEAELVR?LMDRDPWKLS?QSGRRKQDYG?PKVNFRKQKL

130 140 150 160 170 180

KTEGFCGLPS?FSREVVRRMG?LYPGLEGFRP?VEQCNLDYCP?ERGSAIDPAL?ADAWLWGERL

190 200 210 220 230 240

VSLNLLSPTV?LSMCREAPGS?LLLCSAPSAA?PEALVDSVIA?PSRSVLCQEV?EVAIPLPARS

250 260 270 280 290 300

LLVLTGAARH?QWKAAIHRRH?IEARRVCVTF?RELSAEFGPG?GRQQELGQEL?LRIALSFQGR

302

PV

<210>8

<211>300

<212>PRT

＜213〉Mus (Mus Sapiens)

<220>Mouse?mALKBH4?protein

<400>8

10 20 30 40 50 60

MAAAAEVSLL?QECGCKGIRT?CLICERQRHR?DPPWQICLQK?KCCFLYCPDT?GWAAGAEGSD

70 80 90 100 110 120

LEGWAFPFPG?VTLIQDFVTP?EEEAEMVRLM?DCDPWKLSQS?GRKKQDYGPK?VNFRKQKLKM

130 140 150 160 170 180

AGFQGLPGFS?QKVVQRMGLY?PGLEDFQPVE?QCNLDYSPER?GSAIDPHLDD?AWLWGERLVS

190 200 210 220 230 240

LNLLSATVVS?MSPEAPGSLL?LCSAPSVRPD?AFEDSLVAPS?RSVPCQEVEV?AITVPRRSLL

250 260 270 280 290 300

VLTGAARHQW?THAIHRRHIK?ARRVCATFRE?LSSEFLPGGK?QQELGQELLQ?AALSFQGRPV

<210>9

<211>375

<212>PRT

＜213〉people (Homo Sapiens)

<220>Homo?β-actin?protein

<400>9

10 20 30 40 50 60

MDDDIAALVV?DNGSGMCKAG?FAGDDAPRAV?FPSIVGRPRH?QGVMVGMGQK?DSYVGDEAQS

70 80 90 100 110 120

KRGILTLKYP?IEHGIVTNWD?DME mKIWHHTF?YNELRVAPEE?HPVLLTEAPL?NPKANREKMT

130 140 150 160 170 180

QIMFETFNTP?AMYVAIQAVL?SLYASGRTTG?IVMDSGDGVT?HTVPIYEGYA?LPHAILRLDL

190 200 210 220 230 240

AGRDLTDYLM?KILTERGYSF?TTTAEREIVR?DIKEKLCYVA?LDFEQEMATA?ASSSSLEKSY

250 260 270 280 290 300

ELPDGQVITI?GNERFRCPEA?LFQPSFLGME?SCGIHETTFN?SIMKCDVDIR?KDLYANTVLS

310 320 330 340 350 360

GGTTMYPGIA?DRMQKEITAL?APSTMKIKII?APPERKYSVW?IGGSILASLS?TFQQMWISKQ

370 375

EYDESGPSIV?HRKCF

<210>10

<211>375

<212>PRT

＜213〉people (Homo Sapiens)

