CN102899393A - Chip for forecasting lung cancer risk of smoker after smoking and its preparation method and use method - Google Patents
Chip for forecasting lung cancer risk of smoker after smoking and its preparation method and use method Download PDFInfo
- Publication number
- CN102899393A CN102899393A CN2012101677299A CN201210167729A CN102899393A CN 102899393 A CN102899393 A CN 102899393A CN 2012101677299 A CN2012101677299 A CN 2012101677299A CN 201210167729 A CN201210167729 A CN 201210167729A CN 102899393 A CN102899393 A CN 102899393A
- Authority
- CN
- China
- Prior art keywords
- probe
- chip
- smoking
- wild
- hybridization
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a chip for forecasting a lung cancer risk of a smoker after smoking and a preparation method thereof. The chip comprises a negative probe, a GAPDH positive probe, and a wild type probe and a mutant type probe of at least one of 9 SNP loci. The preparation method of the chip comprises the following steps of 1, arranging at least one sub-matrix on a chip, preparing all the probes into probe solutions having concentrations of 65 to 70mM, mixing the probe solutions and a sample application buffer solution according to a volume ratio of 1: 1, and carrying out sample application in the at least one sub-matrix to obtain a chip, 2, standing the chip under the condition of relative humidity of 50% and a room temperature for 10 to 14 hours, 3, carrying out heat-preservation pre-hybridization of the stood chip in a pre-hybridization solution pre-heated to a temperature of 42 DEG C, and 4, washing the chip subjected to the heat-preservation pre-hybridization orderly by nuclease-free water having the resistance of 18.2 megohms and isopropanol, and drying to obtain the chip for forecasting a lung cancer risk of a smoker after smoking. The invention also discloses a use method of the chip.
Description
Technical field
The present invention relates to the application of biotechnology in the medical hygiene field, particularly a kind of chip that can predict smoking future trouble lung-cancer-risk.
Background technology
The state 1,000,000 above crowds' such as the U.S., Britain, Canada large-scale inquiry finds that the sickness rate of smoker's lung cancer is 10.8 times of non-smoker.American Cancer Society investigation confirms, it is 8 times~12 times of non-smoker that the smoker suffers from lung cancer.Smoking capacity is larger, and the danger that gets lung cancer is higher.Inhale 1~9 persons every day, their danger is 3 times~15 times of non-smoker; Inhale 40 above persons every day and then be the non-smoker 19 times~30 times.From the annual death rate of lung cancer, the smoker is higher 18.4 times than the non-smoker.As seen, smoking is the greatest factor that causes that lung cancer occurs.
Since smoking is relevant with lung cancer, why some people has smoked a lifetime, lives more than 80 year old, do not still get lung cancer? think at present, main relevant with following factor:
1, hereditary individual difference:
Smoking causes that the danger of lung cancer also exists the heredity individual difference, comprising the susceptibility of variation and the acquisition of metabolic enzyme.The inheritable variation of this fermentoid will cause individual crowd to rise 50% because of the danger that smoking causes lung cancer, that is to say, if the smoker has the genetic predisposition of lung cancer, the chance that lung cancer occurs will obviously increase, the beginning Age of Smoking more early, smoking capacity is larger, and the smoking time limit is longer, and then Lung Cancer Risk is higher.Otherwise without smoker's Lung Cancer Risk less of hereditary susceptibility, the smoker may not can suffer from lung cancer.
2, family is frequently-occurring:
The risk level that lung cancer occurs among the patients with lung cancer relatives is than exceeding about 2.4 times without lung cancer family members person, the offspring of patients with lung cancer, the age during 40 years old~59 years old, occurs lung cancer danger in addition can be up to 7.2 times of the general population.Form because smoking carcinogenesis is short-term, generally cause the lung cancer effect from beginning smoking to what fully demonstrate smoking, have 10 years~latent period in 20 years, thereby easily ignored by people.Comparatively speaking, the easier trouble cancer of people that smoking year limit for length's people is larger than smoking capacity.
3, smoking and lung cancer susceptibility gene:
The characteristics of susceptible gene are that transgenation itself does not directly cause the generation of disease, and only cause the ill potentially dangerous increase of body, in case the intervention of extraneous adverse factor can cause disease to occur.Another kind of situation appears in the pharmacological agent, and susceptibility gene mutation causes the body susceptibility to change, and can occur the weak curative effect of these human therapies after the medication or untoward reaction occur.
At present about may being that the research of smoker's genetic polymorphism of suffering from the lung-cancer-risk influence factor mainly concentrates on and exogenous foreign body metabolism I/II stage, DNA repair and the research of nicotine addiction effect involved enzyme class.Particularly the relation of dna damage reparation gene, Metabolic Enzyme Polymorphisms Versus and lung cancer susceptibility has become the focus of cancer molecular epidemiology.Known most chemical carcinogen needs biotransformation to activate or detoxifcation in vivo.The metabolic enzyme that relates in this process is divided into two classes: I phase metabolic enzyme is the metabolism activation enzyme, mainly comprises Cytochrome P450 family (cytochrome P450, CYP450), the procarcinogen activation can be ultimate carcinogens; II phase metabolic enzyme is metabolic enzymes; mainly comprise gsh-S-transferring enzyme (glutathione-S-transferase; GST) and N-acetyl transferase (arylamine N-acetyltransferase; NAT), the active result catalysis with chemical carcinogen forms the hydrophilic substance discharge.Because these metabolic enzymes are controlled and have been affected carcinogenic metabolism, so play an important role aspect the tumor susceptibility of its polymorphism individuality in the decision crowd.
For with environmental pollutant and smoking the lung cancer of substantial connection being arranged, individual susceptibility plays an important role.One of main forms of individual susceptibility is gene pleiomorphism, comprises Xenobiotics metabolism enzyme gene pleiomorphism, the single nucleotide polymorphism of DNA injury repairing gene and other some gene pleiomorphisms.All and the smoking that retrieve so far report cause the lung cancer susceptibility genes involved, comprise SNP, sudden change, genetically deficient etc.
Therefore the SNP chip is made in people's expectation, is used for the prediction smoking population and suffers from the height of lung-cancer-risk, thereby can realize reducing to a certain extent the sickness rate of lung cancer.
