CN102899329B - Construction method for more stable mutant of humanized proteasome activity factor - Google Patents

Abstract

The invention relates to a construction method for a mutant REGgammaLinker of a proteasome activity factor REGgamma, which is humanized and not dependent on ubiquitination and ATP (Adenosine Triphosphate) and has a more stable structure. According to the construction method, a molecular cloning method is mainly adopted for respectively performing two times of different polymerase chain reactions and replacing the amino acids from 60-bit to 107-bit of the original REGgamma by hexapeptide Linker (GAVSAG), so that a more stable mutant is obtained. The mutant protein is subjected to prokaryotic expression, purification, crystal screening and structural analysis. The experimental analysis for the structure and function of parent protein proves that the mutant with stable structure and without influence on the activating function of the proteasome is obtained according to the construction method provided by the invention, so that a theory basis is supplied to the aspects, such as the future biological study on the REGgamma protein, medicinal development, and the like.

Description

A kind of construction process of more stable people's source protein enzyme body incitant mutant

Technical field

The invention belongs to molecular biology and structure biology field, relate to a kind of more stable construction process of people's source protein enzyme body incitant and the parsing of its crystalline structure.

Background technology

Proteasomal system plays an important role in the degraded of eukaryotic cell bak protein, and in the regulation and control of cell cycle, transcribe, signal transduction, apoptosis and immunne response aspect all play a part key.Proteasome is degraded to protein mainly through two kinds of approach that ubiquitin relies on and non-ubiquitin relies on.20S proteasome is the core of degrade proteins, the annular cylinder structure be made up of different subunits, and two outer shrouds are made up of 7 kinds of different alpha subunits, and two inner ring are made up of 7 kinds of obstructed β subunits, and wherein protease activity is positioned in β subunit.The activity of proteolytic enzyme needs to be activated by proteasome incitant.The proteasome incitant that current report finds mainly contains PA700, PA28 and PA200. is also not very clear at present for the research of PA200, PA700 is that a class depends on ubiquitination, there is the incitant of ATPase activity, it can combine with 20S proteasome, form 26S mixture, the overwhelming majority come in degradation of cell needs the protein of degraded.Another proteasome incitant is PA28, also referred to as REG, is a kind of proteasome incitant not relying on ubiquitination and do not have ATPase activity.

REGgamma has been proved to be able to activator enzyme body to promote the degraded of some protein, current research shows, REGgamma can mediate the degraded of the proteasome pathway of key protein in some cells, comprises SRC-3, depends on the sub-P of suppression of the protein kinase of cyclin ²¹, P ¹⁶, P ¹⁹.And research shows that REG γ can by promoting the P of MDM2 mediation ⁵³ubiquitination to degrade tumor-inhibiting factor P ⁵³degraded.REGgamma is also a kind of Cell cycle regulatory proteins simultaneously, its mouse knocking out REGgamma gene is obviously suppressed in build growth, REGgamma can reduce cell proliferation, promotes apoptosis, thus implies that it also may play an important role in the generation of cancer.REGgamma can also mediate the degraded of D8L simultaneously, thus illustrates in virus infection and removing, and REGgamma also plays an important role.

The crystal of this proteasome incitant cannot be obtained at present by traditional method, therefore, we construct a kind of new mutant by molecular cloning means, the mutant built by the method, its crystal can be obtained easily, and resolve its structure.

Summary of the invention

The object of the invention is to the means by molecular cloning, build a kind of more stable people's source protein enzyme body incitant mutant REGgammaLinker, and resolve the crystalline structure of this mutant.For the later functional study to this incitant provides architecture basics, thus be study this incitant further for cancer research, and drug development is provided fundamental basis.

