CN102899281B - System for efficiently producing aliphatic acid by escherichia coli and construction method thereof - Google Patents
System for efficiently producing aliphatic acid by escherichia coli and construction method thereof Download PDFInfo
- Publication number
- CN102899281B CN102899281B CN201210376058.7A CN201210376058A CN102899281B CN 102899281 B CN102899281 B CN 102899281B CN 201210376058 A CN201210376058 A CN 201210376058A CN 102899281 B CN102899281 B CN 102899281B
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- puc
- lipid acid
- primer
- fatty acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a system for efficiently producing aliphatic acid by escherichia coli and a construction method and an application thereof. The construction method of the system is characterized by: constructing a fusion protein, wherein the fusion protein comprises one or more of escherichia coli aliphatic acid metabolic pathway key protein FabI, FabG, FabZ, and TesA, and membrane protein Lgt, and one or more of dimer protein selected from GBD Domain, GBD Ligand, SH3Domain, and SH3Ligand; co-expressing the proteins in escherichia coli to position and aggregate the proteins on the cell membrane. According to the invention, by using the system to conduct fermental cultivation, compared with wild type escherichia coli, the yields of escherichia coli and the palmitic acid (C-16) in medium and the yield of total aliphatic acid are significantly increased.
Description
Technical field
The present invention relates to a kind of system and construction process thereof of intestinal bacteria High-efficient Production lipid acid.
Background technology
Along with going from bad to worse of the in short supply and environment of petroleum resources, the demand of environmental protection and renewable energy source is become to more and more urgent, and just head it off well of bioenergy.At present, available commercialization biofuel comprises the alcohols of the short chain that comes from corn and sucrose and comes from rape and the fatty acid methyl ester derivative of animal grease, but these exist biofuel raw material and the conflicting problem of the demand of the mankind own.In order to overcome these restrictions, the best way is to utilize fermentative Production biofuel, mainly comprises alcohols, the hydrocarbon polymer in isoprenoid route of synthesis and the microorganism derivative of fatty acid of short chain.So far, the microorganism of energy production biofuel mainly comprises bacterium, fungi, yeast, micro-algae, but due to the efficient synthetic fatty acid of natural bacterial strain, grease yield is limited, and natural acid mostly is emiocytosis, must, from tissue, cell after separation, just can be applied to production of biodiesel, this procedure relation is to quality, cost and the pollution to environment of biofuel.And compare with natural bacterial strain, it is clear that intestinal bacteria have genetic background, be easy to engineering regulation and control, can high density fermentation, the plurality of advantages such as fast growth, become the desirable recipient bacterium of microorganism catalysis synthesis of chemicals and fuel, in recent years by colibacillary transformation production biofuel has been obtained to certain achievement.Therefore take intestinal bacteria as starting strain herein, utilize genetic engineering means to improve the output of its extracellular fatty acid.
Escherichia coli fatty acid biosynthesizing and regulatory mechanism are studied widely.People have had deep research to colibacillary lipid acid route of synthesis, often the model as type II fatty acid synthetase system colibacillary lipid acid route of synthesis.Intestinal bacteria saturated fatty acid synthetic can be divided into three steps and carry out.The first step is that raw material is synthetic, by malonyl CoA: ACP acyl transferase (FabD) catalysis, is transformed into CoA malonyl CoA ACP by malonyl CoA.Second step is initial action, by β-one acyl ACP synthetic enzyme III (FabH), CoA malonyl CoA ACP and acetyl-CoA is condensed into acetoacetyl ACP.The 3rd step is circulating reaction, has plurality of enzymes catalysis, carries out successively.The acyl carbochain that circulates each time increases by two CH
2group, until form palm acyl ACP.β-one acyl ACP reductase enzyme (FabG) the catalysis β-one acyl ACP reduction that first circulating reaction is relied on by NADPH, generates β-hydroxyl acyl ACP.Then product dehydration, generates trans-2-alkene acyl ACP.This reaction β-hydroxyl acyl ACP dehydratase (FabZ or FabA) catalysis.The final step of circulating reaction is trans-2-alkene acyl ACP reduction, by NADPH, relies on enoyl-ACP reductase (FabI) catalysis, generates acyl ACP.Then start next circulation, CoA malonyl CoA ACP and acyl ACP are condensed into β-one acyl ACP in β-one acyl ACP synthetic enzyme I or II (FabB or FabF), are then reduced successively (FabG), dehydration (FabZ or FabA) and restore (FabI).The synthetic of intestinal bacteria unsaturated fatty acids is to carry out in the following manner: when acyl chain extension to 10 carbon, while forming beta-hydroxy acyl in last of the ten Heavenly stems ACP, this product is through FabA or FabZ dehydration, generate trans-2-decenoyl ACP, because FabA also has isomerase activity, 2-is trans-and decenoyl ACP is simultaneously by isomerization, produce cis-3-decenoyl ACP, this product can not be reduced by FabI, can only be as the substrate of FabB, be condensed into cis-5-beta-keto dodecylene acyl ACP with CoA malonyl CoA ACP, then, this product enters the synthetic circulating reaction of lipid acid, the final palmitoleoyl ACP that produces.
In colibacillus lipid acid route of synthesis; thioesterase gene (TesA) can generate free fatty acids and ACP by catalytic hydrolysis fatty acyl group ACP; feedback inhibition in the synthetic regulation mechanism of fatty acid biological that releasing is caused by acyl ACP, discharges free fatty acids.Related documents is reported in intestinal bacteria and crosses and express endogenous or plant thioesterase gene, can produce free fatty acids.In intestinal bacteria, lipid acid route of synthesis is as follows.
The efficiency of traditional colibacillus lipid acid route of synthesis metabolic reaction is not high.By by the enzymatic polymerization in a pathways metabolism together to improve the efficiency of metabolic reaction, this theory has been proved and has extensively designed and has been applied in multiple shell system, for example DNA skeleton, RNA skeleton and protein skeleton.
Summary of the invention
Intestinal bacteria, produce in lipid acid process, in order better to help product to discharge outside born of the same parents, metabolic reaction is better carried out, the present invention is cascaded by these enzymes escherichia coli fatty acid pathways metabolism key protein FabI, FabZ, FabG and TesA Mouding by membranin on film and by heterodimer according to metabolic sequences, to realize metabolic reaction accelerator.