Summary of the invention
The technical problem to be solved in the present invention provides a kind of chip that can predict smoking future trouble lung-cancer-risk.
In order to solve the problems of the technologies described above, the invention provides a kind of chip that can predict smoking future trouble lung-cancer-risk,
It is GGGTGTATGGGTCGTAGCGAACTGAG that negative probe is set, and it is GTCCAGTTAATTTCTGACCTTTACTCCTGCCCTTTGAGTTTGATGATGCTGAGTGT AC that the positive probe of GAPDH is set;
Wild-type probe and the mutant probe at least one the SNP site in following 9 SNP sites also are set:
CDKAL1(rs7756992):
Wild-type probe: TATTTTAGTTTTAGATCTACAGTTA
Mutant probe: TATTTTAGTTTTGGATCTACAGTTA;
CYP2E1(rs?2031920):
Wild-type probe: ATATAAAAGTACAAAATTGCAA
Mutant probe: ATATAAAAGTATAAAATTGCAA;
IL-18(rs?360721):
Wild-type probe: GCTGAAACTTCTGGCATTTATTGAATG
Mutant probe: GCTGAAACTTCTGGGATTTATTGAATG;
IL-8(rs?4073):
Wild-type probe: TGAAACTTCTGGCATTTATTGAATG
Mutant probe: TGAAACTTCTGGGATTTATTGAATG;
IL1B(rs?16944):
Wild-type probe: GTTCTCTGCCTCAGGAGCTCTCT
Mutant probe: GTTCTCTGCCTCGGGAGCTCTCT;
ITGA11(rs?2306022):
Wild-type probe: GTCACATCGGTCATGTCCTCCAG
Mutant probe: GTCACATCGGTCGTGTCCTCCAG;
NAT2(rs?1799930):
Wild-type probe: CTTGAACCTCAAACAATTGAAG
Mutant probe: CTTGAACCTCGAACAATTGAAG;
XPD(ERCC2)?(rs?13181):
Wild-type probe: CTCTATCCTCTGCAGCGTCTCCTCT
Mutant probe: CTCTATCCTCTTCAGCGTCTCCTCT;
Gln632Gln(rs3547):
Wild-type probe: ACATACTTCAGGCCTGCGGCACCACC
Mutant probe: ACATACTTCAGGCTTGCGGCACCACC.
The present invention also provides the above-mentioned preparation method that can predict the chip of smoking future trouble lung-cancer-risk simultaneously, comprises the steps:
1), at chip at least one inferior matrix is set, each inferior matrix is carried out following setting:
Every kind of probe is arranged to the probe solution that corresponding concentration is 65 ~ 70mM; Every kind of probe solution proceeds as follows respectively: after point sample damping fluid equal-volume mixes, carry out point sample in each inferior matrix;
2), with the chip of step 1) gained under 50% the relative humidity, placed under the room temperature 10 ~ 14 hours;
3), with step 2) chip of gained is incubated prehybridization 35 ~ 45 minutes in the prehybridization solution of 42 ℃ of preheatings;
The preparation method of the prehybridization solution of 42 ℃ of preheatings is: in 20 * SSC of 100ml damping fluid, add SDS 3.5 ~ 4.5ml, the BSA 38 ~ 42ml of mass concentration 10% of mass concentration 10%, use the water of 18.2 megohms that do not contain nuclease to be settled to 420ml; 42 ℃ of preheatings 2 minutes;
4), with step 2) chip of gained cleans with water, the Virahol of 18.2 megohms that do not contain nuclease successively, and is then dry, gets the chip that can predict smoking future trouble lung-cancer-risk.
Improvement as the preparation method of the chip that can predict smoking future trouble lung-cancer-risk of the present invention:
Point sample in the step 1) is: carry out a system with high-throughput chip point sample instrument, dot spacing 200 ~ 300um, spot diameter 80 ~ 120um.
The present invention also provides the above-mentioned using method that can predict the chip of smoking future trouble lung-cancer-risk simultaneously, and every kind of testing sample DNA is carried out following steps successively:
1), the multiplex PCR of target gene amplification:
1., obtain the extracting solution of testing sample DNA;
2., the extracting solution of testing sample DNA is carried out pcr amplification for each SNP site, thus obtain corresponding amplified production:
The PCR reaction system is:
(contain 15mM Mg ion, for example be MgCl to l0 * PCR reaction buffer
2) 2.5 μ l, (total concn is 10mM to contain the dNTP of amine acyl dUTP, the dUTP that contains 2mM amine acyl mark) 2.0 μ l, Taq archaeal dna polymerase (2U/ml) 0.5 μ l, each 0.5 μ l(forward primer of primer (20pmol/ μ l) and each 0.5 μ l of reverse primer), the DNA extraction liquid 1 μ l of testing sample, the water that does not contain 18.2 megohms of nuclease is supplied 25 μ l;
The above-mentioned preparation method who contains the dNTP (total concn is 10mM, contains the dUTP of 2mM amine acyl mark) of amine acyl dUTP is: with dATP, and dTTP, dGTP, dCTP, aa dUTP and the water that does not contain 18.2 megohms of nuclease mix, and get solution; DATP, dTTP, dGTP, dCTP, the concentration of aa dUTP in solution respectively is respectively 2mM; Described aa dUTP is the dUTP that contains amine acyl mark;
PCR loop parameter: 94 ℃ of denaturation 5 min; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ were extended totally 35 circulations 25 seconds; Get amplified production;
Primer is specific as follows:
CDKAL1(rs7756992):
Forward primer: CCTCAAGCAACCCTCCTCC
Reverse primer: GCAAATAAATTCAACTGGCATC;
CYP2E1(rs?2031920):
Forward primer: GACTTGCTTATGTGGCTAA
Reverse primer: TCATACAGACCCTCTTCCA;
IL-18(rs?360721):
Forward primer: GAAGCCAGTCCTTCCTAAA
Reverse primer: TCATTGCCACAAAGTTGAT;
IL-8(rs?4073):
Forward primer: GATTGGCTGGCTTATCTTC
Reverse primer: GTTTGTGCCTTATGGAGTG;
IL1B(rs?16944):
Forward primer: ATCGTTGTGCAGTTGATGT
Reverse primer: ATCTGGCATTGATCTGGTT;
ITGA11(rs?2306022):
Forward primer: CCCTGCGTGATTGAATCTGC
Reverse primer: TTTACTGCCCTCCCATTTGTC;
NAT2(rs?1799930):
Forward primer: TCGATGCTGGGTCTGGAAG
Reverse primer: CAGGTTTGGGCACGAGATT;
XPD(ERCC2)?(rs?13181):
Forward primer: GATTAAAGGCTGTGGACATGA
Reverse primer: TCCGACTACCTAGCTGGCTC;
Gln632Gln(rs3547):
Forward primer: GAGGGTCAGATTCCCAGTT
Reverse primer: TGAGGAGGTGAGTACCAAAG;
3., with known be that the DNA extraction liquid of Healthy People carries out pcr amplification for GAPDH, thereby obtain corresponding amplified production:
The PCR reaction system is:
L0 * PCR reaction buffer (containing 15mM Mg ion) 2.5 μ l, (total concn is 10mM to contain the dNTP of amine acyl dUTP, the dUTP that contains 2mM amine acyl mark) 2.0 μ l, Taq archaeal dna polymerase (2U/ml) 0.5 μ l, each 0.5 μ l(forward primer of primer (20pmol/ μ l) and each 0.5 μ l of reverse primer), known is the DNA extraction liquid 1 μ l of Healthy People, and the water that does not contain 18.2 megohms of nuclease is supplied 25 μ l;
PCR loop parameter: 94 ℃ of denaturation 5 min; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ were extended totally 35 circulations 25 seconds; Get amplified production;
The primer of described GAPDH is:
Forward primer: GCACCGTCAAGGCTGAGAAC
Reverse primer: TGGTGAAGACGCCAGTGGA;
2), chip hybridization detects:
1., fluorochrome label amplified production:
Powdered dyestuff 1 mg is dissolved with 70 ~ 75 μ l DMSO, get dye solution;
With above-mentioned steps 1) every kind of amplified production (comprising above-mentioned steps 1) of gained 2. in for the SNP site carry out the amplified production of pcr amplification gained and step 1) 3. in carry out the amplified production of pcr amplification gained for GAPDH) get 10 μ l and mix, get the amplified production mixed solution; Then by the amount of 2 μ l dye solutions/per 10 μ l amplified production mixed solutions with above-mentioned 2 mixings, transfer at dark room temperature environment and to set to 0 .5 ~ 1.5 hour; Then carry out purifying, wash-out, be concentrated into 1/10 ~ 1/15 of amplified production mixeding liquid volume; Get hybridization probe;
2., sample and chip hybridization:
With above-mentioned steps 1. the hybridization probe of gained be handled as follows:
First cover plate is covered on the chip, again with the hybridization probe and 2 * F hybridization solution (20 * SSC of 250 μ l, the 250 μ l deionized formamides that obtain; 10 μ l mass concentrations, 10% SDS composition) equal volume amounts is handled as follows after mixing: in 98 ℃ of sex change 2 minutes, then place rapidly on ice; Take out after 5 minutes, centrifugal, get hybridization probe after the processing and the mixed solution of hybridization solution; Then after drawing the mixed solution of hybridization probe after the above-mentioned processing and hybridization solution with liquid-transfering gun, the aperture from cover plate is added in the inferior matrix; Then at 58 ℃ of hybridization 2h; Described 2 * F hybridization solution gets according to the preparation of raw material of following volume ratio: 20 * SSC damping fluid of 250 μ l, 250 μ l deionized formamides and 10 μ l mass concentrations, 10% SDS;
Use respectively at last elutriant I (2 * SSC, 0.1% SDS, 42 ℃ of preheatings), elutriant II (0.5 * SSC, 0.01%SDS, 42 ℃ of preheatings), (0.06 * SSC) respectively washes 5 min to the elutriant III; Use again slide whizzer (for example being 800rpm) to dry;
The preparation method of elutriant I is: the SDS(sodium lauryl sulphate that adds 1g on the basis of 2 * SSC damping fluid of every 1L), and 42 ℃ of preheatings 2 minutes;
The preparation method of elutriant II is: add the SDS of 0.1 g on the basis of 0.5 * SSC damping fluid of every 1L, 42 ℃ of preheatings 2 minutes;
The elutriant III is 0.06 * SSC damping fluid;
3), the detection of results of hybridization and analysis:
Adopt Agilent G2505 B scanner scanning chip, and with bioinformatics software the result is analyzed, (average signal value-average background signal)/average background signal, described each corresponding wild-type probe in SNP site and mutant probe are judged, greater than 5 times the positive that is considered as, as basis for estimation;
When certain gene locus only has wild-type probe positive, show that this gene locus corresponding to testing sample is wild-type;
When certain gene locus only has the mutant probe positive, show that this gene locus corresponding to testing sample is mutant;
When the wild-type probe of certain gene locus and mutant probe are all positive, show that this gene locus corresponding to testing sample is heterozygous.
Improvement as the using method of the chip that can predict smoking future trouble lung-cancer-risk of the present invention: further comprising the steps of:
The prediction of smoking future trouble lung-cancer-risk:
When any one gene locus corresponding to testing sample is mutant or heterozygous, show that party concerned's smoking future trouble lung-cancer-risk of this testing sample is high; Mutant or heterozygous appear in 9 SNP sites more, and risk is then higher;
All gene locuss corresponding when testing sample are wild-type, show that party concerned's smoking future trouble lung-cancer-risk of this testing sample is low than the general population.
The remarks explanation: used water is the water of 18.2 megohms that do not contain nuclease among the present invention, used water when comprising the various solution of preparation.
All genes relevant with lung cancer susceptibility that the present invention will study are at present collected and are analyzed, choose the candidate gene of significance, simultaneously in conjunction with chip technology, the tumor susceptibility gene that filters out is made into chip, relation from integral level research genetic polymorphism and lung cancer susceptibility, then by constantly optimizing, finally develop a kind of SNP chip of suffering from lung-cancer-risk for smoking population, be used for the prediction smoking population and suffer from the height of lung-cancer-risk, carry out targetedly personalized prevention, some high-risk smoking populations are tried to stop, thus the sickness rate of minimizing lung cancer.
The present invention has following advantage:
The SNP sudden change situation of first passage batch detection smoking population of the present invention, thus can learn easily that testing sample is mutant or heterozygous for 9 SNP sites; Thereby realize that this crowd of prediction suffers from the risk of lung cancer, this is at home for pioneering, at present both at home and abroad all without similarly achievement in research or accordingly product, chip of the present invention can be developed further into for home-use detection kit, for those smoking populations provide reference, contribute thereby reduce the lung cancer in China sickness rate.
Description of drawings
Below in conjunction with accompanying drawing the specific embodiment of the present invention is described in further detail.
Fig. 1 is the synoptic diagram of each inferior matrix:
The positive probe of solid box, dotted line interval box are wild-type probe, and the dotted line frame is the mutant probe, other negative probes;
The remarks explanation: the wild-type probe in each SNP site and mutant probe are established 3 multiple holes respectively.
Fig. 2 with the picture after the scanner scanning, sees right figure after being hybridization, in two white edges, is respectively the homozygous mutation type, and heterozygous; Choose the gene of heterozygous, test the order checking.
It is bimodal that Fig. 3 is that the sequence verification result is shown as, and is a heterozygous, and to the result of other gene locuss, also meet the result of chip.The result that present method is described is comparatively reliable.
Embodiment
Embodiment 1,
1, the searching of SNP gene locus is with definite:
Snp database search mutational site from NCBI, altogether comprise, CDKAL1(rs7756992), CYP2E1 (rs 2031920), Interleukin-18 (rs 360721), Interleukin-8 (rs 4073), Interleukin 1B (rs 16944), ITGA11 (rs 2306022), NAT 2 (rs 1799930), XPD (ERCC2) (rs 13181), these nine different sites of Gln632Gln (rs3547).These nine sites at home and abroad have been considered to relevant with the lung cancer generation after the smoking in the document, and reach conspicuous level.
2, the design of probe and primer
All sites is identified by chip after increasing by multiplex PCR.Designed primer and probe are as follows respectively:
Table 1
3, chip preparation
Amount to 20 probes (as shown in table 1).Every probe repeats point sample three times.Three points of negative probe, point are in the upper right corner of each inferior matrix, and the positive probe of GAPDH is put respectively three the other angles at each inferior matrix; The wild-type probe in each SNP site and mutant probe are established 3 multiple holes respectively.
12 inferior matrixes of every chip point, each inferior matrix is 9 * 9 dot matrix.The probe of concentration 67mM with carry out point sample after the point sample damping fluid mixes according to 1:1 volume (namely respectively getting 2.5 μ l).With high-throughput chip point sample instrument point coremaking sheet (dot spacing 250um, spot diameter 100um).The relative humidity of maintenance 50% was spent the night (12 hours, be room temperature), then with chip again in 42 the degree preheatings prehybridization solution (preparation method of the prehybridization solution of 42 ℃ of preheatings is: in 20 * SSC of 100ml damping fluid, the SDS 4ml, the BSA 40ml of mass concentration 10% that add mass concentration 10% use the water of 18.2 megohms that do not contain nuclease to be settled to 420ml; 42 ℃ of preheatings 2 minutes) the insulation prehybridization is 40 minutes in, water (water that does not contain 18.2 megohms of nuclease) was washed 2 minutes immediately again, and Virahol cleans 2min, dried with slide whizzer 800rpm again, get detection chip (can predict the chip of smoking future trouble lung-cancer-risk), for subsequent use.
The point sample damping fluid is conventional commercially available prod, for example the optional point sample damping fluid of using (the article No. BST02010) of the production of Shanghai hundred proud companies.
4, the multiplex PCR of target gene amplification
One, blood is got in the EDTA anti-freezing, then utilizes genome in the whole blood of Qiagen to extract test kit (for example article No. 51104) and extracts genomic dna (extracting solution of testing sample DNA) in the testing sample, and the method is routine techniques.
Then the extracting solution of every kind of testing sample DNA is utilized respectively all primers (as shown in table 19 SNP sites institute one to one 9 pairs of primers) to carry out respectively the multiplex PCR amplification, thereby obtain 9 kinds of amplified productions; Concrete steps are as follows:
In the 25 μ l PCR reaction systems, (containing 15mM Mg ion, for example is MgCl to contain l0 * PCR reaction buffer
2) 2.5 μ l, (total concn is 10mM to contain the dNTP of amine acyl dUTP, the dUTP that contains 2mM amine acyl mark) 2.0 μ l, Taq archaeal dna polymerase (2U/ μ l) 0.5 μ l, each 0.5 μ l(forward primer of primer (20pmol/ μ l) and each 0.5 μ l of reverse primer), the DNA extraction liquid 1 μ l of testing sample, the water that does not contain 18.2 megohms of nuclease is supplied 25 μ l.
PCR loop parameter: 94 ℃ of denaturation 5 min; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ were extended totally 35 circulations 25 seconds.Get amplified production.
The above-mentioned preparation method who contains the dNTP (total concn is 10mM, contains the dUTP of 2mM amine acyl mark) of amine acyl dUTP is: with dATP, and dTTP, dGTP, dCTP, aa dUTP and the water that does not contain 18.2 megohms of nuclease mix, and get solution; DATP, dTTP, dGTP, dCTP, the concentration of aa dUTP in solution respectively is respectively 2mM; Aa dUTP is the dUTP that contains amine acyl mark.
Two, blood is got in the EDTA anti-freezing, and then utilizing in the whole blood of Qiagen genome to extract test kit (article No. 51104), to extract known be the genomic dna (known is the DNA extraction liquid of Healthy People) of Healthy People, and the method is routine techniques.
Illustrate: above-mentioned known be that Healthy People refers to check through existing medical means and is the Healthy People without lung cancer and pulmonary disorder.
With known be that the DNA extraction liquid of Healthy People carries out pcr amplification for GAPDH, thereby obtain corresponding amplified production:
The PCR reaction system is:
(contain 15mM Mg ion, for example be MgCl to l0 * PCR reaction buffer
2) 2.5 μ l, (total concn is 10mM to contain the dNTP of amine acyl dUTP, the dUTP that contains 2mM amine acyl mark) 2.0 μ l, Taq archaeal dna polymerase (2U/ml) 0.5 μ l, each 0.5 μ l(forward primer of primer (20pmol/ μ l) and each 0.5 μ l of reverse primer), known is the DNA extraction liquid 1 μ l of Healthy People, and the water that does not contain 18.2 megohms of nuclease is supplied 25 μ l;
PCR loop parameter: 94 ℃ of denaturation 5 min; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ were extended totally 35 circulations 25 seconds; Get amplified production;
GAPDH:
Forward primer: GCACCGTCAAGGCTGAGAAC
Reverse primer: TGGTGAAGACGCCAGTGGA.