The construction process not relying on people's source protein enzyme body incitant mutant REGgammaLinker of ubiquitin and ATP provided by the invention obtains through following steps:

1st, according to the Linker aminoacid sequence that nucleotide sequence and the engineer of REGgamma add, design two pairs of primers, be respectively:

FP1:GCGAATTCATGGCCTCGTTGCTGAAGTTGGAT, SEQ ID No.2 and

RP1:GCCTCGAGTCAGTACAGAGCTTCTGCATTGCT, SEQ ID No.3; And

linker1:GGAGCCGTGAGCGCAGGCCTGAAAAGCAACCAGCAG，SEQ ID No.4

linker2:GCCTGCGCTCACGGCTCCGTGGATCTGAGTTAGGTC，SEQ ID No.5

With the full length nucleotide sequence of REGgamma for template, utilize two pairs of primers to carry out PCR reaction respectively, the amplification front end fragment of substituted amino acid and rear end fragment, the primer used in two PCR reactions is respectively: FP1/linker2, RP1/linker1; By two PCR reactions, the nucleotide sequence before and after linker is cloned respectively;

Utilize FP1/RP1 pair of primers, carry out PCR using the product be obtained by reacting as template above, obtain the full length nucleotide sequence that linker replaces the REGgamma of 60 to 107 amino acids;

2nd, utilize EcoRI and XhoI to carry out double digestion reaction the PCR primer that the linker obtained in upper step reaction replaces, vector plasmid pGEX-6p-1 also utilizes identical enzyme to carry out double digestion reaction simultaneously, forms identical cohesive terminus to make PCR primer and plasmid; Under the effect of T4 ligase enzyme, the goal gene fragment after being cut by enzyme is connected in the plasmid vector of pGEX-6p-1, forms recombinant plasmid pGEX-REGgammaLinker;

3rd, cut this mutant gene of qualification by enzyme to be connected to after expression vector, and send order-checking company to carry out checking order to determine to successfully construct.

The present invention is on the basis of formation of mutant REGgammaLinker, and further provide the Prokaryotic expression, purification of mutant protein REGgammaLinker, crystal screening and structure analysis method, the concrete steps of the method are as follows:

1st, the recombinant plasmid pGEX-REGgammaLinker built above is transformed in expression strain E.coli BL21DE3;

2nd, picking mono-clonal, be inoculated into 5ml and add in 100mg/l Ampicllin antibiotic LB liquid nutrient medium through sterilizing, in 37 DEG C of shaking tables, incubated overnight is after 12 hours, be transferred to 1L and add in 100mg/lAmpicllin antibiotic LB liquid nutrient medium through sterilizing, cultivate about after 4 hours in 37 DEG C of shaking tables, survey its OD and be about 0.7, adding final concentration is that the isopropylthiogalactoside IPTG of 0.5mM makes target protein carry out abduction delivering, the centrifugal 20min of centrifugal 5000rpm after 18 hours is induced to collect thalline at 16 DEG C, the thalline PBS damping fluid Eddy diffusion collected, PBS damping fluid composition is: 137mMNaCl, 2.7mM KCl, 4.3mM Na2HPO4, 1.4mM KH2PO4,

3rd, the bacterium liquid suspended is through ultrasonic disruption and utilize high speed centrifugation 18000rpm 45min to carry out centrifugal, supernatant liquor after centrifugal utilizes GST affinity column to carry out preliminary purification, then utilizes PreScission on post, carry out enzyme and cuts thus remove GST label; Utilize AKTA protein purification instrument after the enzyme target protein cut under wash-out concentrates, carry out purifying through anion-exchange column Resource Q and molecular sieve gel chromatographic column Superdex20010/300GL, obtain through the pure target protein of electrophoresis detection;

4th, electrophoretically pure REGgammaLinker mutant protein sample is obtained by above purification step, this protein solution to be added in Amicon ultrafiltration and concentration pipe and the 150mM NaCl in protein enzyme solution to be utilized not containing NaCl in centrifugal concentrating concentration process under the rotating speed of 4000rpm but the identical damping fluid of other components dilutes, reduce the ionic concn in protein enzyme solution, make NaCl concentration lower than 10mM; Ultraviolet absorption method is utilized to measure the concentration of protein;

After utilizing damping fluid to be diluted to 10mg/ml the protein enzyme solution after mensuration concentration, utilize hanging drop crystallization method in 0.1MTris, 19%PEG3350w/v, 0.2M Li ₂sO ₄, 15%Glycerol, 5% Virahol, obtains the crystal of REGgammaLinker mutant protein under the crystallization condition of pH8.5;

5th, the X ray diffracting data collection step of REGgammaLinker mutant protein crystal is as follows:

5.1st, the nylon crystal rings of Hampton Research company is first used, from the crystal soak solution that dehydration is later, obtain the single crystal of suitable X-ray diffraction, and be refrigerated to subzero 150-180 DEG C in the cryogenic nitrogen air-flow using rapidly the cooling system of Oxford Cyrosystem company to produce; Make X-ray by crystal, utilize precession method to collect X ray diffracting data;

5.2nd, after collecting the X ray diffracting data of crystal, corresponding data processing and structure elucidation is carried out according to following steps:

First using HKL2000 software to process collecting the diffraction data obtained in previous step, obtaining complete data file; Secondly, use the Phaser in CCP4 routine package, utilize Molecular Substitution method, with people's source protein enzyme body incitant REG α of its homology for replacement model PDB code:1AVO carries out molecular replacement to determine its phase place; The structure of REGgammaLinker mutant protein is resolved by softwares such as PHENIX, COOT; Its crystal parameter is as follows:

Parameters REGgammaLinker

Data collection statistics

Unit cell parameters a=89.0 b=89.0 c=438.1 α=β=γ=90

Space group P43212

Wavelength 0.97915

Resolution range 50–3.00(3.11–3.00)

Completeness(%) 86.2(85.6)

Redundancy 7.9(8.0)

Average I/σ(I) 35.5(2.8)

Rmerge(%)5.0(76.1)

Rwork/Rfree(%) 23.4/28.5

r.m.s.d.bonds 0.009

r.m.s.d.angles(°) 1.160

Ramachandran plot(%)

Most favored 95.8；

6th, the activation experiment of mutant protein to proteasome is detected by the experiment alive of the enzyme of fluorescence small peptide;

Carry out wild-type REGgamma and mutant protein REGgammaLinker Enzyme assay, enzyme method of testing alive is carried out after also improving a little the method in the activation experiment of proteasome with reference to the REG described in article " Lysine188substitutions convert the pattern of proteasome activation by REG γ to that of REGs α and β " that people's calendar year 2001s such as JunLi, Martin Rechsteiner deliver on the EMBO Journal.

Enzyme experimental procedure alive is specific as follows: blank adds 40ul assay buffer (50mMTris PH7.5,25mMKCl10mMNaCl 1MgCl ₂); Negative contrast adds 30ul assay buffer, 10ul proteasome (10ug/ml); Positive control adds 20ul assaybuffer, 10ul REG α (100ug/ml), 10ul proteasome; Sample No. 1 group adds 20ul assaybuffer, 10ul REGgamma Native (100ug/ml), 10ul proteasome; Sample No. 2 groups add 20ul assaybuffer; 10ul REGgammaLinker mutant (100ug/ml); 10ul proteasome is appealed each composition in 30 degree of mixing 10min, then adds two kinds of different substrates with fluorophor respectively: Suc-LLVY-MCA (10ul375um); Boc-LRR-MCA (10ul 375um) shakes 2min, then utilize microplate reader to monitor fluorescence-causing substance over time (excitation wavelength is 360nm, and absorbing wavelength is 460nm) read a numerical value every 6min, one hour terminate experiment.

Experimental result is as shown in Figure 2: wherein REG α can two kinds of enzymic activitys (trypsin-like, chymotrypsin-like) of activator enzyme body.And REGgamma can only the trypsin-like active site of activator enzyme body; Same REGgammaLinker mutant to the activation of proteasome enzymic activity and REGgamma Native substantially completely the same, thus can illustrate: after use 6 small peptide Linker of our this experimental design instead of REGgamma Native 60 to 107 amino acids, do not affect its activation effect to proteasome.

Advantage of the present invention and positively effect:

The present invention establishes a kind of method building REGgammaLinker mutant (replacing the amino-acid residue of 60 to 107 with 6 peptides) by molecular cloning means, and the crystalline structure of this mutain has been resolved by the method for X-ray diffraction, make this incitant structurally more stable, identical with parent protein to the activation of proteasome.And by having carried out important functional study to the activation experiment of proteasome and cellular localization experiment.(parent protein is mainly positioned in nucleus, and mutant protein is mainly positioned in tenuigenin), so just for our theoretical investigation afterwards and provide certain theoretical basis on the drug development of relevant Therapeutic cancer.

Accompanying drawing explanation

Fig. 1 is the structural representation of the REGgammaLinker mutant that the present invention builds, and as seen from the figure, wherein has a heptamer molecule in each asymmetry unit.

Fig. 2 be this REGgammaLinker mutant and parent protein to proteasome activation experiment result figure, wherein,

The enzyme that A fluorogenic substrate Suc-LLVY-MCA carries out is lived and is tested,

The enzyme that B fluorogenic substrate Boc-LRR-MCA carries out is lived and is tested.

Embodiment

Following embodiment is only used for explaining the present invention, and not should be understood to limit the scope of the invention by any way.

Embodiment 1,

Do not rely on the structure of people's source protein enzyme body incitant mutant REGgammaLinker of ubiquitin and ATP

1. the molecular cloning containing proteasome incitant mutant REGgammaLinker

1) arrange as template with the nucleotides sequence of REGgamma parent protein, utilize FP1/linker2 respectively, these two pairs of primers of RP1/linker1 (SEQ ID No.2 to SEQ ID No.5) carry out PCR reaction, and the end fragment of site end fragment in front and back is replaced in amplification.Reaction system is as follows:

2) PCR response procedures

2. the recovery of mutant REGgammaLinker gene order PCR primer

After PCR terminates, the agarose gel electrophoresis of product utilization 1% cuts the object fragment that glue reclaims about 600bp.Concrete steps are as follows:

1), after agarose gel electrophoresis terminates, observe under ultraviolet lamp and run cementing fruit, cut the EP pipe that object fragment puts into 1.5ml sterilizing;

2) in EP pipe, add 300 μ L sol solutionses, EP pipe is put into 65 DEG C of water-baths and heat, blob of viscose is dissolved;

3) sol solutions is added in resin column, on ice leave standstill 2min, under room temperature in whizzer the centrifugal 1min of 10000rpm.Liquid in pipe to be refunded in resin column recombine once, leaves standstill 2min on ice, under room temperature in whizzer the centrifugal 1min of 10000rpm, discard the liquid in collection tube;

4) add 600 μ L washingss in resin column, in whizzer, the centrifugal 1min of 12000rpm, discards liquid in collection tube; Repeat this step once;

5) under room temperature in whizzer the centrifugal 3min of 12000rpm, to make in resin column alcohol reduce as far as possible; Resin column is transferred in the EP pipe of 1.5ml sterilizing;

6) on resin column, add the TE solution of 20 μ L65 DEG C preheatings, room temperature leaves standstill 3min, the centrifugal 2min of 12000rpm in whizzer; Repeat this step once.

Obtain 40 μ L REGgammaLinker mutant genes.

The double digestion of 3.REGgammaLinker mutant gene sequence PCR primer and carrier

The object fragment PCR products reclaimed in 3 and vector plasmid pGEX-6p-1 are carried out double digestion simultaneously, and it is as follows that enzyme cuts system:

10*H： 5μL

EcoRI: 1μL

XhoI: 1μL

ddH2O: 18μL

pGEX-6p-1: 1000ng

Object fragment enzyme cuts system and vector plasmid enzyme, and to cut system identical, and difference is that the object fragment amount of adding in system is 600ng.

Reactant is all added in the EP pipe after sterilizing, soft mixing, in 37 DEG C of water-baths, carry out enzyme cut, react more than 18 hours.

The recovery of 4.REGgammaLinker mutant gene sequence PCR primer and the digestion products of carrier, to be connected

Enzyme cut after object fragment and vector plasmid carry out cutting glue and reclaim, recycling step is with 3.After recovery terminates, carry out the connection of object fragment and vector plasmid.Ligation system is as follows:

Solution I: 5μL

Vector plasmid: 0.5 μ L

Goal gene fragment: 4.5 μ L

6 hours are carried out under reacting on 18 DEG C of conditions.

5. connect product conversion E.coli trans5 α

A. from-80 DEG C of refrigerators, take out 100 μ L competent cell suspensions be placed on and thaw on ice;

B. competent cell 50 μ L is joined in the connection product in 5, ice bath 30min;

C. after ice bath terminates, the reaction system in b is put into 42 DEG C of water-bath heat shock 90s, after heat shock terminates, proceed to rapidly ice bath 5min in ice;

D., after ice bath terminates, in reaction system, 800 μ L LB substratum are added, shaking culture 90min in 37 DEG C of shaking tables;

E., after shaking culture terminates, culture is taken out, the centrifugal 10min of 4500rpm in whizzer;

F., after centrifugal, with liquid-transfering gun, most of supernatant is sucked, residual liquid quantity 200 μ L, again with liquid-transfering gun by the bottom of pipe thalline pressure-vaccum suspend get up after, transfer to containing on the antibiotic LB flat board of 100mg/l Ampicillin, push away with hairclipper even, cultivate 14 hours for 37 DEG C.