Technical scheme of the present invention is as follows:
A kind of escherichia coli plasmid system of High-efficient Production lipid acid, described pUC pUC comprises the coding region of the fusion rotein of escherichia coli fatty acid pathways metabolism, described fusion rotein comprises some escherichia coli fatty acid pathways metabolism key proteins, by membranin, those albumen is anchored on film and by heterodimer escherichia coli fatty acid pathways metabolism key protein is cascaded according to metabolic sequences.
Preferably, described escherichia coli fatty acid pathways metabolism key protein is selected from one or more in enzyme FabI, FabG, FabZ, TesA, membranin is membranin Lgt, and heterodimer is selected from one or more of dimer protein GBD Domain, GBD Ligand, SH3 Domain, SH3 Ligand.
A kind of construction process of escherichia coli plasmid system of above-mentioned High-efficient Production lipid acid, by membranin, escherichia coli fatty acid pathways metabolism key protein is anchored on film and by heterodimer described escherichia coli fatty acid pathways metabolism key protein is cascaded according to metabolic sequences, be structured in afterwards and in plasmid, formed pUC pUC, described pUC pUC coexpression in intestinal bacteria made to its location and be gathered on Bacillus coli cells film, obtaining the escherichia coli plasmid system of High-efficient Production lipid acid.
Preferably, build a plurality of pUC pUCs, by those pUC pUCs coexpression in intestinal bacteria.
Preferably, described method also comprises, first, prepares respectively escherichia coli fatty acid pathways metabolism key protein, membranin and heterodimer fragment.
Preferably, described escherichia coli fatty acid pathways metabolism key protein is selected from one or more in enzyme FabI, FabG, FabZ, TesA, membranin is membranin Lgt, and heterodimer is selected from one or more of dimer protein GBD Domain, GBD Ligand, SH3 Domain, SH3 Ligand.
Preferably, the preparation method of described fragment is: take genome of E.coli or rat cdna or mouse cDNA is template, with primer, carries out carrying out overlapping PCR after pcr amplification or pcr amplification again.
A kind of escherichia coli plasmid system of above-mentioned High-efficient Production lipid acid is for the production of the purposes of lipid acid.
A kind of escherichia coli plasmid system of above-mentioned High-efficient Production lipid acid is produced the method for lipid acid, the intestinal bacteria that carry pUC pUC are cultivated in a LB substratum, obtain seed liquor, afterwards this seed liquor is inoculated in another LB substratum and is cultivated, then add inductor to carry out abduction delivering.
Compared with prior art, beneficial effect of the present invention is as follows:
With respect to wild-type e. coli, system of the present invention carries out that lipid acid is synthetic can accelerate metabolic reaction, and significantly promotes the total fatty acid content outside born of the same parents, and the lifting of extracellular fatty acid content can help the fermentation of lipid acid and the simplification of extraction process greatly.
Accompanying drawing explanation
Fig. 1 is the GC-MS collection of illustrative plates that embodiment of the present invention sample 1 carries the Escherichia coli fermentation 24h gained supernatant bacterium liquid of pRSF-A pUC pUC;
Fig. 2 is that embodiment of the present invention sample 1 carries the Escherichia coli fermentation 24h gained supernatant bacterium liquid of pRSF-A pUC pUC and with condition wild-type e. coli, produces the comparison of lipid acid, comprising C-16, C-18 (Fig. 2 A) and total fatty acid content (Fig. 2 B);
Fig. 3 is the GC-MS collection of illustrative plates that embodiment of the present invention sample 1 carries the Escherichia coli fermentation 24h gained lower floor thalline of pRSF-A pUC pUC;
Fig. 4 is that embodiment of the present invention sample 1 carries the Escherichia coli fermentation 24h gained lower floor thalline of pRSF-A pUC pUC and with condition wild-type e. coli, produces the comparison of lipid acid, comprising C-16, C-18 (Fig. 4 A) and total fatty acid content (Fig. 4 B);
Fig. 5 is the GC-MS collection of illustrative plates that another embodiment of the present invention sample 2 carries the Escherichia coli fermentation 24h gained supernatant bacterium liquid of pRSF-A, pET-BD, pACYC-C pUC pUC;
Fig. 6 is that another embodiment of the present invention sample 2 carries the Escherichia coli fermentation 24h gained supernatant bacterium liquid of pRSF-A, pET-BD, pACYC-C pUC pUC and with condition wild-type e. coli, produces the comparison of lipid acid, comprising C-14, C-16, C-17, C-18 (Fig. 6 A) and total fatty acid content (Fig. 6 B);
Fig. 7 is the GC-MS collection of illustrative plates that another embodiment of the present invention sample 2 carries the Escherichia coli fermentation 24h gained lower floor thalline of pRSF-A, pET-BD, pACYC-C pUC pUC;
Fig. 8 is that another embodiment of the present invention sample 2 carries the Escherichia coli fermentation 24h gained lower floor thalline of pRSF-A, pET-BD, pACYC-C pUC pUC and with condition wild-type e. coli, produces the comparison of lipid acid, comprising C-16, C-17, C-18, C-19 (Fig. 6 A) and total fatty acid content (Fig. 6 B).
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be appreciated that, these embodiment are only for the present invention is described, and are not intended to limit the scope of the invention.Those skilled in the art make according to the present invention in actual applications improvement and adjustment, still belong to protection scope of the present invention.
Experimental technique in following examples, if no special instructions, is ordinary method.Test materials used in following embodiment, if no special instructions, is and purchases available from routine biochemistry reagent shop.Percentage composition in following embodiment, if no special instructions, is quality percentage composition.
One, raw material and source:
Duet series plasmid pRSFDuet-1, pETDuet-1 and pACYCDuet-1 that plasmid: Novagen produces, and plasmid pBAD18, plasmid pUC19, wherein plasmid pRSFDuet-1, pETDuet-1 and pACYCDuet-1 are with HpaI, NotI site, BsrGI and XhoI site;
E. coli bl21 (DE3) genotype: (fhuA2[lon] ompT gal (λ DE3) [dcm] Δ hsdS, λ DE3=λ sBamHIo Δ EcoRI-B int::(lacI::PlacUV5::T7gene1) i21 Δ nin5);
FastDigest serial enzymes EcoRI, XbaI, SpeI, PstI and XhoI that restriction enzyme: Fermentas produces; BglII, HpaI, BsrGI, NotI that Tarara company produces.Use its recommendation response system to react.