That is, as described in Table 1.
It is to do Quality Control that the positive purpose of GAPDH is set.
5, chip hybridization detects
1., fluorochrome label amplified production:
The every bag of Powdered dyestuff (1mg) is dissolved with 72 μ l DMSO, get dye solution; Then packing, deposit-20 ℃ of dark places.The name of this Powdered dyestuff is called the Cy5 dyestuff, GE company, and article No. is PA25001.
Every kind of testing sample is carried out respectively following work:
With 10 kinds of amplified productions of above-mentioned steps gained (be 9 SNP sites respectively corresponding 9 kinds of amplified productions and for the increase amplified production of gained of GAPDH) every kind in get 10 μ l and mix (namely, total amount is 100ul), get the amplified production mixed solution.Then get the quantity relative ratio relationship adding fluorescence dye mixing of amplified production mixed solution by 2 μ l dye solutions/per 10 μ l, under dark room temperature environment, placed 1 hour.And utilize the purification kit (article No. 28104) of Qiagen to carry out purifying, wash-out, and be concentrated into 7 μ l with the vacuum concentration instrument; Get hybridization probe.
2., sample and chip hybridization:
With above-mentioned steps 1. the hybridization probe of every kind of testing sample of gained be handled as follows respectively:
First cover plate is covered on the chip, again with the hybridization probe 7 μ l and the 2 * F hybridization solution (20 * SSC damping fluid of 250 μ l that obtain; 250 μ l deionized formamides; The SDS composition of 10 μ l mass concentrations 10%) 7 μ l carry out being handled as follows after the balanced mix: 98 ℃ of sex change 2 minutes, then place rapidly on ice; Take out after 5 minutes, 1000rcf centrifugal 3 seconds get hybridization probe and the mixed solution of hybridization solution after the processing, then draw (all absorptions) with liquid-transfering gun.Aperture from the cover plate adds hybridization probe after the above-mentioned processing and the mixed solution (about 14 μ l) of hybridization solution, and liquid can along with tension force, be diffused into the probe array zone.
Each sample is added to an inferior matrix, at 58 ℃ of hybridization 2h.
Then use respectively elutriant I (2 * SSC, 0.1% SDS need 42 ℃ of preheatings), elutriant II (0.5 * SSC, 0.01%SDS need 42 ℃ of preheatings), (0.06 * SSC) respectively washes 5 min to the elutriant III.Dry with slide whizzer 800rpm again.
The preparation method of above-mentioned elutriant I is: the SDS(sodium lauryl sulphate that adds 1g on the basis of 2 * SSC damping fluid of every 1L), and 42 ℃ of preheatings 2 minutes.
The preparation method of above-mentioned elutriant II is: add the SDS of 0.1 g on the basis of 0.5 * SSC damping fluid of every 1L, 42 ℃ of preheatings 2 minutes.
Above-mentioned elutriant 3 is 0.06 * SSC damping fluid.
6, the detection of results of hybridization and analysis
Adopt Agilent G2505 B scanner scanning chip, and with bioinformatics softwares such as genepix the result is analyzed, (average signal value-average background signal)/average background signal, each corresponding wild-type probe in SNP site and mutant probe are judged, greater than 5 times the positive that is considered as, as basis for estimation.
The remarks explanation: a chip can detect 12 kinds of different samples.And can to every kind of sample, all detect that 9 SNP sites.
7, random choose chip results is with sanger method sequence verification
Statistical analysis: with χ
2The significance of two groups of crowd's genotype frequencies of check analysis distributional difference.The odds ratio (OR) that calculates with the non-conditionality logistic Return Law represents the relative risk degree with 95% fiducial limit (CI).Statistical study is all calculated by SPSS 13.0 softwares.
The detection of results of hybridization and analysis:
Adopt Agilent G2505 B scanner scanning chip, and with bioinformatics softwares such as genepix the result is analyzed, (average signal value-average background signal)/average background signal, greater than 5 times the positive that is considered as, wherein: only having this gene locus of expression detection sample of the wild-type probe positive is wild-type; Only having the expression of the mutant probe positive to detect this gene locus of sample is mutant, two kinds of probes all positive expression to detect this gene locus of sample be heterozygous.
In each inferior matrix, the effect of positive probe is location and Quality Control; When no signal condition appears in positive probe, then show the failure of an experiment, need to re-start experiment; The effect of negative probe is location and Quality Control; When signal condition appears in negative probe, then show the failure of an experiment, need to re-start experiment.
Remarks explanations: the theory approved of the industry is at present: when in 9 SNP sites corresponding to testing sample any one during for mutant or heterozygous, show that party concerned's smoking future trouble lung-cancer-risk of this testing sample is high; Mutant or heterozygous appear in 9 SNP sites more, and risk is then higher.All gene locuss in 9 SNP sites corresponding to testing sample are wild-type, show that party concerned's smoking future trouble lung-cancer-risk of this testing sample is low than the general population.
The above-mentioned theory foundation for example is " progress of CYP1A1, CYP2E1 gene pleiomorphism and cancer susceptibility ", " research of metabolic enzyme CYP2D6, GSTP1, NAT2 gene pleiomorphism and lung cancer susceptibility relation ".
Example one
Research object: 126 routine patients with lung cancer are all made a definite diagnosis through the postoperative histopathology from the patient who accepts puncture or operation year June in January, 2006 to 2010 in the Changxing County, Zhejiang Province the People's Hospital.Select 126 examples else without the outpatient service physical examination of healthy population contrast of lung cancer and pulmonary disorder, contrast crowd's sex, age (± 5 years old) match with the frequency of patients with lung cancer.Collect patient and collator's blood preparation, it is to be measured to be stored in-70 ℃ of refrigerators.Understand study population's smoking history, population characteristic, oil smoke contact history, Exposed history, Family history of cancer etc. by survey.Smoking is defined as: 1 of average smoking every day or more than, smoking is at least 1 year continuously.