<220>Homo?β-actin?protein

<400>10

10 20 30 40 50 60

MDDDIAALVV?DNGSGMCKAG?FAGDDAPRAV?FPSIVGRPRH?QGVMVGMGQK?DSYVGDEAQS

70 80 90 100 110 120

KRGILTLKYP?IEHGIVTNWD?DME AIWHHTF?YNELRVAPEE?HPVLLTEAPL?NPKANREKMT

130 140 150 160 170 180

QIMFETFNTP?AMYVAIQAVL?SLYASGRTTG?IVMDSGDGVT?HTVPIYEGYA?LPHAILRLDL

190 200 210 220 230 240

AGRDLTDYLM?KILTERGYSF?TTTAEREIVR?DIKEKLCYVA?LDFEQEMATA?ASSSSLEKSY

250 260 270 280 290 300

ELPDGQVITI?GNERFRCPEA?LFQPSFLGME?SCGIHETTFN?SIMKCDVDIR?KDLYANTVLS

310 320 330 340 350 360

GGTTMYPGIA?DRMQKEITAL?APSTMKIKII?APPERKYSVW?IGGSILASLS?TFQQMWISKQ

370 375

EYDESGPSIV?HRKCF

<210>11

<211>26

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>

atagaattcccatggcggcggctgcc

<210>12

<211>27

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>12

accgtcgactcacacgggtcttccctg

<210>13

<211>25

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>13

ttcgaattctatggcggcggctgcc

<210>14

<211>27

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>14

gacctcgagatggcggcggctgccgcc

<210>15

<211>29

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>15

tataatgcggccgccacgggtcttccctg

<210>16

<211>29

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>16

cagctcgagatggatgatgatatcgccgc

<210>17

<211>35

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>17

ataagaatgcggccgcctagaagcatttgcggtgg

<210>18

<211>33

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>18

gccattgaccccgccctggccgacgcctggctg

<210>19

<211>31

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>19

ggcaccagtggaaggctgccatccaccgcag

<210>20

<211>34

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>20

ctgggacgacatggaggcaatctggcaccacacc

<210>21

<211>20

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>21

attgggatccaagtgctctg

<210>22

<211>20

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>22

gggtgtggctacaggaggta

<210>23

<211>20

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>23

ctttggtcacagtgggtgtg

<210>24

<211>20

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>24

tcagcggcagaggtagagat

<210>25

<211>20

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>25

tgccgggattaaagatatgc

<210>26

<211>20

<212>DNA

＜213〉artificial sequence

＜220〉primer sequence

<400>26

gcaacccctctggtgtttta

<210>27

<211>19

<212>RNA

＜213〉artificial sequence

＜220〉siRNA sequence is for ALKBH4

<400>27

gaucccgggauugaaauga

<210>28

<211>19

<212>RNA

＜213〉artificial sequence

＜220〉siRNA sequence is for ALKBH4

<400>28

gggauugaaaugaggagca

<210>29

<211>19

<212>RNA

＜213〉artificial sequence

＜220〉siRNA sequence is for ALKBH4

<400>29

gggaucauuugagcuuaaa

<210>30

<211>19

<212>RNA

＜213〉artificial sequence

＜220〉siRNA sequence is for NM II

<400>30

gggccaacauugaaacaua

<210>31

<211>19

<212>RNA

＜213〉artificial sequence

＜220〉siRNA sequence is for NM II

<400>31

gugcuacaguuuggaaata

<210>32

<211>19

<212>RNA

＜213〉artificial sequence

＜220〉siRNA sequence is for NM II

<400>32

cucgggaugaggugauuaa

Claims

1. the purposes of antisense RNA sequence in the medicine of preparation prevention or treatment cancer of the human actin actin K84me1 that modifies of the 84th a lysine monomethylation, one of the antisense RNA sequence of the human actin actin K84me1 that described the 84th lysine monomethylation modified such as following nucleotide sequence:

I) with the nucleotide sequence of SEQ ID NO:4 complete complementary;

Ii) from i) nucleotide sequence coded same acid sequence protein but list the nucleotide sequence of different nucleotide sequence complete complementaries at nucleotides sequence because of the degeneracy of genetic code;

Iii) with the nucleotide sequence of the nucleotide sequence complete complementary of aminoacid sequence shown in the coding SEQ ID NO:9.

2. the 84th the lysine monomethylation purposes of human actin actin K84me1 in the medicine of preparation prevention or treatment cancer of modifying, the aminoacid sequence of the human actin actin K84me1 that described the 84th lysine monomethylation modified is shown in SEQ ID NO:9.

3. the cDNA sequence of the human actin actin K84me1 mutant modified of the 84th a lysine monomethylation, one of its nucleotide sequence such as following nucleotide sequence:

I) nucleotide sequence shown in the SEQ ID NO:5;

Ii) from i) nucleotide sequence coded same acid sequence protein but list different nucleotide sequences at nucleotides sequence because of the degeneracy of genetic code; Or

Iii) nucleotide sequence of aminoacid sequence shown in the coding SEQ ID NO:10.

4. the human actin actin K84me1 mutant protein modified of the 84th a lysine monomethylation, its aminoacid sequence is shown in SEQ ID NO:10.

5. the 84th lysine monomethylation of an immunogenicity height, the Dispersal risk purposes of human actin actin K84me1 epitope sequence in the medicine of preparation prevention or treatment cancer of modifying, the aminoacid sequence of the human actin actin K84me1 epitope sequence that described the 84th lysine monomethylation modified is TNWDDMEmKIWHHTFY.