The KOD – plus-that High fidelity PCR enzyme (primer): TOYOBO produces carries out PCR reaction amplification segment.Use reaction system and the reaction method of its recommendation to react.
LB liquid nutrient medium: 10g sodium-chlor, 10g peptone, 5g yeast powder, adding distil water is settled to 1L;
LB solid medium: add agar in LB liquid nutrient medium, the final concentration that makes agar is 1.5%;
Resistance screening substratum: add respectively various microbiotic mother liquors in LB substratum (liquid or solid), these microbiotic are selected from penbritin, kantlex, paraxin, in this resistance screening substratum, the final concentration of penbritin is that the final concentration of 50 μ g/mL, kantlex is that the final concentration of 50 μ g/mL, paraxin is 68 μ g/mL, wherein
Penbritin mother liquor is: solvent adopts aseptic double-distilled water, and solute is penbritin, and penbritin concentration is 50mg/mL;
Kanamycin mother liquid: solvent is aseptic double-distilled water, solute is kantlex, the concentration of kantlex is 50mg/mL;
Paraxin mother liquor: solvent is dehydrated alcohol, solute is paraxin, the concentration of paraxin is 34mg/mL.
The construction process of the system of intestinal bacteria High-efficient Production lipid acid, mainly comprises
The preparation of the first step, recombination, comprises again the preparation of four small step fragments:
1. the preparation of membranin Lgt, escherichia coli fatty acid pathways metabolism key protein TesA, FabI, FabG, FabZ
The preparation of membranin Lgt: take genome of E.coli as masterplate, with Auele Specific Primer (being formed by Lgt primer 1 and Lgt primer 2), carry out the fragment that pcr amplification obtains membranin Lgt, this fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
Lgt primer 1:
AAAAAAGAATTCTCTAGAGCTGAGGCCGCCGCAAAAGAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGACCAGTAGCTATCTGCATTTT；
Lgt primer 2: GTTCTTCCTGCAGTACTAGTGGAAACGTGTTGCTGTGG.
The preparation of escherichia coli fatty acid pathways metabolism key protein TesA: take genome of E.coli as masterplate, with Auele Specific Primer (being formed by TesA primer 1 and TesA primer 2), carry out the fragment that pcr amplification obtains escherichia coli fatty acid pathways metabolism key protein TesA, this fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
TesA primer 1:
AAAAAAGAATTCTCTAGAGCTGAGGCCGCCGCAAAAGAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGATGAACTTCAACAATGTTTTCCGC；
TesA primer 2:
AAAACTGCAGTACTAGTTTATGAGTCATGATTTACTAAAGGCTGC
The preparation of escherichia coli fatty acid pathways metabolism key protein FabG: take genome of E.coli as masterplate, with Auele Specific Primer (being formed by FabG primer 1 and FabG primer 2), carry out the fragment that pcr amplification obtains FabG, this fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
FabG primer 1:
AAAAAAGAATTCTCTAGAGCTGAGGCCGCCGCAAAAGAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGAATTTTGAAGGAAAAATCGCACTGG；
FabG primer 2:
AAAACTGCAGTACTAGTTCAGACCATGTACATCCCGCCG
The preparation of escherichia coli fatty acid pathways metabolism key protein FabZ: take genome of E.coli as masterplate, with Auele Specific Primer (being formed by FabZ primer 1 and FabZ primer 2), carry out the fragment that pcr amplification obtains FabZ, this fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoRI, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
FabZ primer 1:
AAAAAAGAATTCTCTAGAGCTGAGGCCGCCGCAAAAGAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGACTACTAACACTCATACTCTTCAGATT；
FabZ primer 2: AAAACTGCAGTACTAGTTCAGGCCTCCCGGCTACGA.
The preparation of escherichia coli fatty acid pathways metabolism key protein FabI: take genome of E.coli as masterplate, use respectively FabI primer 1 and FabI mutant primer 2, FabI primer 2 and FabI mutant primer 1, carry out respectively pcr amplification and obtain FabI-1, FabI-2.Take FabI-1 and FabI-2 as template again, with FabI primer 1 and FabI primer 2, carry out overlapping PCR, obtain FabI fragment.FabI fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI, and the FabI gene carrying out after overlapping PCR step sudden change does not contain PstI restriction enzyme site.
FabI primer 1:
AAAAAAGAATTCTCTAGAGCTGAGGCCGCCGCAAAAGAAGCAGCAGCTAAGGAAGCTGCGGCGAAGATGGGTTTTCTTTCCGGTAAGCGC；
FabI primer 2:
AAAACTGCAGTACTAGTTTATTTCAGTTCGAGTTCGTTCATTGCAG
FabI mutant primer 1:GACATCGTTCTTCAGTGCGATGTTGCA;
FabI mutant primer 2:TGCAACATCGCACTGAAGAACGATGTC.
2. the preparation of dimer protein GBD Domain, GBD Ligand
The preparation of dimer protein GBD Domain: take rat cdna as masterplate, with Auele Specific Primer (being formed by GBD Domain primer 1 and GBD Domain primer 2), carry out the fragment that pcr amplification obtains dimer protein GBD Domain, this fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
GBD Domain primer 1:CGGGAATTCTCTAGACTCCAGCGGCGCCGCGT;
GBD Domain primer 2:
AAAACTGCAGTACTAGTTGGTGCTTGCCTTCGGAGTTCAT。
The preparation of dimer protein GBD Ligand: take rat cdna as masterplate, with Auele Specific Primer (being formed by GBD Ligand primer 1 and GBD Ligand primer 2), carry out the fragment that pcr amplification obtains dimer protein GBD Ligand, this fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
GBD Ligand primer 1:
CGGGAATTCTCTAGAGCTGAGGCCGCCGCAAAAGAAGCAGCAGCTAAGGAAGCTGCGGCGAAGCTGGTGGGCGCGCTG；
GBD Ligand primer 2:
AAAACTGCAGTACTAGTATCTTCATCTTCATCGCCCGCCTGATCTTCGC。
3. the preparation of dimer protein SH3 Domain, SH3 Ligand
The preparation of dimer protein SH3 Domain: take mouse cDNA as masterplate, with Auele Specific Primer (being formed by SH3 Domain primer 1 and SH3 Domain primer 2), carry out the fragment that pcr amplification obtains dimer protein GBD Domain, this fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
SH3 Domain primer 1:
CGGGAATTCTCTAGAGCAGAGTATGTGCGGGCCCT；
SH3 Domain primer 2:
AAAACTGCAGTACTAGTATACTTCTCCACGTAAGGGACAGG。
The preparation of dimer protein SH3 Ligand: take mouse cDNA as masterplate, with Auele Specific Primer (being formed by SH3 Ligand primer 1 and SH3 Ligand primer 2), carry out the fragment that pcr amplification obtains dimer protein SH3 Ligand, this fragment the place ahead is with restriction enzyme site and the connection albumen FL3 fragment of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
SH3 Ligand primer 1:
CGGGAATTCTCTAGAGCTGAGGCCGCCGCAAAAGAAGCAGCAGCTAAGGAAGCTGCGGCGAAGCCCCCTCCAGCGCTG；
SH3 Ligand primer 2:
AAAACTGCAGTACTAGTCCGGCGACGTTTTGGCGGCAG。
The preparation of 4.Rbs-DsbAss-Lgt, Rbs-DsbAss-PDZ Domain, Rbs-DsbAss-PDZ Ligand
The preparation of Rbs-DsbAss fragment: take genome of E.coli as masterplate, carry out pcr amplification with Auele Specific Primer (being formed by Rbs-DsbAss primer 1 and Rbs-DsbAss primer 2) and obtain Rbs-DsbAss fragment.
Rbs-DsbAss primer 1:
CGGGAATTCTCTAGAAAAAATAAGGAGGAAAAAAAAATGAAAAAGATTTGGCTGGCG；
Rbs-DsbAss primer 2:
AAGAAGATCTGAATTCTCTAGAAAAAATAAGGAGGAAAAAAAAATGAAAAAGATTTGGC。
The preparation of dimer protein Pdz Domain: take rat cdna as masterplate, carry out pcr amplification with Auele Specific Primer (by PDZ Domain primer 1 and PDZ Domain primer 2) and obtain dimer protein Pdz Domain;
PDZ Domain primer 1:CGATGCGCTAAACGCTAAAAC;
PDZ Domain primer 2:
GTTTTAGCGTTTAGCGCATCGGCGCTCCAGCGGCGCCGCGTGA。
The preparation of dimer protein Pdz Ligand: take rat cdna as masterplate, carry out pcr amplification with Auele Specific Primer (by PDZ Ligand primer 1 and PDZ Ligand primer 2) and obtain dimer protein Pdz Domain;
PDZ Ligand primer 1:
CGGGAATTCTCTAGAGCTGAGGCCGCCGCAAAAGAAGCAGCAGCTAAGGAAGCTGCGGCGAAGCTGGTGGGCGCGCTG；
PDZ Ligand primer 2:
AAAACTGCAGTACTAGTATCTTCATCTTCATCGCCCGCCTGATCTTCGC。
The preparation of Rbs-DsbAss-Lgt fragment: take Rbs-DsbAss fragment and membranin Lgt is template, with Rbs-DsbAss primer 1 and Lgt primer 2, carry out overlapping PCR, obtain Rbs-DsbAss-Lgt fragment, this fragment the place ahead is with the restriction enzyme site of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
Rbs-DsbAss primer 1:
CGGGAATTCTCTAGAAAAAATAAGGAGGAAAAAAAAATGAAAAAGATTTGGCTGGCG；
Lgt primer 2: GTTCTTCCTGCAGTACTAGTGGAAACGTGTTGCTGTGG.
The preparation of Rbs-DsbAss-PDZ Domain fragment: take Rbs-DsbAss fragment and dimer protein Pdz Domain is template, with Rbs-DsbAss primer 1 and Pdz Domain primer 2, carry out overlapping PCR, obtain Rbs-DsbAss-PDZ Domain fragment, this fragment the place ahead is with the restriction enzyme site of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
Rbs-DsbAss primer 1:
CGGGAATTCTCTAGAAAAAATAAGGAGGAAAAAAAAATGAAAAAGATTTGGCTGGCG；
Pdz Domain primer 2:
GTTTTAGCGTTTAGCGCATCGGCGCTCCAGCGGCGCCGCGTGA。
The preparation of Rbs-DsbAss-PDZ Domain fragment: take Rbs-DsbAss fragment and dimer protein Pdz Ligand is template, with Rbs-DsbAss primer 1 and Pdz Domain primer 2, carry out overlapping PCR, obtain Rbs-DsbAss-PDZ Ligand fragment, this fragment the place ahead is with the restriction enzyme site of EcoR I, Xba I, and fragment rear is with the restriction enzyme site of SpeI, PstI.
Rbs-DsbAss primer 1:
CGGGAATTCTCTAGAAAAAATAAGGAGGAAAAAAAAATGAAAAAGATTTGGCTGGCG；
PDZ Domain primer 2:
GTTTTAGCGTTTAGCGCATCGGCGCTCCAGCGGCGCCGCGTGA。
Second step, vector construction, divide again 11 small steps:
1. plasmid pRSF-Ara builds
Step 1. plasmid pRSF-Ara0 builds: with primer site11 and primer site12 amplification plasmid pBAD18, the fragment after amplification is processed with restriction enzyme HpaI and NotI, is cloned into HpaI and the NotI site of plasmid pRSFDuet-1.
Primer site1 1:AAAAGTTAACTTATGACAACTTGACGGCTA;
Primer site1 2:
TTTAGCGGCCGCCTGCAGGAATTCGCTAGCCCAAAAAAACGGGTA。
Step 2. plasmid pRSF-Ara builds: with primer site21 and primer site22 amplification plasmid pBAD18, the fragment after amplification is processed with restriction enzyme BsrGI and XhoI, is cloned into BsrGI and the XhoI site of above-mentioned steps 1 gained plasmid pRSF-Ara0.
Primer site21:AAAATGTACATCCACATTGATTATTTGCACGGCG;
Primer site22:CCGCTCGAGAGATCTGCTAGCCCAAAAAAACGGGTA.
2. plasmid pET-Ara builds
Step 1. plasmid pET-Ara0 builds: with primer site11 and primer site12 (structure is the same) amplification plasmid pBAD18, the fragment after amplification is processed with restriction enzyme HpaI and NotI, is cloned into HpaI and the NotI site of plasmid pETDuet-1.
Step 2. plasmid pET-Ara builds: with primer site21 and primer site22 (structure is the same) amplification plasmid pBAD18, the fragment after amplification is processed with BsrGI and XhoI, is cloned into BsrGI and the XhoI site of plasmid pET-Ara0.
3. plasmid pACYC-Ara builds
Step 1. plasmid pACYC-Ara0 builds: with primer site11 and primer site12 (structure is the same) amplification plasmid pBAD18, the fragment after amplification is processed with HpaI and NotI, is cloned into HpaI and the NotI site of plasmid pACYCDuet-1.
Step 2. plasmid pACYC-Ara builds: with primer site21 and primer site22 amplification plasmid pBAD18, the fragment after amplification is processed with BsrGI and XhoI, is cloned into BsrGI and the XhoI site of plasmid pACYC-Ara0.
4. plasmid pUC19A builds
Step 1. plasmid pUC19A-1 builds: with restriction enzyme EcoRI and PstI, process the escherichia coli fatty acid pathways metabolism key protein TesA that the first small step obtains, be cloned into EcoRI and the PstI site of plasmid pUC19.
Step 2. plasmid pUC19A-2 builds: with restriction enzyme EcoRI and SpeI, process the dimer protein SH3 Domain that the first small step obtains, be cloned into EcoRI and the XbaI site of plasmid pUC19A-1.
Step 3. plasmid pUC19A builds: with restriction enzyme EcoRI and SpeI, process the Rbs-DsbAss-Lgt fragment that the first small step obtains, be cloned into EcoRI and the XbaI site of plasmid pUC19A-2.
5. plasmid pUC19B builds
Step 1. plasmid pUC19B-1 builds: with restriction enzyme EcoRI and PstI, process the escherichia coli fatty acid pathways metabolism key protein FabG that the first small step obtains, be cloned into EcoRI and the PstI site of plasmid pUC19.
Step 2. plasmid pUC19B-2 builds: with restriction enzyme EcoRI and SpeI, process dimer protein SH3 Ligand, be cloned into EcoRI and the XbaI site of plasmid pUC19B-1.
Step 3. plasmid pUC19B-3 builds: with restriction enzyme EcoRI and SpeI, process the membranin Lgt that the first small step obtains, be cloned into EcoRI and the XbaI site of plasmid pUC19B-2.
Step 4. plasmid pUC19B builds: with restriction enzyme EcoRI and SpeI, process Rbs-DsbAss-PDZ Ligand fragment, be cloned into EcoRI and the XbaI site of plasmid pUC19B-3.
6. plasmid pUC19C builds
Step 1. plasmid pUC19C-1 builds: with restriction enzyme EcoRI and PstI, process escherichia coli fatty acid pathways metabolism key protein FabI, be cloned into EcoRI and the PstI site of plasmid pUC19.
Step 2. plasmid pUC19C-2 builds: with restriction enzyme EcoRI and SpeI, process dimer protein GBD Domain, be cloned into EcoRI and the XbaI site of plasmid pUC19C-1.
Step 3. plasmid pUC19C-3 builds: with restriction enzyme EcoRI and SpeI, process membranin Lgt, be cloned into EcoRI and the XbaI site of plasmid pUC19C-2.
Step 4. plasmid pUC19C builds: with restriction enzyme EcoRI and SpeI, process Rbs-DsbAss-PDZ Domain fragment, be cloned into EcoRI and the XbaI site of plasmid pUC19C-3.
7. plasmid pUC19D builds
Step 1. plasmid pUC19D-1 builds: with restriction enzyme EcoRI and PstI, process escherichia coli fatty acid pathways metabolism key protein FabZ, be cloned into EcoRI and the PstI site of plasmid pUC19.
Step 2. plasmid pUC19D-2 builds: with restriction enzyme EcoRI and SpeI, process dimer protein GBD-Ligand, be cloned into EcoRI and the XbaI site of plasmid pUC19D-1.
Step 3. plasmid pUC19D builds: with restriction enzyme EcoRI and SpeI, process Rbs-DsbAss-Lgt fragment, be cloned into EcoRI and the XbaI site of plasmid pUC19D-2.
8. plasmid pRSF-A builds
With restriction enzyme EcoRI and PstI, process the above-mentioned 4 plasmid pUC19A that obtain, reclaim the fragment DsbAss-Lgt-SH3 Domain-TesA (seeing the sequence 1 of sequence table) of about 1900bp, be cloned into EcoRI and the PstI site of the above-mentioned 1 plasmid pRSF-Ara obtaining.
9. plasmid pET-B builds
With restriction enzyme EcoRI and PstI, process the above-mentioned 5 plasmid pUC19B that obtain, reclaim the fragment DsbAss-PDZ Ligand-Lgt-SH3 Ligand-FabG (seeing the sequence 2 of sequence table) of about 1900bp, be cloned into EcoRI and the PstI site of the above-mentioned 1 plasmid pET-Ara obtaining.
10. plasmid pET-BD builds
With Rbs-DsbAss primer 1 and the primer XhoI above-mentioned 7 plasmid pUC19D that obtain that increase, obtain fragment DsbAss-Lgt-GBD-Ligand-FabZ (seeing the sequence 3 of sequence table), then with restriction enzyme BglII and XhoI, process, be cloned into BglII and the XhoI site of the above-mentioned 9 plasmid pET-B that obtain.
Rbs-DsbAss primer 1:
CGGGAATTCTCTAGAAAAAATAAGGAGGAAAAAAAAATGAAAAAGATTTGGCTGGCG；
Primer XhoI:
AAAACTCGAGTTATTTCAGTTCGAGTTCGTTCATTGCAG。
11. plasmid pACYC-C build
With restriction enzyme EcoRI and PstI, process the above-mentioned 5 plasmid pUC19B that obtain, reclaim the fragment DsbAss-PDZ Domain-Lgt-GBD Domain-FabI (seeing the sequence 4 of sequence table) of about 2000bp, be then cloned into EcoRI and the PstI site of the above-mentioned 3 plasmid pACYC-Ara that obtain.
The acquisition of the 3rd step, expression strain, comprises two embodiment (sample 1 and sample 2)
Sample 1: the small step of second step 8 gained plasmid pRSF-A are proceeded in e. coli bl21 (DE3), by band kantlex antibiotics resistance screening culture medium (LB solid medium), cultivate 14 hours, acquisition is with the intestinal bacteria of plasmid pRSF-A, and mono-clonal 1.
The control group of sample 1: plasmid pRSFDuet-1 is proceeded in e. coli bl21 (DE3), cultivate 14 hours by band kantlex antibiotics resistance screening culture medium (LB solid medium), obtain the intestinal bacteria with plasmid pRSFDuet-1.
Sample 2: the small step of second step 8 gained plasmid pRSF-A, small step 10 gained plasmid pET-BD, small step 11 gained plasmid pACYC-C are proceeded to e. coli bl21 (DE3), by band penbritin, kantlex, chlorampenicol resistant screening culture medium (LB solid medium), cultivate 14 hours, acquisition is with the intestinal bacteria of plasmid pRSF-A, pET-BD, pACYC-C, and mono-clonal 2.
The control group of sample 2: plasmid pRSFDuet-1, pETDuet-1, pACYCDuet-1 are proceeded to e. coli bl21 (DE3), by band penbritin, kantlex, chlorampenicol resistant screening culture medium (LB solid medium), cultivate 14 hours, obtain the intestinal bacteria with plasmid pRSFDuet-1, pETDuet-1, pACYCDuet-1.
The mensuration (application examples) of the 4th step, strain fermentation and lipid acid
Strain fermentation
1, the fresh mono-clonal 1 that above-mentioned the 3rd step of picking obtains and mono-clonal 2 are respectively at 5ml LB liquid nutrient medium, and incubated overnight, obtains seed liquor;
2, by 3% volume ratio, above-mentioned seed liquor is seeded to respectively in LB liquid/solid substratum, shaking table is cultured to about 0D600=0.6, then add respectively the Arabic Tang of inductor L-, making its final concentration is 0.2% (W/L), add inductor to carry out abduction delivering, continue to cultivate 24h, obtain the product of intestinal bacteria High-efficient Production lipid acid, every part of 10ml, the centrifugal above-mentioned product of difference, and collect respectively supernatant Jun Yehe lower floor thalline.
The strain fermentation process of two groups of control groups is the same.
The mensuration of lipid acid, each sample test program is identical, and the wherein one group of sample 1 of take is example:
1, the sample obtaining in above-mentioned steps is equal-volume solvent (chloroform: methyl alcohol=2:1) extraction is three times, and stratification, takes off a layer organic layer, and evaporate to dryness obtains supernatant liquor crude extract, i.e. lipid acid for 1 supernatant bacterium liquid;
Supernatant liquor crude extract (lipid acid) is used to 1ml dissolve with methanol, add 2ml tetrafluoride boron, 60 ℃ are carried out esterification reaction of organic acid, after reactant is cooling, add 2ml normal hexane, and oscillation extraction twice is collected upper strata normal hexane phase evaporate to dryness, obtains fatty acid methyl ester.
2, sample 1 lower floor's thalline 4ml ddH obtained above
2o suspends evenly, then adds 20ml chloroform methanol extraction agent, extracting twice, and stratification, takes off a layer organic layer, and evaporate to dryness obtains thalline crude extract, i.e. lipid acid.Thalline crude extract is added to 1mL extraction agent (chloroform: vortex vibration methyl alcohol=2:1), the total fat of extracting cell, then use 2mL saponification reagent (methyl alcohol: water=4:1, containing 20g/L NaOH), carry out saponification reaction, according to above-mentioned 1 method, carry out esterification reaction of organic acid again, obtain fatty acid methyl ester.
The control group of the control group of sample 1, sample 1, sample 2, sample 2 is all carried out to the operation of above-mentioned 1 and 2 liang of step, obtain four groups of totally 8 samples.
3, the n-hexane dissolution of same volume for 8 samples obtained above (the supernatant Jun Yehe lower floor thallus extracts of two experimental group, two control groups), and to add methyl myristate be object of reference, in each sample solution, get afterwards 1ml and carry out GC-MS test.
GC-MS test condition: sampler temperature: 250 ℃, detector temperature: 280 ℃; Temperature programming: initial 100 ℃, continue 2min, 10 ℃/min is warming up to 250 ℃, keeps 5min.Dependence test the results are shown in accompanying drawing 1-accompanying drawing 8.
Referring to Fig. 1, GC-MS collection of illustrative plates for sample 1 (carrying the intestinal bacteria of pRSF-A pUC pUC) fermentation 24h gained supernatant bacterium liquid, as seen from Figure 1, the lipid acid of producing in sample 1 supernatant bacterium liquid mainly comprises C16 and C18, also has in addition a small amount of C17 and C19.Fig. 2 is that sample 1 (carries the intestinal bacteria of pRSF-A pUC pUC, i.e. experimental group in figure) fermentation 24h gained supernatant bacterium liquid and sample 1 control group (producing lipid acid with the condition wild-type e. coli) comparison of supernatant bacterium liquid of 24h of fermenting, comparison comprising C16, C18 (Fig. 2 A) and total fatty acid content (Fig. 2 B) with respect to original bacterium, wherein in sample 1 (being experimental group), C16 content is 0.39mg/ (OD*L), C18 is 0.29mg/ (OD*L), and C16 content is 0.27mg/ (OD*L) in sample 1 control group (being wild-type), C18 is 0.24mg/ (OD*L); In sample 1 (being experimental group), total fatty acid content is 0.71mg/ (OD*L), and in sample 1 control group (being wild-type), total fatty acid content is 0.54mg/ (OD*L).Can find out that the intestinal bacteria of preparing according to the inventive method produce that in the supernatant bacterium liquid of lipid acid, fatty acid content is apparently higher than lipid acid that wild-type e. coli is produced, system of the present invention has advantages of High-efficient Production lipid acid.
Referring to Fig. 3, GC-MS collection of illustrative plates for sample 1 (carrying the intestinal bacteria of pRSF-A pUC pUC) fermentation 24h gained lower floor thalline, as seen from Figure 3, the lipid acid of producing in sample 1 lower floor's thalline mainly comprises C16 and C18, also has in addition C14, C17 and C19.Fig. 4 is that sample 1 (carries the intestinal bacteria of pRSF-A pUC pUC, i.e. experimental group in figure) fermentation 24h gained lower floor's thalline and sample 1 control group (producing lipid acid with the condition wild-type e. coli) comparison of lower floor's thalline of 24h of fermenting, comparison diagram comprising C16, C18 (Fig. 4 A) and total fatty acid content (Fig. 4 B) with respect to original bacterium, wherein in sample 1 (being experimental group), C16 content is 12.27mg/ (OD*L), C18 is 7.23mg/ (OD*L), and C16 content is 8.68mg/ (OD*L) in sample 1 control group (being wild-type), C18 is 6.08mg/ (OD*L); In sample 1 (being experimental group), total fatty acid content is 19.44mg/ (OD*L), and in sample 1 control group (being wild-type), total fatty acid content is 14.72mg/ (OD*L).Can find out that the intestinal bacteria of preparing according to the inventive method produce that in lower floor's thalline of lipid acid, fatty acid content is apparently higher than lipid acid that wild-type e. coli produces, system of the present invention has advantages of High-efficient Production lipid acid.
Referring to Fig. 5, GC-MS collection of illustrative plates for sample 2 (carrying the intestinal bacteria of pRSF-A, pET-BD, pACYC-C pUC pUC) fermentation 24h gained supernatant bacterium liquid, as seen from Figure 5, the lipid acid of producing in sample 2 supernatant bacterium liquid mainly comprises C14, C16, C17 and C18, also has in addition a small amount of C12.Fig. 6 is the comparison of the supernatant bacterium liquid (i.e. wild-type in figure) of sample 2 (carrying the intestinal bacteria of pRSF-A pUC pUC) fermentation 24h gained supernatant bacterium liquid (i.e. experimental group in figure) and sample 1 control group (producing lipid acid with condition wild-type e. coli), comprising C14, C16, C17, C18 (Fig. 6 A) and total fatty acid content (Fig. 6 B) are with respect to the contrast of original bacterium, wherein in sample 2 (being experimental group), the content of C14 is 1.17mg/ (OD*L), C16 content is 4.27mg/ (OD*L), the content of C17 is 1.29mg/ (OD*L), C18 is 2.75mg/ (OD*L), and the content of C14 is 0.02mg/ (OD*L) in sample 2 control groups (being wild-type), C16 content is 0.21mg/ (OD*L), the content of C17 is 0.04mg/ (OD*L), C18 is 0.15mg/ (OD*L), in sample 2 (being experimental group), total fatty acid content is 9.96mg/ (OD*L), and in sample 1 control group (being wild-type), total fatty acid content is 0.41mg/ (OD*L).Can find out that in the colibacillary supernatant bacterium liquid of preparing according to the inventive method, fatty acid content is apparently higher than lipid acid that wild-type e. coli is produced, system of the present invention has advantages of High-efficient Production lipid acid.
Referring to Fig. 7, GC-MS collection of illustrative plates for sample 2 (carrying the intestinal bacteria of pRSF-A, pET-BD, pACYC-C pUC pUC) fermentation 24h gained lower floor thalline, as seen from Figure 7, the lipid acid of producing in sample 2 lower floor's thalline mainly comprises C16, C17, C18 and C19, also has in addition C12 and C14.Fig. 8 is that sample 2 (carries pRSF-A, pET-BD, the comparison of the intestinal bacteria of pACYC-C pUC pUC) producing lipid acid in lower floor's thalline of fermentation 24h gained lower floor's thalline (i.e. experimental group in figure) and sample 1 control group (with condition wild-type e. coli), comprising C16, C17, C18 and C19 (Fig. 8 A) and total fatty acid content (Fig. 8 B) are with respect to the comparison diagram of original bacterium, wherein in sample 2 (being experimental group), C16 content is 9.97mg/ (OD*L), the content of C17 is 2.76mg/ (OD*L), C18 is 5.79mg/ (OD*L), C19 is 0.58mg/ (OD*L), and C16 content is 2.46mg/ (OD*L) in sample 2 control groups (being wild-type), the content of C17 is 1.64mg/ (OD*L), C18 is 0.55mg/ (OD*L), C19 is 1.00mg/ (OD*L), in sample 2 (being experimental group), total fatty acid content is 18.33mg/ (OD*L), and in sample 1 control group (being wild-type), total fatty acid content is 5.38mg/ (OD*L).Can find out that in the colibacillary lower floor thalline of preparing according to the inventive method, fatty acid content is apparently higher than lipid acid that wild-type e. coli produces, system of the present invention has advantages of High-efficient Production lipid acid.And, Fig. 7, Fig. 8 and Fig. 5, Fig. 6 contrast can be found, in lower floor's thalline of sample 2, the lifting amplitude of lipid acid output is less than lifting amplitude in bacterium liquid, illustrates that native system is conducive to the outer row of lipid acid.
Above combination specific embodiments of the invention have been described in detail the present invention, but the present invention is not limited only to the mode of above-described embodiment, and any employing is equal to replaces and embodiment and scheme that simple deformation mode obtains, all in protection scope of the present invention.
Claims (9)
1. the intestinal bacteria of a High-efficient Production lipid acid, it is characterized in that, these intestinal bacteria carry pUC pUC, described pUC pUC comprises the coding region of the fusion rotein of escherichia coli fatty acid pathways metabolism, described fusion rotein comprises some escherichia coli fatty acid pathways metabolism key proteins, by membranin, those albumen is anchored on film and by heterodimer escherichia coli fatty acid pathways metabolism key protein is cascaded according to metabolic sequences.
2. the intestinal bacteria of High-efficient Production lipid acid as claimed in claim 1, it is characterized in that, described escherichia coli fatty acid pathways metabolism key protein is selected from one or more in enzyme FabI, FabG, FabZ, TesA, membranin is membranin Lgt, and heterodimer is selected from one or more of dimer protein GBD Domain, GBD Ligand, SH3Domain, SH3Ligand.
3. the colibacillary construction process of the High-efficient Production lipid acid described in a claim 1 or 2, it is characterized in that, by membranin, escherichia coli fatty acid pathways metabolism key protein is anchored on film and by heterodimer described escherichia coli fatty acid pathways metabolism key protein is cascaded according to metabolic sequences, be structured in afterwards and in plasmid, formed pUC pUC, described pUC pUC coexpression in intestinal bacteria made to its location and be gathered on Bacillus coli cells film, obtaining the escherichia coli plasmid system of High-efficient Production lipid acid.
4. the colibacillary construction process of High-efficient Production lipid acid as claimed in claim 3, is characterized in that, builds a plurality of pUC pUCs, by those pUC pUCs coexpression in intestinal bacteria.
5. the colibacillary construction process of High-efficient Production lipid acid as claimed in claim 3, is characterized in that, described method also comprises, first, prepares respectively escherichia coli fatty acid pathways metabolism key protein, membranin and heterodimer fragment.
6. the colibacillary construction process of High-efficient Production lipid acid as claimed in claim 5, it is characterized in that, described escherichia coli fatty acid pathways metabolism key protein is selected from one or more in enzyme FabI, FabG, FabZ, TesA, membranin is membranin Lgt, and heterodimer is selected from one or more of dimer protein GBD Domain, GBD Ligand, SH3Domain, SH3Ligand.
7. the colibacillary construction process of High-efficient Production lipid acid as claimed in claim 6, it is characterized in that, the preparation method of described fragment is: take genome of E.coli or rat cdna or mouse cDNA is template, with primer, carries out carrying out overlapping PCR after pcr amplification or pcr amplification again.
8. the intestinal bacteria of the High-efficient Production lipid acid described in a claim 1 or 2 are for the production of the purposes of lipid acid.
9. the method that the intestinal bacteria of the High-efficient Production lipid acid described in a right to use requirement 1 or 2 produce lipid acid, it is characterized in that, the intestinal bacteria that carry pUC pUC are cultivated in a LB substratum, obtain seed liquor, afterwards this seed liquor is inoculated in another LB substratum and is cultivated, then add inductor to carry out abduction delivering.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210376058.7A CN102899281B (en) | 2012-09-28 | 2012-09-28 | System for efficiently producing aliphatic acid by escherichia coli and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210376058.7A CN102899281B (en) | 2012-09-28 | 2012-09-28 | System for efficiently producing aliphatic acid by escherichia coli and construction method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102899281A CN102899281A (en) | 2013-01-30 |
| CN102899281B true CN102899281B (en) | 2014-10-15 |
Family
ID=47571771
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210376058.7A Active CN102899281B (en) | 2012-09-28 | 2012-09-28 | System for efficiently producing aliphatic acid by escherichia coli and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102899281B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108753809B (en) * | 2018-06-06 | 2021-08-17 | 上海交通大学 | Recombinant blue algae for efficiently expressing fatty acid and preparation method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250517A (en) * | 2007-10-24 | 2008-08-27 | 侯玥 | Expression of human cardiac muscle type fatty acid binding proteins in bacillus coli DH5 alpha and purification |
| WO2011132854A2 (en) * | 2010-04-22 | 2011-10-27 | 서강대학교 산학협력단 | Heterogeneous e. coli for improving fatty acid content using fatty acid biosynthesis and preparation method thereof |
-
2012
- 2012-09-28 CN CN201210376058.7A patent/CN102899281B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250517A (en) * | 2007-10-24 | 2008-08-27 | 侯玥 | Expression of human cardiac muscle type fatty acid binding proteins in bacillus coli DH5 alpha and purification |
| WO2011132854A2 (en) * | 2010-04-22 | 2011-10-27 | 서강대학교 산학협력단 | Heterogeneous e. coli for improving fatty acid content using fatty acid biosynthesis and preparation method thereof |
Non-Patent Citations (3)
| Title |
|---|
| Microbial production of fatty-acid-derived fuels and chemicals from plant biomass;STEEN J E, KANG Y, BOKINSKY G, et al;《nature》;20101231;第463卷;559－562 * |
| STEEN J E, KANG Y, BOKINSKY G, et al.Microbial production of fatty-acid-derived fuels and chemicals from plant biomass.《nature》.2010,第463卷559－562. |
| 孟 鑫，等.工程大肠杆菌脂肪酸胞外分泌调控研究进展.《食品科学 》.2011,第32卷(第5期),331－335. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102899281A (en) | 2013-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li et al. | Large‐scale biodiesel production from microalga Chlorella protothecoides through heterotrophic cultivation in bioreactors | |
| Wen et al. | Enhanced solvent production by metabolic engineering of a twin-clostridial consortium | |
| Tang et al. | Industrial biotechnology: tools and applications | |
| Chen et al. | Biomass and lipid production of heterotrophic microalgae Chlorella protothecoides by using biodiesel-derived crude glycerol | |
| Zhao et al. | Lipid production from Jerusalem artichoke by Rhodosporidium toruloides Y4 | |
| Quarterman et al. | A survey of yeast from the Yarrowia clade for lipid production in dilute acid pretreated lignocellulosic biomass hydrolysate | |
| CN102482676A (en) | Product of fatty acid esters from biomass polymers | |
| CN105838657A (en) | Production of fatty acids and derivatives thereof | |
| CN102216463A (en) | Ethanol production by microorganisms | |
| CN101802208A (en) | Reduction of the toxic effect of impurities from raw materials by extractive fermentation | |
| JP2014513964A5 (en) | ||
| US20150125933A1 (en) | Production of fatty acids and derivatives thereof having improved aliphatic chain length and saturation characteristics | |
| CN102586350A (en) | Production method for C8:0/C10:0/C12:0/C14:0 medium-chain fatty acid and ethyl ester thereof | |
| CN103080305A (en) | Production of biodiesel by yeast from lignocellulose and glycerol | |
| CN106574238A (en) | Microbial production of fatty diols | |
| Fan et al. | Synthesis of medium chain length fatty acid ethyl esters in engineered Escherichia coli using endogenously produced medium chain fatty acids | |
| CN107548418A (en) | Separation and the method for purifying ambrox | |
| CN101748069A (en) | recombinant blue-green algae | |
| Su et al. | Progress and perspective of biosynthetic platform for higher-order biofuels | |
| CN111088175A (en) | Yarrowia lipolytica for producing bisabolene and construction method and application thereof | |
| CN104726477A (en) | Lipase coding gene and engineering strain thereof | |
| CN102899281B (en) | System for efficiently producing aliphatic acid by escherichia coli and construction method thereof | |
| Ghim et al. | Synthetic biology for biofuels: building designer microbes from the scratch | |
| MX2012010341A (en) | Methods, biological oils, biofuels, units, and organisms related to use in compression engines. | |
| CN103194419B (en) | Microorganism and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |