CN102898524A - Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof - Google Patents
Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof Download PDFInfo
- Publication number
- CN102898524A CN102898524A CN2011102095021A CN201110209502A CN102898524A CN 102898524 A CN102898524 A CN 102898524A CN 2011102095021 A CN2011102095021 A CN 2011102095021A CN 201110209502 A CN201110209502 A CN 201110209502A CN 102898524 A CN102898524 A CN 102898524A
- Authority
- CN
- China
- Prior art keywords
- chimeric antibody
- people
- human
- mouse
- mouse chimeric
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention provides a human-mouse chimeric antibody of an anti-human tumor necrosis factor related apoptosis-inducing ligand (TRAIL) receptor DR5, a preparation method and uses thereof. Specifically the present invention relates to a human-mouse chimeric antibody of an anti-human TRAIL receptor extracellular region, wherein the human-mouse chimeric antibody comprises a variable region of a mouse antibody IgG and a constant region of a human antibody IgG. The present invention further relates to a stable cell line expressing the human-mouse chimeric antibody of the anti-human TRAIL receptor extracellular region, a recombinant eukaryotic expression vector for stably expressing the human-mouse chimeric antibody, a method for preparing the human-mouse chimeric antibody, and uses of the human-mouse chimeric antibody and a composition thereof. The human-mouse chimeric antibody provides good affinity for the DR5 extracellular region, provides special apoptosis-inducing activity for tumor cells, can be used separately or be combined with other drugs, and can be used for treatments of a plurality of tumors and other DR5 related diseases.
Description
Technical field
The present invention relates to a kind of anti-human tumor necrosin relative death inducing ligand (tumor necrosis factor-related apoptosis-inducing ligand, TRAIL) acceptor (death receptor 5, people-mouse chimeric antibody DR5), efficiently express this antibody carrier for expression of eukaryon, produce this antibody stable cell line, prepare the method for described people-mouse chimeric antibody and the purposes of described people-mouse chimeric antibody and composition thereof.
Background technology
Death receptor 5 (death receptor 5, DR5) be tumor necrosin relative death inducing ligand (tumor necrosis factor related apoptosis-inducing ligand, TRAIL) acceptor, its intracellular region contains death domain.DR5 effective activating cells apoptotic signal transduction pathway after native ligand TRAIL is combined causes necrocytosis.Early-stage Study proves, the monoclonal antibody of the functional anti-DR5 in mouse source can induce the kinds of tumor cells of vitro culture dead, energy establishment tumor growth in the body, and normal tissue and cell do not have toxicity (Guo Y et al., A novel anti-human DR5 monoclonal antibody with tumoricidal activity induces caspase-dependent and caspase-independent cell death J Biol Chem 2005; 280 (51): 41940-52).But, utilize this monoclonal antibody of hybridoma technology preparation for the heteroimmunity sphaeroprotein in mouse source, be directly used in the treatment of human tumor, may cause human antimouse antibody (human anti-mouse antibody, HAMA) reaction weakens its result for the treatment of and human body is produced deleterious effect.
Therefore, mouse source antibody is modified transformation, reducing its immunogenicity to human body is the necessary ways that described antibody are successfully applied to pharmaceutical applications.Common mouse source antibody rebuilding approach comprises chimeric and humanization.People-mouse chimeric antibody is to utilize genetic engineering technique that the variable region of mouse antibody is connected with the constant region of human antibody, be built into complete chimeric antibody, can be on the basis that keeps former monoclonal antibody specificity and avidity, reduce the human antimouse antibody reaction, prolong its transformation period and improve pharmacokinetic properties.
Mammalian cell expression system can efficiently produce has the complete antibody molecule that correct folding, assembling, space conformation and good biological are learned effect, be the optimal expression system of chimeric antibody, and the selection of the structure of carrier for expression of eukaryon and host cell is extremely important to the expression level of chimeric antibody.Desirable carrier for expression of eukaryon needs strong promotor and suitable screening sign, both has been conducive to the amplification of gene itself, can be used as again the screening of positive cell.
Therefore, technical problem of the present invention is to utilize the chimeric antibody technology to prepare anti-DR5 people-mouse chimeric antibody.
Summary of the invention
Therefore, technical purpose of the present invention is to provide the people of a kind of anti-human tumor necrosin relative death inducing ligand (TRAIL) acceptor (DR5)-mouse inosculating antibody.
Therefore, a first aspect of the present invention relates to a kind of people-mouse chimeric antibody of anti-human tumor necrosin relative death inducing ligand acceptor extracellular region, it is characterized in that the light chain of described chimeric antibody and the aminoacid sequence of variable region of heavy chain comprise variable region of heavy chain (VH) aminoacid sequence shown in variable region of light chain (VL) aminoacid sequence shown in the SEQ ID NO:1 and the SEQ ID NO:2, the constant region of the constant region behaviour antibody of described chimeric antibody.
Preferably, the CH of described chimeric antibody is human IgG1's constant region, constant region of light chain behaviour κ chain.
Preferably, variable region of light chain CDR1, the CDR2 of described chimeric antibody and the aminoacid sequence of CDR3 are respectively:
24 of CDR1 to 39 amino acids: RSSQSLVHSNGNTYLH (SEQ ID NO:3);
55 of CDR2 to 61 amino acids: KVSNRFS (SEQ ID NO:4);
94 of CDR3 to 102 amino acids: FQSTHVPHT (SEQ ID NO:5); And/or
Variable region of heavy chain CDR11, the CDR22 of described chimeric antibody and the aminoacid sequence of CDR33 are respectively:
31 of CDR11 to 35 amino acids: DFSMN (SEQ ID NO:6);
55 of CDR22 to 66 amino acids: WINTETGEPTYADDFKG (SEQ ID NO:7);
99 of CDR33 to 101 amino acids: IDY (SEQ ID NO:8).
Most preferably, described chimeric antibody is the stable cell line expression of CGMCC No.4938 by the preserving number that was deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on June 15th, 2011, called after Zaptuximab.
A second aspect of the present invention relates to the stable cell lines of the people-mouse chimeric antibody of the anti-human tumor necrosin relative death inducing ligand acceptor of strain stably express extracellular region, specific name is the anti-DR5 people of stably express-mouse chimeric antibody Chinese hamster ovary celI strain, be deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) on June 15th, 2011, preserving number is CGMCC No.4938.
A third aspect of the present invention relates to the recombinant eukaryon expression vector of the people-mouse chimeric antibody of a kind of stably express such as the described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of first aspect present invention, it is characterized in that described recombinant eukaryon expression vector is with CAG strong promoter and Tetrahydrofolate dehydrogenase selection markers, from the monoclonal antibody variable region of heavy chain of mouse-anti people DR5 and the encoding sequence of variable region of light chain, the sequence of human IgG1's CH and constant region of light chain κ chain and the Furin/2A sequence with self splicing function that adds between heavy chain and light chain are effectively connected to efficiently express described people-mouse chimeric antibody, preferably, the initial plasmid of described recombinant eukaryon expression vector is pCDNA3, preferably, the monoclonal antibody of described mouse-anti people DR5 is AD5-10 (Guo Y et al., A novel anti-human DR5 monoclonal antibody with tumoricidal activity induces caspase-dependent and caspase-independent cell death J Biol Chem 2005; 280 (51): 41940-52).
Preferably, from the sequence that couples together of the sequence of encoding sequence, human IgG1's CH and the constant region of light chain κ chain of the monoclonal antibody variable region of heavy chain of mouse-anti people DR5 and variable region of light chain and the Furin/2A sequence with self splicing function that between heavy chain and light chain, adds shown in SEQ ID NO:9.
A fourth aspect of the present invention relates to a kind of method for preparing such as the people-mouse chimeric antibody of the described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of first aspect present invention, it is characterized in that may further comprise the steps:
A) usefulness is such as the recombinant eukaryon expression vector transfection CHO-dhfr of the people-mouse chimeric antibody of the described stably express of third aspect present invention such as the described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of first aspect present invention
-Cell;
B) utilize methotrexate pressurization screening to obtain the cell strain of stably express chimeric antibody.
A fifth aspect of the present invention relates to a kind of stable cell line that obtains such as the described method of fourth aspect present invention.
A sixth aspect of the present invention relates to a kind of composition, its activeconstituents is to form such as the people-mouse chimeric antibody of the described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of first aspect present invention and chemotherapeutics, preferably, described chemotherapeutics is TRAIL or epirubicin.
A seventh aspect of the present invention relates to such as the people-mouse chimeric antibody of the described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of first aspect present invention, such as the recombinant eukaryon expression vector of the people-mouse chimeric antibody of the described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of the described stably express first aspect present invention of third aspect present invention or according to the purposes of the described composition of sixth aspect present invention in the medicine of preparation treatment tumour, preferably, described tumour is leukemia, liver cancer, colorectal carcinoma or lung cancer.
In other words, in order to finish purpose of the present invention, the invention provides a kind of people-mouse chimeric antibody, the aminoacid sequence of its light chain and variable region of heavy chain comprises the aminoacid sequence of the variable region of heavy chain (VH) of the aminoacid sequence of variable region of light chain (VL) of SEQ ID NO:1 and SEQ ID NO:2.
Variable region of light chain CDRL1, the CDRL2 of described chimeric antibody and the aminoacid sequence of CDRL3 are respectively:
CDRL1 (24 to 39 amino acids): RSSQSLVHSNGNTYLH (SEQ ID NO:3),
CDRL2 (55 to 61 amino acids): KVSNRFS (SEQ ID NO:4),
CDRL3 (94 to 102 amino acids): FQSTHVPHT (SEQ ID NO:5),
Variable region of heavy chain CDRH1, the CDRH2 of described chimeric antibody and the aminoacid sequence of CDRH3 are respectively:
CDRH1 (31 to 35 amino acids): DFSMN (SEQ ID NO:6),
CDRH2 (50 to 66 amino acids): WINTETGEPTYADDFKG (SEQ ID NO:7),
CDRH3 (99 to 101 amino acids): IDY (SEQ ID NO:8).
The present invention also provides a kind of preparation method of people-mouse chimeric antibody of anti-DR5 extracellular region, and the light chain of this chimeric antibody and the aminoacid sequence of variable region of heavy chain comprise the aminoacid sequence of the variable region of heavy chain (VH) of the aminoacid sequence of variable region of light chain (VL) of SEQ ID NO:1 and SEQ ID NO:2.Its constant region of light chain behaviour κ chain, the CH hypotype is the human IgG1.The method may further comprise the steps:
Take single-chain antibody (scFv) the prokaryotic expression carrier pET15b-AD5scFvDNA of anti-human DR5 as template, adopt variable region of heavy chain and the chain variable region gene fragment of the anti-DR5 chimeric antibody of polymerase chain reaction (PCR) amplification, respectively with human IgG1's CH with after the κ chain is connected, with overlapping PCR the heavy chain of people-mouse chimeric antibody is connected with light chain again, and between heavy chain and light chain, adds the Furin/2A sequence with self splicing function.
Take pCDNA3 as initial carrier, make up a new carrier for expression of eukaryon that contains CAG promotor and Tetrahydrofolate dehydrogenase (dhfr) selection markers, this carrier is arrived in the gene clone of above-mentioned people-mouse chimeric antibody, make up the carrier for expression of eukaryon of anti-DR5 people-mouse chimeric antibody.The new expression vector that the present invention obtains is connected in the open reading frame with Furin/2A sequence with self splicing function heavy chain and the light chain with chimeric antibody.
Eukaryotic expression vector transfection CHO-dhfr with anti-DR5 people-mouse chimeric antibody
-Cell is through the cell strain of methotrexate (MTX) gradient pressurization screening acquisition stability and high efficiency chimeric antibody expression.Can be simultaneously, balanced, matchingly heavy chain and the light chain of chimeric antibody expression, and automatic Composition becomes people-mouse chimeric antibody of the anti-human DR5 of telotism, called after Zaptuximab.
Stable Chinese hamster ovary celI strain through method acquisition of the present invention, in on June 15th, 2011 in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) preservation, its specific name is the anti-DR5 people of stably express-mouse chimeric antibody Chinese hamster ovary celI strain, and it is numbered: CGMCC No.4938.
Stable Chinese hamster ovary celI strain of the present invention can produce people-mouse chimeric antibody, and the hypotype of its chimeric antibody antibody immunoglobulin is IgG1.
The native ligand TRAIL of this anti-DR5 people-mouse chimeric antibody and DR5 all can be combined with DR5, but its binding site is different.External studies show that, this anti-DR5 people-mouse chimeric antibody can kill the kinds of tumor cells such as leukemia, liver cancer, colorectal carcinoma and lung cancer, and lethality is time and dose-dependence.
Studies show that this anti-DR5 people-mouse chimeric antibody can suppress the tumour cells such as human colon carcinoma, liver cancer and lung cancer consumingly at the nude mice tumor growth in the body, and can use with the chemotherapy drugs in combination such as epirubicin, reach better result for the treatment of.Have no obvious rebound phenomena after the drug withdrawal, histologic analysis has no and causes that mouse liver kidney and other organs pathologic changes.
The present invention stablizes the Chinese hamster ovary celI strain and is created in external people with strong killing tumor cell effect-mouse chimeric antibody Zaptuximab.This chimeric antibody and epirubicin or other chemotherapeutics have the effect of Synergistic killing tumour cell, and can suppress in vivo formation and the growth of the multiple transplanted tumor of people in nude mouse.
The people that described stable cell line produces-mouse chimeric antibody Zaptuximab cell death inducing and the dead two kinds of different form of cell death of autophagy.
The present invention also provides the purposes of people of the present invention-mouse chimeric antibody Zaptuximab in preparation medicine for treating tumor thing.
The present invention further provides a kind of people-mouse chimeric antibody of the present invention and humanized reshaping antibody thereof.
At last, the present invention also provides a kind of described people-mouse chimeric antibody or its at least 80% homology, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or the homologous sequence of 99% homology and the restructuring of pharmaceutically acceptable carrier after the application of recombinant expression vector in the gene therapy medicament of preparation treatment tumour that obtain.
This shows, in the present invention, adopt modern biology technology and the methods such as genetically engineered, made up the carrier for expression of eukaryon of people-mouse chimeric antibody of the anti-human DR5 of stably express, and then with this carrier stable transfection CHO-dhfr
-Cell after methotrexate pressurization screening, has obtained stable cell line, can express the people of a kind of novel anti-DR5-mouse chimeric antibody Zaptuximab.External, this chimeric antibody has the ability of induced strong kinds of tumor cells apoptosis; In nude mouse, this chimeric antibody has the biologic activity that remarkable inhibition human tumor cells forms tumour and inhibition tumor cell growth; This chimeric antibody can with other cancer therapy drug coupling, inducing death of neoplastic cells is in vivo and in vitro strengthened the curative effect of chemotherapeutics, reduces dosage and the toxic side effect of chemotherapeutics.Therefore, this people-mouse chimeric antibody is significant in the new type antineoplastic medicine development.
Advantage of the present invention and effect are to have obtained the not anti-DR5 people of report-mouse chimeric antibody and carrier for expression of eukaryon and stably express cell of strain forefathers.The gene expression regulation element of described carrier for expression of eukaryon comprises that strong promoter CAG promotor, dhfr selection markers and Furin/2A are from shearing sequence, in described carrier for expression of eukaryon, the heavy chain of chimeric antibody and light chain are connected in the open reading frame, can be simultaneously, balanced, matchingly heavy chain and the light chain of chimeric antibody expression, and automatic Composition becomes the chimeric antibody molecule of telotism.With described carrier for expression of eukaryon stable transfection CHO-dhfr
-Behind the cell, through MTX pressurization screening, obtain the Chinese hamster ovary celI strain of the anti-DR5 chimeric antibody of a strain stably express.
This people-mouse chimeric antibody is different from TRAIL with the site of DR5 combination, can with the chemotherapy drugs in combination effects such as TRAIL and epirubicin, the collaborative effect that strengthens the tumours such as its anti-liver cancer, lung cancer and colorectal carcinoma.Induce the kinds of tumor cells apoptosis external, but normal cell is had no side effect.The biologic activity that has in vivo strong inhibition people liver cancer, lung cancer and Growth of Colon Cancer Cells has no side effect to liver, the kidney and other organs of normal mouse.Shown that this chimeric antibody can develop into safe and effective antitumor drug, be connected with pharmaceutically acceptable carrier restructuring with this chimeric antibody sequence or further humanization reshaping antibody sequence, the recombinant expression vector of acquisition can be used for preparing the gene therapy medicament for the treatment of tumour.
Anti-DR5 people-mouse chimeric antibody is to utilize genetic engineering technique that the variable region of mouse Anti-DR5 antibody is connected with the constant region of human antibody, be built into complete chimeric antibody, can be on the basis that keeps former monoclonal antibody specificity and avidity, reduce the human antimouse antibody reaction, prolong its transformation period and improve pharmacokinetic properties, and the effect system that complement activation is relevant with the Fc acceptor effectively.
The present invention is connected the variable region of the strain mouse source functional Anti-human DR5 monoclonal antibody that we prepare with the constant region of human antibody, set up people-mouse chimeric antibody, and in mammalian cell stably express, obtain the cell strain of this novel people-mouse chimeric antibody of stably express.This antibody has specific apoptosis induction activity to kinds of tumor cells in vivo and in vitro, normal cell and tissue there is not toxic side effect, can be separately or with TRAIL or other chemotherapeutics coupling, be used for the treatment of kinds of tumors and other and DR5 abnormal expression relative disease.
Description of drawings
Fig. 1: be the new carrier for expression of eukaryon that efficiently expresses anti-DR5 people-mouse chimeric antibody with CAG promotor and dhfr selection markers that makes up.
Fig. 2: be the Chinese hamster ovary celI strain of this chimeric antibody of stably express after MTX pressurization screening, the detected result of this chimeric antibody expression level.
Fig. 3: be show this chimeric antibody and its antigen people DR5 in conjunction with situation.The combination that shows this chimeric antibody and DR5 among the figure is typical unit point binding pattern, K
d=1.1nM, data processing adopts GraphPad software.
Fig. 4: be to show that this chimeric antibody is in the activity of external killing tumor cell.A figure shows 24 hours the cell survival rate of this chimeric antibody handler T Lymphocytic leukemia Jurkat cell with different concns; B figure shows 24 hours the cell survival rate of this chimeric antibody handler SMMC-7721 liver cancer cells with different concns; C figure shows 24 hours the cell survival rate of this chimeric antibody handler colorectal carcinoma HCT116 cell with different concns; D figure shows 24 hours the cell survival rate of this chimeric antibody handler hepatoma cell line BEL-7402 of different concns; E figure shows 24 hours the cell survival rate of this chimeric antibody handler nonsmall-cell lung cancer H460 cell of different concns.Cell survival rate adopts the MTS test kit, and (Promega company G1112) measures.
Fig. 5: be to show that this chimeric antibody and combined chemotherapy medicine thereof suppress the activity that people's transplantation tumor forms and grows in nude mouse.A figure shows that this chimeric antibody and combined chemotherapy medicine thereof suppress the human hepatocellular carcinoma BEL-7402 cell forms tumour in nude mouse growth; B figure shows that chimeric antibody and combined chemotherapy medicine thereof suppress human colon carcinoma HCT116 cell forms tumour in nude mouse growth; C figure shows that chimeric antibody and combined chemotherapy medicine thereof suppress Non-small cell lung carcinoma H460 cell forms tumour in nude mouse growth.EPB represents the chemotherapeutics epirubicin.
Fig. 6: be the activity that shows that this chimeric antibody activates the Caspase cascade and causes Caspase substrate PARP (polyADP-ribose polymerase) to degrade in people's liver cancer, colorectal carcinoma and non-small cell lung cancer cell.
Embodiment
The below will further specify the present invention by following non-limiting example, and will be as well known to those skilled in the art, without departing from the spirit of the invention, can make many modifications to the present invention, and such modification also falls into scope of the present invention.
Following experimental technique is ordinary method if no special instructions, and employed experiment material all can easily be obtained from commercial company if no special instructions.
Embodiment
The structure with the carrier for expression of eukaryon of the people-mouse chimeric antibody that efficiently expresses anti-DR5 of CAG promotor and dhfr selection markers that experimental example 1 is new
With anti-human DR5 single-chain antibody (scFv) prokaryotic expression carrier pET15b-AD5scFv DNA (Guo Y et al., A novel anti-human DR5 monoclonal antibody with tumoricidal activity induces caspase-dependent and caspase-independent cell death J Biol Chem 2005; 280 (51): 41940-52) be template, the variable region of heavy chain of the anti-DR5 chimeric antibody of pcr amplification and chain variable region gene fragment (VH primer, heavy chain: upstream primer VHE:5 ' CGGAATTCCAGATCCAGTTG3 ' (SEQ ID NO:10), downstream primer VHS:5 ' ATGTGTCGACGCTGAGGAGACTGT3 ' (SEQ ID NO:11).The VL primer, light chain: upstream primer VLE:5 ' GCGGAATTCGATGTTGTGATG3 ' (SEQ ID NO:12), downstream primer VLS:5 ' ACGCGTCGACCCGTTTTATTTC3 ' (SEQ ID NO:13), insertion is with the carrier (pCI-neo of human IgG1's CH and κ chain (universal sequence), Promega Co., E1841), again with overlapping PCR people-mouse chimeric antibody heavy chain is connected with light chain (primer 1:
5’CCGCTCGAGG?ATCCACCATGGAGACAGACACA3’(SEQ?ID?NO：14)，
Primer 2:
5’CTTGAGAAGGTCAAAGTTCAGTGTTTGCTTTACAGGTGCT?CGCCTCTTCCTTTTACCCGGAGACAGG3’(SEQ?ID?NO：15)，
Primer 3:
5’CTTTGACCTTCTCAAGTTGGCTGGAGACGTTGAGTCCAATC?CTGGGCCCGAGACAGACACACTC3’(SEQ?ID?NO：16)，
Primer 4:
5 ' CCGAAGCTTCTAGATATCTTACTAGCACTCTCCCCTGTTG3 ' (SEQ ID NO:17)), thus between heavy chain and light chain, add the Furin/2A sequence with self splicing function.Take pCDNA3 (Invitrogen.A-150228) as initial carrier, take pAM-CAG carrier (Hong Kong University provides) as template, with upstream primer 5 ' GGCGCAGATCTATTGACGTCAAT3 ' ((SEQ ID NO:18) and downstream primer 5 ' GGCAAGCTTAATTCTTTGCCAAAATG 3 ' (SEQ ID NO:19) amplification chicken actin promoter CAG, with the pSV2-dhfr carrier (available from ATCC, 67110) be masterplate, with upstream primer 5 ' AATCCCGGGACAGCTCAGGGCTGCG3 ' (SEQ ID NO:20) and downstream primer 5 ' GGCGGCGCTTCGAAAAAGCCAGCAAAAGCTC3 ' (SEQ ID NO:21) amplification Tetrahydrofolate dehydrogenase dhfr gene fragment.CAG, complete antibody gene HF2AL (SEQ ID NO:9) and dhfr gene fragment are inserted this initial carrier successively, identify correctly through order-checking, obtain the carrier for expression of eukaryon pcDNA3-CAG-HF2AL-dhfr of people-mouse chimeric antibody of new anti-DR5.The collection of illustrative plates of gained recombinant plasmid is seen Fig. 1.
The foundation of the Chinese hamster ovary celI strain of experimental example 2 high efficiency stable expression chimeric antibodies
With the carrier for expression of eukaryon pcDNA3-CAG-HF2AL-dhfr transfection CHO-dhfr of liposome transfection method with structure
-Cell is (available from ATCC, CRL-9096), through not containing selection substratum IMDM (HyClone, SH30228.01B) the screening positive monoclonal of xanthoglobulin and thymus pyrimidine, obtain the cell strain of stably express chimeric antibody, through the methotrexate MTX (5 * 10 of different concns
-8-5 * 10
-7Mol/L) pressurization screening, the cell strain of this chimeric antibody of stably express that acquisition expression output significantly improves.The results are shown in Figure 2.This cell strain on June 15th, 2011 in China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) preservation, its specific name is the anti-DR5 people of stably express-mouse chimeric antibody Chinese hamster ovary celI strain, it is numbered: CGMCC No.4938.This chimeric antibody called after Zaptuximab.
Experimental example 3 euzymelinked immunosorbent assay (ELISA) (ELISA) are measured the specific combination of chimeric antibody and its antigen
Be coated with 96 hole enzyme plates with the recombinant human DR5 at expression in escherichia coli, skim-milk sealing with 5%, the chimeric antibody or the mouse Anti-DR5 antibody that add different concns (0,7.8,15.6,31.2,62.5,125,250,500,1000,2000,4000ng/ml), 37 ℃ of insulations 2 hours.Goat-anti people/the mouse IgG that adds horseradish peroxidase (HRP) mark two anti-(middle China fir Golden Bridge), 37 ℃ of insulations 2 hours.Add chromogenic substrate, after 30 minutes, add 2 M sulfuric acid termination reactions, measure the OD value.The results are shown in Figure 3, the result shows that the combination of chimeric antibody Zaptuximab and DR5 is typical unit point binding pattern, Kd=1.1nM, and avidity is not compared with mouse Anti-DR5 antibody AD5-10 and is obviously reduced.
Experimental example 4 MTS methods are measured chimeric antibody Zaptuximab in external lethality to tumour cell
Human T lymphocyte's leukemia Jurkat cell (ATCC with logarithmic phase, TIB-152), SMMC-7721 liver cancer cells (Shanghai Inst. of Life Science, CAS cell resource center, TCHu 52), colorectal carcinoma HCT116 cell (ATCC, CCL-247), hepatoma cell line BEL-7402 (Shanghai Inst. of Life Science, CAS cell resource center, TCHu 10) and nonsmall-cell lung cancer H460 cell (ATCC, HTB-177) etc. tumour cell adds in the 96 porocyte culture plates, the chimeric antibody (0 that adds different concns, 0.13,0.25,0.5,1,2,4,8 μ g/ml), process after 24 hours, add MTS reagent, reacted 2-4 hour, and measured OD value (wavelength 492nm).Take the OD value in acellular hole as blank " 0 ".The ratio of the OD value in cell survival rate=processing hole and the hole OD value that is untreated.The results are shown in Figure 4.The result shows that cell survival rate is decreased significantly, and illustrates that chimeric antibody Zaptuximab has very strong function of tumor inhibition.
Experimental example 5 chimeric antibody Zaptuximab tumor killing activity in vivo
Nude mice (BALB/c, Beijing Vital River Experimental Animals Technology Co., Ltd.) subcutaneous injection BEL-7402 cell 5 * 10
6/ only.Treatment group (n=6) minute independent treatment group of chimeric antibody various dose, chemotherapeutics epirubicin (EPB) is treatment group and chimeric antibody and chemotherapy drugs in combination treatment group separately, from inoculated tumour cell beginning on the 5th administration, detect the activity that chimeric antibody suppresses tumor growth.Negative control group (n=6) awards PBS and physiological saline.Route of administration is abdominal injection.After the administration 29 days, put to death nude mice, get tumour and weigh.
The results are shown in Figure 5.The result shows that chimeric antibody Zaptuximab can significantly suppress the growth of human hepatocellular carcinoma BEL-7402 cell, colorectal carcinoma HCT116 cell and nonsmall-cell lung cancer H460 Transplanted cells knurl in the nude mouse, and is dose-dependence.Behind the chimeric antibody Zaptuximab combined chemotherapy medicine epirubicin Epirubicin, it suppresses tumor promotion and is further strengthened.
Experimental example 6 Western blot detect chimeric antibody Zaptuximab and activate the caspase cascade and cause its substrate PARP (poly ADP-ribose polymerase) degraded
The BEL-7402 of logarithmic phase, HCT116 and H460 cell chimeric antibody Zaptuximab processing 0,4 and the 8h of 100ng/ml, collecting cell, the 12%SDS-polyacrylamide gel electrophoresis is carried out in cracking.Albumen on the gel is forwarded on the pvdf membrane, and the first antibody (Cell Signaling Technology Co.) that adds caspase-3, caspase-8 and PARP is hybridized.Add two anti-(HRP-goat antirabbit or mouse IgG, the company of middle China fir Golden Bridge) of corresponding horseradish peroxidase-labeled, add luminous substrate and develop.
Western blot result shows that time dependent degraded has occured for caspase-8, caspase-3 and PARP, proves that chimeric antibody Zaptuximab can activate the caspase cascade and cause its substrate PARP degraded (Fig. 6).
Claims (11)
1. people-the mouse chimeric antibody of an anti-human tumor necrosin relative death inducing ligand acceptor extracellular region, it is characterized in that the light chain of described chimeric antibody and the aminoacid sequence of variable region of heavy chain comprise the weight chain variable region amino acid sequence shown in the light chain variable region amino acid sequence shown in the SEQ ID NO:1 and the SEQ ID NO:2, the constant region of the constant region behaviour antibody of described chimeric antibody.
2. people-the mouse chimeric antibody of anti-human tumor necrosin relative death inducing ligand acceptor extracellular region according to claim 1 is characterized in that the CH of described chimeric antibody is human IgG1's constant region, constant region of light chain behaviour κ chain.
3. people-the mouse chimeric antibody of anti-human tumor necrosin relative death inducing ligand acceptor extracellular region according to claim 1 and 2 is characterized in that variable region of light chain CDR1, the CDR2 of described chimeric antibody and the aminoacid sequence of CDR3 are respectively:
24 of CDR1 to 39 amino acids: shown in SEQ ID NO:3;
55 of CDR2 to 61 amino acids: shown in SEQ ID NO:4;
94 of CDR3 to 102 amino acids: shown in SEQ ID NO:5; And/or
Variable region of heavy chain CDR11, the CDR22 of described chimeric antibody and the aminoacid sequence of CDR33 are respectively:
31 of CDR11 to 35 amino acids: shown in SEQ ID NO:6;
55 of CDR22 to 66 amino acids: shown in SEQ ID NO:7;
99 of CDR33 to 101 amino acids: shown in SEQ ID NO:8.
4. according to claim 1 to the people-mouse chimeric antibody of 3 each described anti-human tumor necrosin relative death inducing ligand acceptor extracellular regions, it is characterized in that described chimeric antibody is the stable cell line expression of CGMCC No.4938 by the preserving number that was deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on June 15th, 2011, called after Zaptuximab.
5. the stable cell lines of the people-mouse chimeric antibody of the anti-human tumor necrosin relative death inducing ligand acceptor of strain stably express extracellular region, its specific name is the anti-DR5 people of stably express-mouse chimeric antibody Chinese hamster ovary celI strain, be deposited in China Committee for Culture Collection of Microorganisms common micro-organisms center on June 15th, 2011, preserving number is CGMCC No.4938.
6. the recombinant eukaryon expression vector of the people-mouse chimeric antibody of each described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of stably express claim 1 to 4, it is characterized in that described recombinant eukaryon expression vector is with CAG strong promoter and Tetrahydrofolate dehydrogenase selection markers, from the monoclonal antibody variable region of heavy chain of mouse-anti people DR5 and the encoding sequence of variable region of light chain, the sequence of human IgG1's CH and constant region of light chain κ chain and the Furin/2A sequence with self splicing function that adds between heavy chain and light chain are effectively connected to efficiently express described people-mouse chimeric antibody, preferably, the initial plasmid of described recombinant eukaryon expression vector is pCDNA3, preferably, the monoclonal antibody of described mouse-anti people DR5 is AD5-10.
7. the recombinant eukaryon expression vector of the people-mouse chimeric antibody of each described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of stably express claim 1 to 4 according to claim 6 is characterized in that the sequence that couples together from the sequence of encoding sequence, human IgG1's CH and the constant region of light chain κ chain of the monoclonal antibody variable region of heavy chain of mouse-anti people DR5 and variable region of light chain and the Furin/2A sequence with self splicing function that adds is shown in SEQ ID NO:9 between heavy chain and light chain.
8. method for preparing such as the people-mouse chimeric antibody of each described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of claim 1 to 4 is characterized in that may further comprise the steps:
A) usefulness is such as the recombinant eukaryon expression vector transfection CHO-dhfr of the people-mouse chimeric antibody of claim 6 or 7 each described anti-human tumor necrosin relative death inducing ligand acceptor extracellular regions of described stably express claim 1 to 4
-Cell;
B) utilize methotrexate pressurization screening to obtain the cell strain of stably express chimeric antibody.
9. stable cell line that method as claimed in claim 8 obtains.
10. composition, its activeconstituents is to form such as the people-mouse chimeric antibody of each described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of claim 1 to 4 and chemotherapeutics, preferably, described chemotherapeutics is TRAIL or epirubicin.
11. such as the people-mouse chimeric antibody of each described anti-human tumor necrosin relative death inducing ligand acceptor extracellular region of claim 1 to 4, such as recombinant eukaryon expression vector or the purposes of composition according to claim 10 in the medicine of preparation treatment tumour of the people-mouse chimeric antibody of claim 6 or 7 each described anti-human tumor necrosin relative death inducing ligand acceptor extracellular regions of described stably express claim 1 to 4, preferably, described tumour is leukemia, liver cancer, colorectal carcinoma or lung cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102095021A CN102898524A (en) | 2011-07-25 | 2011-07-25 | Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011102095021A CN102898524A (en) | 2011-07-25 | 2011-07-25 | Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102898524A true CN102898524A (en) | 2013-01-30 |
Family
ID=47571039
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011102095021A Pending CN102898524A (en) | 2011-07-25 | 2011-07-25 | Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102898524A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318970A (en) * | 2016-08-18 | 2017-01-11 | 广东东阳光药业有限公司 | High-throughput screening method for CHO-Dhfr expression system cell strains |
| CN107964535A (en) * | 2016-12-23 | 2018-04-27 | 浙江海隆生物科技有限公司 | Screening method and application of CHO monoclonal cell strain |
| CN110637032A (en) * | 2017-03-21 | 2019-12-31 | 东亚St株式会社 | anti-DR 5 antibodies and uses thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1673232A (en) * | 2004-08-19 | 2005-09-28 | 中国医学科学院基础医学研究所 | Receptor DR5 monoclonal antibody (AD5-10) resisting human tumor necrosin related apoptosis inducing ligand and its prepn and use |
| CN101287492A (en) * | 2005-10-14 | 2008-10-15 | 中外制药株式会社 | Anti-glypican-3 antibody |
-
2011
- 2011-07-25 CN CN2011102095021A patent/CN102898524A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1673232A (en) * | 2004-08-19 | 2005-09-28 | 中国医学科学院基础医学研究所 | Receptor DR5 monoclonal antibody (AD5-10) resisting human tumor necrosin related apoptosis inducing ligand and its prepn and use |
| CN101287492A (en) * | 2005-10-14 | 2008-10-15 | 中外制药株式会社 | Anti-glypican-3 antibody |
Non-Patent Citations (4)
| Title |
|---|
| PENG ZHANG等: "Targeting a novel N-terminal epitope of death deceptor 5 triggers tumor cell death", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| XIU XIAN WU等: "Enhancement of Lexatumumab-induced apoptosis in human solid cancer cells by cisplatin in caspase-dependent manner", 《CLIN CANCER RES.》 * |
| 李蒙 等: "重组抗死亡受体5人-鼠嵌合抗体的表达和活性研究", 《中华医学杂志》 * |
| 陈凤 等: "抗肿瘤坏死因子相关凋亡诱导配体受体死亡受体5嵌合抗体的构建及其真核表达", 《中国医学科学院学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106318970A (en) * | 2016-08-18 | 2017-01-11 | 广东东阳光药业有限公司 | High-throughput screening method for CHO-Dhfr expression system cell strains |
| CN106318970B (en) * | 2016-08-18 | 2019-06-25 | 广东东阳光药业有限公司 | A kind of high-throughput screening method of CHO-Dhfr expression system cell strain |
| CN107964535A (en) * | 2016-12-23 | 2018-04-27 | 浙江海隆生物科技有限公司 | Screening method and application of CHO monoclonal cell strain |
| CN110637032A (en) * | 2017-03-21 | 2019-12-31 | 东亚St株式会社 | anti-DR 5 antibodies and uses thereof |
| CN110637032B (en) * | 2017-03-21 | 2023-05-12 | 东亚St株式会社 | anti-DR 5 antibodies and uses thereof |
| US11840574B2 (en) | 2017-03-21 | 2023-12-12 | Dong-A St Co., Ltd. | Anti-DR5 antibody and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6124377B2 (en) | New anti-DR5 antibody | |
| TWI564306B (en) | Bispecific antibody | |
| US20190321466A1 (en) | Anti-pd1 monoclonal antibody, pharmaceutical composition thereof and use thereof | |
| WO2021008463A1 (en) | Cldn18.2 antibody and use thereof | |
| CN103030695B (en) | The pharmaceutical composition of anti-c Met humanized antibodies and the prevention containing it or treating cancer | |
| JP2020022482A (en) | Oncostatin M receptor antigen binding protein | |
| ES2719084T3 (en) | Monoclonal antibody to antagonize and inhibit the union of vascular endothelial cell growth factor and its receptor, and coding sequence and use of this | |
| JP5729839B2 (en) | Antibodies that specifically bind to epidermal growth factor receptor | |
| KR20120060235A (en) | Specific binding proteins and uses thereof | |
| JP7090204B2 (en) | Bispecific antibodies targeting immune checkpoints | |
| JP2023071889A (en) | Tigit and pd-1/tigit-binding molecules | |
| EP4043495A1 (en) | Anti-human trop-2 antibody and application thereof | |
| WO2021136489A1 (en) | Anti pd-l1 antibody and use thereof | |
| CN102276722B (en) | Novel vascular endothelial growth factor humanized monoclonal antibody | |
| EP4269442A1 (en) | Mesothelin binding molecule and application thereof | |
| JP2024504124A (en) | Novel anti-gremlin 1 antibody | |
| US20220340657A1 (en) | Antibody and bispecific antibody targeting lag-3 and use thereof | |
| CN102898524A (en) | Human-mouse chimeric antibody of anti-human tumor necrosis factor related apoptosis-inducing ligand receptor DR5, preparation method and uses thereof | |
| TW202132350A (en) | Antibody targeting EpCAM, and preparation and applications thereof | |
| WO2023078382A1 (en) | Antibody binding to gprc5d and use thereof | |
| US20230212302A1 (en) | Antibodies Binding TNFR2 and Uses Thereof | |
| WO2022194201A1 (en) | Cldn18.2-targeting antibody or antigen binding fragment thereof and use thereof | |
| WO2021244553A1 (en) | Tetravalent bispecific antibody against pd-1 and egfr | |
| WO2023143444A1 (en) | Anti-dkk1 antibody, pharmaceutical composition thereof and use thereof | |
| EP4180457A1 (en) | Anti-cldn-18.2 antibody and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| CB02 | Change of applicant information |
Address after: 201203 China (Shanghai) free trade zone Cailun Road, room 406 No. 781 Applicant after: OBIO TECHNOLOGY (SHANGHAI) Corp.,Ltd. Address before: 201203, 10F, building 1, Heng International Building, 1238 Zhangjiang Road, Shanghai, Pudong New Area Applicant before: Obio Technology (Shanghai) Co.,Ltd. |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160302 Address after: 201203, 10F, building 1, Heng International Building, 1238 Zhangjiang Road, Shanghai, Pudong New Area Applicant after: Obio Technology (Shanghai) Co.,Ltd. Address before: 100005 Beijing, Dongdan, No. three, No. 5, No. Applicant before: Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences |
|
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130130 |
|
| RJ01 | Rejection of invention patent application after publication |