The lung cancer group patient male sex 82 examples, women's 44 examples, 25 years old to 81 years old age, average 52.3 years old.Control group man 84 examples, woman 42 years old, the age 22 is to 80 years old, average 51.9 years old.Two groups of Gender formations, ages form equal no difference of science of statistics.
Blood is got in the EDTA anti-freezing, then utilizes the blood DNA of Qiagen to extract the genomic dna that test kit (article No. 51104) extracts whole blood, gets the extracting solution of every kind of testing sample DNA;-20 ℃ for subsequent use.
Detection method is with embodiment 1.
The detection of results of hybridization and analysis:
Adopt Agilent G2505 B scanner scanning chip, and with bioinformatics softwares such as genepix the result is analyzed, (average signal value-average background signal)/average background signal, greater than 5 times the positive that is considered as, wherein: only having this gene locus of expression detection sample of the wild-type probe positive is wild-type; Only having the expression of the mutant probe positive to detect this gene locus of sample is mutant, two kinds of probes all positive expression to detect this gene locus of sample be heterozygous.
The result is as shown in Figure 2:
Fig. 2 with the picture after the scanner scanning, sees right figure after being hybridization, in two white edges, is respectively the homozygous mutation type, and heterozygous; Choose the gene of heterozygous, test the order checking.The result is as shown in Figure 3: sequence verification result is shown as bimodal, is a heterozygous, and to the result of other gene locuss, also meets the result of chip.The result that present method is described is comparatively reliable.
Above-mentioned particular exam conclusion is as follows:
Table 2,
The remarks explanation: above-mentioned each " heterozygous " all carried out sequence verification, and the result all is shown as bimodal.
The result shows that in the patients with lung cancer, 9 SNP sites find that the probability of mutant+heterozygous will be higher than healthy population, and by statistical study, the P value reaches significant state.
In addition: the relation of XPD gene pleiomorphism and lung cancer occurrence risk: listed the genotypic adjustment odds ratio of XPD 751Lys/Gln in the patients with lung cancer in the table 3, take the genotype of carrying XPD 751Lys/Lys as with reference to the crowd, after adjusting the factors such as age, income, schooling, the risk that the individuality of (being Lys/Gln or Gln/Gln) is suffered from lung cancer after the Lys/Lys disappearance (OR=2.83 of adjustment that obviously raises, 95%CI is 1.22-6.54), see Table described.
XPD genotype and smoking interaction are on the impact of lung cancer occurrence risk: XPD 751Lys/Gln genotype and smoking may be to certain interactions of existing of lung cancer, layer analysis shows, be large the increasing that have a big risk of the individuality generation lung cancer of Lys/Gln or Gln/Gln and smoking in phenotype, the OR value of proofreading and correct is that 6.92 (95%CI is 1.72-20.36, P=0.003), see Table 4.
The relative risk analysis of table 3. XPD gene pleiomorphism and lung cancer
Table 4. XPD genotype and smoking interaction affect lung cancer/contrast (routine number) to the lung cancer occurrence risk
At last, it is also to be noted that what more than enumerate only is several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention all should be thought protection scope of the present invention.
Claims (5)
1. can predict the chip of smoking future trouble lung-cancer-risk, it is characterized in that:
It is GGGTGTATGGGTCGTAGCGAACTGAG that negative probe is set, and it is GTCCAGTTAATTTCTGACCTTTACTCCTGCCCTTTGAGTTTGATGATGCTGAGTGT AC that the positive probe of GAPDH is set;
Wild-type probe and the mutant probe at least one the SNP site in following 9 SNP sites also are set:
CDKAL1:
Wild-type probe: TATTTTAGTTTTAGATCTACAGTTA
Mutant probe: TATTTTAGTTTTGGATCTACAGTTA;
CYP2E1:
Wild-type probe: ATATAAAAGTACAAAATTGCAA
Mutant probe: ATATAAAAGTATAAAATTGCAA;
IL-18:
Wild-type probe: GCTGAAACTTCTGGCATTTATTGAATG
Mutant probe: GCTGAAACTTCTGGGATTTATTGAATG;
IL-8:
Wild-type probe: TGAAACTTCTGGCATTTATTGAATG
Mutant probe: TGAAACTTCTGGGATTTATTGAATG;
IL1B:
Wild-type probe: GTTCTCTGCCTCAGGAGCTCTCT
Mutant probe: GTTCTCTGCCTCGGGAGCTCTCT;
ITGA11:
Wild-type probe: GTCACATCGGTCATGTCCTCCAG
Mutant probe: GTCACATCGGTCGTGTCCTCCAG;
NAT2:
Wild-type probe: CTTGAACCTCAAACAATTGAAG
Mutant probe: CTTGAACCTCGAACAATTGAAG;
XPD:
Wild-type probe: CTCTATCCTCTGCAGCGTCTCCTCT
Mutant probe: CTCTATCCTCTTCAGCGTCTCCTCT;
Gln632Gln:
Wild-type probe: ACATACTTCAGGCCTGCGGCACCACC
Mutant probe: ACATACTTCAGGCTTGCGGCACCACC.
2. the preparation method that can predict the chip of smoking future trouble lung-cancer-risk as claimed in claim 1 is characterized in that comprising the steps:
1), at chip at least one inferior matrix is set, each inferior matrix is carried out following setting:
Every kind of probe is arranged to the probe solution that corresponding concentration is 65 ~ 70mM; Every kind of probe solution proceeds as follows respectively: after point sample damping fluid equal-volume mixes, carry out point sample in each inferior matrix;
2), with the chip of step 1) gained under 50% the relative humidity, placed under the room temperature 10 ~ 14 hours;
3), with step 2) chip of gained is incubated prehybridization 35 ~ 45 minutes in the prehybridization solution of 42 ℃ of preheatings;
The preparation method of the prehybridization solution of described 42 ℃ of preheatings is: in 20 * SSC of 100ml damping fluid, SDS 3.5 ~ the 4.5ml, the BSA 38 ~ 42ml of mass concentration 10% that add mass concentration 10% use the water of 18.2 megohms that do not contain nuclease to be settled to 420ml; 42 ℃ of preheatings 2 minutes;
4), with step 2) chip of gained cleans with water, the Virahol of 18.2 megohms that do not contain nuclease successively, and is then dry, gets the chip that can predict smoking future trouble lung-cancer-risk.
3. the preparation method that can predict the chip of smoking future trouble lung-cancer-risk according to claim 2 is characterized in that:
Point sample in the described step 1) is: carry out a system with high-throughput chip point sample instrument, dot spacing 200 ~ 300um, spot diameter 80 ~ 120um.
4. the using method that can predict the chip of smoking future trouble lung-cancer-risk as claimed in claim 1 is characterized in that every kind of testing sample DNA is carried out following steps successively:
1), the multiplex PCR of target gene amplification:
1., obtain the extracting solution of testing sample DNA;
2., the extracting solution of testing sample DNA is carried out pcr amplification for each SNP site, thus obtain corresponding amplified production:
The PCR reaction system is:
L0 * PCR reaction buffer (containing 15mM Mg ion) 2.5 μ l, (total concn is 10mM to contain the dNTP of amine acyl dUTP, the dUTP that contains 2mM amine acyl mark) 2.0 μ l, Taq archaeal dna polymerase (2U/ml) 0.5 μ l, each 0.5 μ l of primer (20pmol/ μ l), the DNA extraction liquid 1 μ l of testing sample, the water that does not contain 18.2 megohms of nuclease is supplied 25 μ l;
PCR loop parameter: 94 ℃ of denaturation 5 min; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ were extended totally 35 circulations 25 seconds; Get amplified production;
CDKAL1:
Forward primer: CCTCAAGCAACCCTCCTCC
Reverse primer: GCAAATAAATTCAACTGGCATC;
CYP2E1:
Forward primer: GACTTGCTTATGTGGCTAA
Reverse primer: TCATACAGACCCTCTTCCA;
IL-18:
Forward primer: GAAGCCAGTCCTTCCTAAA
Reverse primer: TCATTGCCACAAAGTTGAT;
IL-8:
Forward primer: GATTGGCTGGCTTATCTTC
Reverse primer: GTTTGTGCCTTATGGAGTG;
IL1B:
Forward primer: ATCGTTGTGCAGTTGATGT
Reverse primer: ATCTGGCATTGATCTGGTT;
ITGA11:
Forward primer: CCCTGCGTGATTGAATCTGC
Reverse primer: TTTACTGCCCTCCCATTTGTC;
NAT2:
Forward primer: TCGATGCTGGGTCTGGAAG
Reverse primer: CAGGTTTGGGCACGAGATT;
XPD(ERCC2):
Forward primer: GATTAAAGGCTGTGGACATGA
Reverse primer: TCCGACTACCTAGCTGGCTC;
Gln632Gln:
Forward primer: GAGGGTCAGATTCCCAGTT
Reverse primer: TGAGGAGGTGAGTACCAAAG;
3., with known be that the DNA extraction liquid of Healthy People carries out pcr amplification for GAPDH, thereby obtain corresponding amplified production:
The PCR reaction system is:
L0 * PCR reaction buffer (containing 15mM Mg ion) 2.5 μ l, (total concn is 10mM to contain the dNTP of amine acyl dUTP, the dUTP that contains 2mM amine acyl mark) 2.0 μ l, Taq archaeal dna polymerase (2U/ml) 0.5 μ l, each 0.5 μ l(forward primer of primer (20pmol/ μ l) and each 0.5 μ l of reverse primer), known is the DNA extraction liquid 1 μ l of Healthy People, and the water that does not contain 18.2 megohms of nuclease is supplied 25 μ l;
PCR loop parameter: 94 ℃ of denaturation 5 min; 94 ℃ of sex change 30 seconds, 60 ℃ of annealing 30 seconds, 72 ℃ were extended totally 35 circulations 25 seconds; Get amplified production;
Described GAPDH:
Forward primer: GCACCGTCAAGGCTGAGAAC
Reverse primer: TGGTGAAGACGCCAGTGGA;
2), chip hybridization detects:
1., fluorochrome label amplified production:
Powdered dyestuff 1 mg is dissolved with 70 ~ 75 μ l DMSO, get dye solution;
With above-mentioned steps 1) every kind of amplified production (comprising above-mentioned steps 1) of gained 2. in for the SNP site carry out the amplified production of pcr amplification gained and step 1) 3. in carry out the amplified production of pcr amplification gained for GAPDH) get 10 μ l and mix, get the amplified production mixed solution; Then by the amount of 2 μ l dye solutions/per 10 μ l amplified production mixed solutions with above-mentioned 2 mixings, transfer at dark room temperature environment and to set to 0 .5 ~ 1.5 hour; Then carry out purifying, wash-out, be concentrated into 1/10 ~ 1/15 of amplified production mixeding liquid volume; Get hybridization probe;
2., sample and chip hybridization:
With above-mentioned steps 1. the hybridization probe of gained be handled as follows:
First cover plate is covered on the chip, again with the hybridization probe that obtains be handled as follows after 2 * F hybridization solution equal volume amounts is mixed: in 98 ℃ of sex change 2 minutes, then place rapidly on ice; Take out after 5 minutes, centrifugal, get hybridization probe after the processing and the mixed solution of hybridization solution; Then after drawing the mixed solution of hybridization probe after the above-mentioned processing and hybridization solution with liquid-transfering gun, the aperture from cover plate is added in the inferior matrix; Then at 58 ℃ of hybridization 2h;
Described 2 * F hybridization solution gets according to the preparation of raw material of following volume ratio: 20 * SSC damping fluid of 250 μ l, 250 μ l deionized formamides and 10 μ l mass concentrations, 10% SDS;
Respectively wash 5 min with elutriant I, elutriant II, elutriant III respectively at last; Dry with the slide whizzer again;
The preparation method of elutriant I is: add the SDS of 1g on the basis of 2 * SSC damping fluid of every 1L, 42 ℃ of preheatings 2 minutes;
The preparation method of elutriant II is: add the SDS of 0.1 g on the basis of 0.5 * SSC damping fluid of every 1L, 42 ℃ of preheatings 2 minutes;
The elutriant III is 0.06 * SSC damping fluid;
3), the detection of results of hybridization and analysis:
Adopt Agilent G2505 B scanner scanning chip, and with bioinformatics software the result is analyzed, (average signal value-average background signal)/average background signal, described each corresponding wild-type probe in SNP site and mutant probe are judged, greater than 5 times the positive that is considered as, as basis for estimation;
When certain gene locus only has wild-type probe positive, show that this gene locus corresponding to testing sample is wild-type;
When certain gene locus only has the mutant probe positive, show that this gene locus corresponding to testing sample is mutant;
When the wild-type probe of certain gene locus and mutant probe are all positive, show that this gene locus corresponding to testing sample is heterozygous.