6. the enzyme of recombinant plasmid cuts qualification

1) after 6 middle plateforms are cultivated 14 hours, planar surface can grow many bacterium colonies, picking mono-clonal bacterium colony to the addition of in the antibiotic LB liquid nutrient medium of 100mg/l Ampicillin in 5ml through high-temperature sterilization, chooses altogether 4 mono-clonals, in 37 DEG C of shaking culture 12 hours;

2) get 3ml bacterium liquid and extract plasmid, the enzyme carrying out plasmid cuts qualification.Plasmid extraction step operates according to vast Tyke test kit specification sheets.Plasmid enzyme restriction system is as follows:

EcoRI: 0.5μL

XhoI: 0.5μL

10*Buffer H 1μL

ddH2O: 3μL

recombinant plasmid: 5μL

37 DEG C of water-baths utilize agarose gel electrophoresis to detect after 4 hours, containing two segment DNA fragments in electrophoresis, size is respectively about 600bp and 4.9kb, shows that object fragment is connected in vector plasmid, plasmid is sent to order-checking company and checks order.Sequencing result is as SEQ ID No.1.

Embodiment 2,

The Prokaryotic expression, purification of mutant protein REGgammaLinker, crystal screening and structure elucidation;

1. by the recombinant plasmid transformed E.coli BL21 with REGgammaLinker mutant full-length gene

To enter E.coli trans5 α step identical with connecting product conversion in 6 for step of converting, and only add LB substratum in system after, 37 DEG C of shaking culture times are 1h.Bacterium liquid is coated on containing on the antibiotic flat board of 100mg/l Ampicillin, is inverted cultivates 12h in 37 DEG C.

2.IPTG induces the heterogenous expression of REGgammaLinker mutant protein

A. on picking flat board containing recombinant plasmid single colony inoculation in 5ml through high-temperature sterilization, with the addition of in the antibiotic LB liquid nutrient medium of 100mg/lAmpicillin, 37 DEG C of shaking culture are spent the night;

B. with the addition of the antibiotic LB liquid medium of 100mg/l Ampicillin by 1% inoculum size switching, 37 DEG C, 200rpm cultivates 4h, induces 18h after adding 0.5mM IPTG in 16 DEG C.

The purifying of 3.REGgammaLinker mutant protein

1) microorganism collection

A. the nutrient solution in 8 is collected thalline in the centrifugal 20min of 5000rpm;

B. in the ratio of the PBS damping fluid (137mMNaCl 2.7mM KCl 4.3mM Na2HPO41.4mM KH2PO4 pH8.0) of 1L fermented liquid 30ml, thalline is resuspended;

2) ultrasonic disruption is utilized to extract bacterium liquid

The bacterium liquid suspended is positioned on ice, utilizes the ultrasonic wave of 40% frequency, under stopping the condition of 6s after ultrasonic 4s, broken 10 minutes, then carry out three circulations, until re-suspension liquid is completely limpid; By the bacterium liquid after fragmentation in the centrifugal 40min of 18000rpm4 degree, collected after centrifugation supernatant;

3) crude extract crosses affinity column

A. GST affinity column is utilized;

B. 1*PBS damping fluid (137mMNaCl 2.7mM KCl 4.3mM Na2HPO41.4mMKH2PO4 pH8.0) damping fluid is used to balance affinity column;

C. by 2) in the crude extract that obtains join in the GST affinity column balanced and make target protein be attached to GST medium top; In triplicate;

D. 1*PBS low salt buffer (137mMNaCl 2.7mM KCl 4.3mM Na2HPO4 1.4mMKH2PO4 pH8.0) and 1*PBS high-salt buffer (500mMNaCl 2.7mM KCl 4.3mM Na2HPO41.4mM KH2PO4 pH8.0) is used alternately to rinse pillar, other foreign proteins are removed by each 10ml;

E. the PreScission proteolytic enzyme adding 60ul 3mg/ml carries out enzyme at 4 degree and cuts through ight to remove GST label;

F. next day, enzyme is cut later albumen 1*PBS low salt buffer (137mMNaCl 2.7mM KCl4.3mM Na2HPO41.4mM KH2PO4 pH8.0) and elute;

4) replacement of the damping fluid of the target protein of wash-out

Join in 30kD evaporating pipe by the Protein elution liquid of collection, under 4 DEG C of conditions, in whizzer, 4000rpm is concentrated into 500ul, then adds 10ml 20mM Tris-HCl(pH8.0) damping fluid to replace the PBS in target protein solution, repeat once;

5) anion-exchange chromatography post (Resource Q) is utilized to be further purified target protein

A. 20mM Tris-HCl(pH8.0 is used) damping fluid balance anion exchange column, until specific conductivity, UV value no longer change;

B. the sample concentrated is transferred in 1.5ml EP pipe, the centrifugal 10min of 13300rpm in 4 DEG C of whizzers, to remove the throw out and bubble that may exist in target protein matter solution;

C. carry out loading by six-way valve, then use 20mM Tris-HCl damping fluid (pH8.0) with the flow velocity of 1ml/min balance pillar 2 column volumes;

D. complete chromatography column to be rinsed, carries out gradient elution.Elution requirement is make salt concn be raised to 700mM elution buffer (20mM Tris-HCl, 1M NaCl, pH8.0) gradually from 0 in 60min, and flow velocity is 1ml/min, collects elution peak according to the monitoring of A280 simultaneously;

E. use the SDS-PAGE electrophoresis of 13% to carry out the detection of target protein purity, collect the partial concentration that purity is higher;

6) molecular sieve gel chromatographic column Superdex 20010/300GL

A. 20mM Tris-HCl is used, 150mM NaCl(pH8.0) damping fluid balance Superdex 20010/300GL molecular sieve gel chromatographic column remains unchanged to specific conductivity;

B. sample concentration is then transferred in 1.5ml EP pipe to 500ul, the centrifugal 10min of 13300rpm in 4 DEG C of whizzers, precipitation and bubble may be there is to remove in protein soln;

C. carry out loading by six-way valve, then at 20mM Tris-HCl, 150mM NaCl(pH8.0) under buffer conditions with flow velocity 0.5ml/min wash-out.Elution peak is collected in change according to A280 monitoring;

D. use the SDS-PAGE electrophoresis detection purity of protein of 13%, collect the partial concentration that purity is higher;

E. protein sample concentration and dilution good after, utilize ultraviolet absorption method to measure the concentration of target protein.

The crystal screening of 4.REGgammaLinker mutant protein, data gathering and structure elucidation

1) character obtained and all extraordinary REGgammaLinker mutant protein of purity are carried out the screening of crystal, obtain the good crystal of outward appearance after one week, thus carry out the optimization of crystal.We utilize the synchrotron radiation in Shanghai to have collected the crystal data of a set of REGgammaLinker mutant.

2) obtain good data file after carrying out data processing by HKL2000, carried out the determination of phase place by the phaser in ccp4 software, then by phenix, and the correction of COOT software, obtain the structure of REGgammaLinker mutant.REGgammaLinker mutant protein crystal belongs to P43212 spacer.

The collection of table 2 crystalline diffraction data and correction

Parameters REGgammaLinker

Data collection statistics

Unit cell parameters a=89.0 b=89.0 c=438.1 α=β=γ=90

Space group P43212

Wavelength 0.97915

Resolution range 50–3.00(3.11–3.00)

Completeness(%) 86.2(85.6)

Redundancy 7.9(8.0)

Average I/σ(I)35.5(2.8)

Rmerge(%)5.0(76.1)

Rwork/Rfree(%)23.4/28.5

r.m.s.d.bonds 0.009

r.m.s.d.angles(°) 1.160

Ramachandran plot(%)

Most favored 95.8

Embodiment 3,

REGgamma native and REGgammaLinker mutant are to the activation experiment of proteasome

Enzyme method of testing alive is carried out after also improving a little the method in the activation experiment of proteasome with reference to the REG described in article " Lysine 188substitutions convert the pattern of proteasome activation by REG γ tothat of REGs α and β " that people's calendar year 2001s such as JunLi, Martin Rechsteiner deliver on the EMBO Journal.