5. the using method that can predict the chip of smoking future trouble lung-cancer-risk according to claim 4 is characterized in that: further comprising the steps of:
The prediction of smoking future trouble lung-cancer-risk:
When any one gene locus corresponding to testing sample is mutant or heterozygous, show that party concerned's smoking future trouble lung-cancer-risk of this testing sample is high; Mutant or heterozygous appear in 9 SNP sites more, and risk is then higher;
All gene locuss corresponding when testing sample are wild-type, show that party concerned's smoking future trouble lung-cancer-risk of this testing sample is low than the general population.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210167729.9A CN102899393B (en) | 2012-05-23 | 2012-05-23 | Chip for forecasting lung cancer risk of smoker after smoking and preparation method and use method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210167729.9A CN102899393B (en) | 2012-05-23 | 2012-05-23 | Chip for forecasting lung cancer risk of smoker after smoking and preparation method and use method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102899393A true CN102899393A (en) | 2013-01-30 |
CN102899393B CN102899393B (en) | 2014-04-02 |
Family
ID=47571880
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210167729.9A Expired - Fee Related CN102899393B (en) | 2012-05-23 | 2012-05-23 | Chip for forecasting lung cancer risk of smoker after smoking and preparation method and use method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102899393B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107034287A (en) * | 2017-05-22 | 2017-08-11 | 中南大学 | The common SNPs of NAT2 Sanger PCR sequencing PCRs are disposably detected for isoniazid personalized medicine |
CN113234830A (en) * | 2021-06-29 | 2021-08-10 | 浙江医院 | Product for lung cancer diagnosis and application |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
TWI617668B (en) * | 2017-03-15 | 2018-03-11 | Carcinoma risk assessment method |
-
2012
- 2012-05-23 CN CN201210167729.9A patent/CN102899393B/en not_active Expired - Fee Related
Non-Patent Citations (3)
Title |
---|
HC ERICHSEN等: "SNPs in cancer research and treatment", 《BRITISH JOURNAL OF CANCER》 * |
JIAOYANG YIN等: "The DNA repair gene XRCC1 and genetic susceptibility of lung cancer in a northeastern Chinese population", 《LUNG CANCER》 * |
胡彬等: "利用单核苷酸多态性芯片全基因组检测人大细胞肺癌细胞株的杂合性缺失和拷贝数变异", 《中国肺癌杂志》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107034287A (en) * | 2017-05-22 | 2017-08-11 | 中南大学 | The common SNPs of NAT2 Sanger PCR sequencing PCRs are disposably detected for isoniazid personalized medicine |
CN113234830A (en) * | 2021-06-29 | 2021-08-10 | 浙江医院 | Product for lung cancer diagnosis and application |
CN113234830B (en) * | 2021-06-29 | 2022-03-08 | 浙江医院 | Product for lung cancer diagnosis and application |
Also Published As
Publication number | Publication date |
---|---|
CN102899393B (en) | 2014-04-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Rafehi et al. | Bioinformatics-based identification of expanded repeats: a non-reference intronic pentamer expansion in RFC1 causes CANVAS | |
Kinnally et al. | Epigenetic regulation of serotonin transporter expression and behavior in infant rhesus macaques | |
Nisoli et al. | D2 dopamine receptor (DRD2) gene Taq1A polymorphism and the eatingrelated psychological traits in eating disorders (anorexia nervosa and bulimia) and obesity | |
CN107254531B (en) | Genetic biomarker for auxiliary diagnosis of early colorectal cancer and application thereof | |
CN103184268A (en) | Kit for detecting aldehyde dehydrogenase 2 gene polymorphism and amplification method and detection method thereof | |
Fudalej et al. | Association between tryptophan hydroxylase 2 gene polymorphism and completed suicide | |
CN114292909B (en) | Application of SNP rs241970 as target in development of kit for screening plateau pulmonary edema susceptible population | |
CN111676283B (en) | Application of mitochondrial DNA single nucleotide polymorphism related to occurrence of high altitude pulmonary edema | |
CN111560428B (en) | Application of substance for detecting single nucleotide polymorphism of mitochondrial DNA rs3937033 | |
CN102899393B (en) | Chip for forecasting lung cancer risk of smoker after smoking and preparation method and use method thereof | |
Valenta et al. | Determinants of excess genetic risk of acute myocardial infarction-a matched case-control study | |
CN106834501A (en) | To the fat related mononucleotide polymorphism site of Children in China and its application | |
Hamilton | Linkage and association studies of anxiety disorders. | |
CN107557468B (en) | Cancer-testis gene genetic marker related to auxiliary diagnosis of primary lung cancer and application thereof | |
CN114381516B (en) | Kit for screening plateau pneumochysis susceptible population and application thereof | |
Haberstick et al. | Between-and within-family association test of the dopamine receptor D2 TaqIA polymorphism and alcohol abuse and dependence in a general population sample of adults | |
JP5360853B2 (en) | Gene detection method for metabolic syndrome | |
Arenas et al. | Dynamic genetic linkage of intermediate blood pressure phenotypes during postural adaptations in a founder population | |
JP2006254735A (en) | Diabetic disease-sensitive gene, and method for detecting difficulty or easiness of being infected with diabetes | |
CN114292910B (en) | Kit for screening plateau pneumochysis susceptible population developed based on SNP rs11620394 and application thereof | |
KR102562955B1 (en) | Single nucleotide polymorphism for predicting the risk factor of lung function depression and the use thereof | |
CN111041086B (en) | SNP site susceptible to RPL13 gene congenital heart disease and application thereof | |
JP5489146B2 (en) | Genetic risk detection method for obesity | |
CN106399571A (en) | Application of SNP (single nucleotide polymorphism) rs181206 in screening of patients with leprosy | |
JP2006254739A (en) | Diabetic disease-sensitive gene, and method for detecting difficulty or easiness of being infected with diabetes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140402 Termination date: 20150523 |
|
EXPY | Termination of patent right or utility model |