Specific experiment step is as follows:

A. blank adds 40ul assay buffer (50mMTris PH7.5,25mMKCl 10mMNaCl1MgCl ₂).

B. negative contrast adds 30ul assaybuffer, 10ul proteasome (10ug/ml);

C. positive control adds 20ul assay buffer, 10ul REG α (100ug/ml), 10ul proteasome;

D. sample No. 1 group adds 20ul assay buffer, 10ul REGgamma Native (100ug/ml), 10ul proteasome;

E. sample No. 2 groups add 20ul assay buffer, 10ul REGgammaLinker mutant (100ug/ml), 10ul proteasome

F. appealed each composition in 30 degree of mixing 10min, then added two kinds of different substrates with fluorophor respectively: Suc-LLVY-MCA (10ul 375um); Boc-LRR-MCA (10ul 375um)

Concussion 2min, then utilize microplate reader to monitor fluorescence-causing substance over time (excitation wavelength is 360nm, and absorbing wavelength is 460nm) read a numerical value every 6min, one hour terminate experiment.

Proteasomal system plays an important role in the degraded of eukaryotic cell bak protein, and in the regulation and control of cell cycle, transcribe, signal transduction, apoptosis and immunne response aspect all play a part key.And people's source protein enzyme body incitant REGgamma Native of the present invention is a kind of incitant not relying on ubiquitination and ATP, at apoptosis, cancer generation aspect plays an important role.

The present invention constructs a kind of brand-new REGgammaLinker mutant by the means of molecular cloning, the mutant protein obtained by the method easily carries out the growth of crystal, thus its structure can be resolved, as shown in Figure 1, this mutant is 7 aggressiveness, containing 7 REGgammaLinker mutant monomers, thus be that the structure studying REGgamma parent provides theoretical direction.We are by showing functional experiment research of mutant and parent, and as shown in Figure 2, this mutant and parent protein are equally same can the trypsin-like protease activity of activator enzyme body of activator enzyme body.Therefore for we provide certain theoretical basis on the drug development of relevant Therapeutic cancer.

Various experiment reagent consumptive material involved in the present invention and articles for use (include but not limited to: chemical reagent, biological products, cell, instrument etc.) among, special in or not easily obtain those, Wen Zhongjun has indicated manufacturers, reference or detailed preparation method; Without what illustrate, be normal experiment articles for use.Can be obtained very easily by various mode (such as buy, prepare voluntarily).

Claims (3)

1. do not rely on a construction process of people's source protein enzyme body incitant mutant REGgammaLinker of ubiquitin and ATP, comprise the steps:

1st, according to the nucleotide sequence of REGgamma and the linker sequence that adds after replacing 60 to 107 amino acids residues, design two pairs of primers, be respectively:

FP1:GCGAATTCATGGCCTCGTTGCTGAAGTTGGAT，SEQ ID No.2

RP1:GCCTCGAGTCAGTACAGAGCTTCTGCATTGCT, SEQ ID No.3; And

linker1:GGAGCCGTGAGCGCAGGCCTGAAAAGCAACCAGCAG，SEQ ID No.4

linker2:GCCTGCGCTCACGGCTCCGTGGATCTGAGTTAGGTC，SEQ ID No.5；

With the full length nucleotide sequence of REGgamma for template, two pairs of primers are utilized to carry out PCR reaction respectively, the amplification front end fragment of substituted amino acid and rear end fragment, the primer used in two PCR reactions is respectively: the primer pair of FP1 and linker2 composition, the primer pair of RP1 and linker1 composition; By two PCR reactions, the nucleotide sequence before and after linker is cloned respectively;

Utilize the primer pair that FP1 and RP1 forms, carry out PCR using the product be obtained by reacting as template above, obtain the full length nucleotide sequence that linker replaces the REGgamma of 60 to 107 amino acids;

2nd, utilize EcoRI and XhoI to carry out double digestion reaction the PCR primer that the linker obtained in upper step reaction replaces, vector plasmid pGEX-6p-1 also utilizes identical enzyme to carry out double digestion reaction simultaneously, forms identical cohesive terminus to make PCR primer and plasmid; Under the effect of T4 ligase enzyme, the goal gene fragment after being cut by enzyme is connected in the plasmid vector of pGEX-6p-1;

3rd, cut this mutant gene of qualification by enzyme to be connected to after expression vector, and send order-checking company to check order, sequencing result REGgammaLinker mutant sequence, as SEQ ID No.1, is determined to successfully construct.

2. method according to claim 1, it is characterized in that the method also comprises constructed mutant REGgammaLinker and carries out Prokaryotic expression, purification, crystal screening and structure elucidation, concrete steps are as follows:

(1) the recombinant plasmid pGEX-REGgammaLinker, claim 1 built is transformed in expression strain E.coliBL21 DE3;

(2), picking mono-clonal, be inoculated into 5ml and add in 100mg/l Ampicllin antibiotic LB liquid nutrient medium through sterilizing, in 37 DEG C of shaking tables, incubated overnight is after 12 hours, be transferred to 1L and add in 100mg/lAmpicllin antibiotic LB liquid nutrient medium through sterilizing, cultivate about after 4 hours in 37 DEG C of shaking tables, survey its OD and be about 0.7, adding final concentration is that the isopropylthiogalactoside IPTG of 0.5mM makes target protein carry out abduction delivering, the centrifugal 20min of centrifugal 5000rpm after 18 hours is induced to collect thalline at 16 DEG C, the thalline PBS damping fluid Eddy diffusion collected, PBS damping fluid composition is: 137mMNaCl, 2.7mM KCl, 4.3mM Na ₂hPO ₄, 1.4mM KH ₂pO ₄,

(3) the bacterium liquid, suspended is through ultrasonic disruption and utilize high speed centrifugation 18000rpm 45min to carry out centrifugal, supernatant liquor after centrifugal utilizes GST affinity column to carry out preliminary purification, then utilizes PreScission on post, carry out enzyme and cuts thus remove GST label; AKTA protein purification instrument is utilized after the enzyme target protein cut under wash-out concentrates, purifying is carried out through anion-exchange column Resource Q and molecular sieve gel chromatographic column Superdex200 10/300GL, the damping fluid that purifying uses is 20mM Tris, 150mM NaCl, pH8.0, obtains through the pure target protein of electrophoresis detection;

(4), electrophoretically pure REGgammaLinker mutant protein sample is obtained by above purification step, this protein solution is added in Amicon ultrafiltration and concentration pipe, centrifugal concentrating under the rotating speed of 4000rpm, the 150mM NaCl contained in protein solution to be utilized not containing NaCl in concentration process but the identical damping fluid of other components dilutes, reduce the ionic concn in protein solution, make NaCl concentration lower than 10mM, utilize ultraviolet absorption method to measure the concentration of protein;

After protein solution recycling damping fluid after mensuration concentration is diluted to 10mg/ml, utilize hanging drop crystallization method to obtain the crystal of REGgammaLinker mutant protein, crystallization condition is: 0.1M Tris, 19%PEG3350 w/v, 0.2MLi ₂sO ₄, 15%Glycerol, 5% Virahol, pH8.5;

(5), the X ray diffracting data collection step of REGgammaLinker mutant protein crystal is as follows:

The nylon crystal rings of a, first use Hampton Research company, from the crystal soak solution that dehydration is later, obtain the single crystal of suitable X-ray diffraction, and be refrigerated to subzero 150-180 DEG C in the cryogenic nitrogen air-flow using rapidly the cooling system of Oxford Cyrosystem company to produce; Make X-ray by crystal, utilize precession method to collect X ray diffracting data;

B, collect crystal X ray diffracting data after, carry out corresponding data processing and structure elucidation according to following steps:

First using HKL2000 software to process collecting the diffraction data obtained in previous step, obtaining complete data file; Secondly, use the Phaser in CCP4 routine package, utilize Molecular Substitution method, with people's source protein enzyme body incitant REG α of its homology for replacement model carries out molecular replacement to determine its phase place; The structure of REGgammaLinker mutant protein is resolved by PHENIX, COOT software;

(6), the activation experiment of mutant protein to proteasome is detected by the experiment alive of the enzyme of fluorescence small peptide.

3. method according to claim 2, is characterized in that the crystal parameter of obtained REGgammaLinker mutant protein is as follows: