CN102895190A

CN102895190A - Liposome preparation and preparation method and application thereof

Info

Publication number: CN102895190A
Application number: CN 201210393528
Authority: CN
Inventors: 陈建新; 彭薇; 李铁军; 主辉; 倪燕; 冯文建
Original assignee: Biomics Biotechnologies Co Ltd
Current assignee: Biomics Biotechnologies Co Ltd
Priority date: 2012-10-16
Filing date: 2012-10-16
Publication date: 2013-01-30

Abstract

The invention discloses a liposome preparation and a preparation method for the liposome preparation and an application of the liposome preparation for treating related diseases caused by genetic abnormal expression. The liposome preparation is characterized by comprising complementary double positive lipid, phospholipid and long-acting lipid. The preparation method comprises the following steps of: mixing solution of the complementary double positive lipid, solution of the phospholipid with solution of the long-acting lipid to form a prefabricated empty vesicle; then, mixing the prefabricated empty vesicle with nucleic acid solution to form the nucleic acid liposome preparation. The liposome preparation disclosed by the invention can be easily prepared, and drugs, such as nucleic acid, can be delivered in vivo to take therapeutic effect. The liposome preparation can be used for treating the related diseases caused by the genetic abnormal expression.

Description

Liposomal formulation, preparation method and application thereof

Technical field

The present invention relates to a kind of interior transmission of body preparation of therapeutical effect, especially a kind of Liposomal formulation.

Background technology

In recent years, dissimilar nucleic acid is used to treat the research of some diseases, is expected to develop into the gene therapy of a new generation.These nucleic acid comprise for the DNA of gene therapy and RNA, and the structure of analogies and modification.Wherein, RNA comprises small RNA (small interfering RNA, siRNA), Microrna (microRNA, miRNA), RNA aptamers, little part RNA (small ligand RNA, sliRNA) etc.; DNA comprises plasmid etc., these nucleic acid play a role by different mechanism, disturb (RNA interferring such as siRNA and miRNA by RNA, RNAi) mechanism is regulated the expression of specific gene in the cell, after siRNA or miRNA enter in the cell, these double-stranded RNAs can be combined with intracellular specific protein and be formed reticent complex (the RNAInducing Silencing Complex that RNA induces, RISC), after unwinding in RISC, siRNA is combined by the complementary identification of sequence and with mRNA, mRNA is cut, and reaches the effect of down-regulation of gene expression.RNAi provides a kind of and target gene complementary and block the gene therapy method of the mrna expression of encoding proteins.

RNAi has widely purposes, and the siRNA of a certain albumen of targeting and miRNA can be directly obtain with the method for chemosynthesis.A large amount of research reports, siRNA can reduce target protein in the model in vitro and in vivo specifically, to so far, has tens of kinds of siRNA to enter clinical experimental stage.

Yet, siRNA and other nucleic acid drug must face two problems at present, the first, the degradation capability of their nuclease-resistants in Cytoplasm a little less than, the secondth, by the whole body administration exposed siRNA or miRNA be difficult to permeate through cell membranes and enter in the cell and be combined with RISC.This class nucleic acid drug can be by introducing the nucleotide of chemical modification in molecule, such as the D2EHDTPA group, yet these chemical modifications can only limitedly protect nucleic acid not by nuclease degradation, and may reduce the activity of nucleic acid.Nucleic acid drug can carry out transmitting in the cell with carrier system, and such as the structure of polymer, positive liposome or chemical modification, other carries out covalently bound such as cholesterol molecule.Yet, be necessary to improve transmission system to improve siRNA and miRNA stability in vivo and to wear the film ability, the unfavorable factor of avoiding as much as possible chemical modification to bring simultaneously.

But the matter of utmost importance that nucleic acid drug will be faced is stability, in serum or cell, in the situation that has Cobra venom endonuclease and excision enzyme to exist, nucleic acid drug can be degraded rapidly, only has very short half-life (Zelphati, the people such as O, Antisense.Res.Dev.1993 (3): 323-338).Reduce nucleic acid with the method for chemical modification and solved subproblem in serum or cell, modify such as phosphodiester bond, nucleotide modification or sugar ring are modified etc.But these can not be dealt with problems fully, still have limitation.

On the other hand, to be used for the treatment of still the problem that exists be the limited in one's ability of nucleic acid drug permeates cell membranes to nucleic acid drug.In order to attempt improving curative effect, the research worker nucleic acid drug that transmits chemical modification or unmodified based on the carrier system of liposome.Large quantity research report is arranged, and positive liposome can be used to a bag year siRNA and is prepared into the nucleic acid Liposomal formulation, and these nucleic acid Liposomal formulations have obtained good checking in external, external experiment.

Although obtain recently some progress, in the art, still need to improve the composition based on the nucleic acid Liposomal formulation, to be applicable to general treatment.Under the perfect condition, these components have efficient nucleic acid envelop rate, have high medicine fat ratio, and the protection nucleic acid drug is fit to the whole body transmission not by the intracellular nucleic acid enzymatic degradation, and the nucleic acid that wraps that is suitable for transmission in the cell is provided.In addition, these Liposomal formulations should have good toleration, and suitable therapeutic index is provided, and do not have obvious toxicity such as the effective dose of nucleic acid drug and to patient.The invention provides such Liposomal formulation, and the preparation method of this Liposomal formulation, also provide this Liposomal formulation that nucleic acid drug is imported method in the mammalian body simultaneously, be used for the treatment of disease.

Summary of the invention

The purpose of this invention is to provide a kind of not only easily preparation but also be delivered to easily the Liposomal formulation of target tissue, can be used for treating the relevant disease that the unconventionality expression by gene causes.

In order to achieve the above object, the invention provides a kind of Liposomal formulation, it is characterized in that, comprise complementary two positive lipid, phospholipid and long-acting lipid.

Preferably, the molar percentage of complementary two positive lipids, phospholipid and long-acting lipid is respectively 20～80%, 10% and 10% in the described Liposomal formulation.

Preferably, the two positive lipids of described complementation comprise: the first positive lipid and the second positive lipid, and the first positive lipid and the molar percentage of the second positive lipid in Liposomal formulation are respectively 20～60%; The described first positive lipid is 4-(N, N-dimethyl amido) butanoic acid-6,9,28,31-tetraene-19-, three Heptadecyl alcohol ester (heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino) butanoate, CL01) or N, N-dimethyl-2,3-two inferior oily oxygen base propylamine (N, N-dimethyl-(2,3-dilinoleyloxy) propylamine, DLinDMA); The described second positive lipid is 3-(N, the N-dimethyl amido) propanoic acid-cholesteryl ester (cholesteryl3-(dimethylamino) propanoate, CL06) or 2-(N, the N-dimethyl amido) acetic acid-cholesteryl ester (cholesteryl2-(dimethylamino) acetate, CL08).

Preferably, described phospholipid is diacyl phosphatidyl choline (distearyl phosphatidyl choline, DSPC).

Preferably, described long-acting lipid is N-(2,3-20 tetraether propyl group) carbamic acid poly glycol monomethyl ether ester (N-[(methoxy poly (ethyleneglycol) 2000) carbamoyl]-1,2-dimyristyloxypropyl-3-amine, PEG-c-DMA), N-(poly glycol monomethyl ether base) carbamic acid-6,9,28,31-tetraene-19-three Heptadecyl alcohol ester (heptatriaconta-6,9,28,31-tetra-en-19-ol methoxy poly (ethylene glycol) 2000carbamate, PEG-DLM), N-(poly glycol monomethyl ether base) carbamic acid cholesteryl ester (cholesterolmethoxy poly (ethylene glycol) 2000carbamate, PEG-Chol), in N-(poly glycol monomethyl ether base) carbamic acid-15-nonacosanol ester (nonacosan-15-ol methoxypoly (ethylene glycol) 2000carbamate, PEG-DMM) any one.

Preferably, also comprise a kind of medicine with therapeutic effect.

Further, described medicine is nucleic acid; Described nucleic acid is functional r NA and the version that contains modification or analogies and DNA and contains the version of modification or any one or a few the mixture in the analogies

Further, described functional r NA is any one or a few the mixture in siRNA (small ligand RNA, be called for short sliRNA), miRNA, little part RNA and the RNA aptamers.

The present invention also provides the preparation method of above-mentioned Liposomal formulation, it is characterized in that, forms prefabricated empty pocket bubble after the solution mixing with complementary two positive lipids, phospholipid, long-acting lipid, then mixes with nucleic acid solution, forms the nucleic acid Liposomal formulation.

The nucleic acid Liposomal formulation can be formed by a kind of cation lipid and siRNA aqueous solution that is dissolved in organic solvent (such as ethanol and the miscible solvent composition of Qi Yi), and the mixtures of nucleic acids that comprises cationic-liposome can be for subsequent use as pharmaceutical preparation use or energy stored refrigerated immediately; The method that also can adopt the those skilled in the art to commonly use is carried out chemical process.This cation lipid complex can carry out suitable processing by enough many mechanical means, can become solid-state or liquid nucleic acid drug.

The present invention also provides the application of above-mentioned Liposomal formulation in the relevant disease that treatment is caused by gene unconventionality expression.

Liposomal formulation provided by the invention can be used for pharmaceutically acceptable nucleic acid molecules, transmits in the body such as siRNA or miRNA etc., and this preparation can prevent and treat mammalian diseases, reaches better therapeutic effect.

Description of drawings

Fig. 1 is Mouse Weight bar diagram before and after Liposomal formulation F113 and the F115 administration;

Among the figure, abscissa represents each experimental group, and vertical coordinate represents Mouse Weight;

Fig. 2 is total cholesterol level bar diagram in the mice serum after Liposomal formulation F113 and the F115 administration;

Among the figure, abscissa represents each experimental group, and vertical coordinate represents the mice serum total cholesterol level;

Fig. 3 is the horizontal bar diagram of mRNA relative expression of ApoB gene in the mouse liver tissue after Liposomal formulation F113 and the F115 administration;

Among the figure, abscissa represents each experimental group, and vertical coordinate represents the mRNA relative expression level of ApoB gene;

Fig. 4 is Mouse Weight bar diagram before and after Liposomal formulation F121, F123, F128 and the F129 administration; Among the figure, abscissa represents each experimental group, and vertical coordinate represents Mouse Weight;

Fig. 5 is total cholesterol level bar diagram in the mice serum after Liposomal formulation F121, F123, F128 and the F129 administration;

Fig. 6 is the horizontal bar diagram of mRNA relative expression of ApoB gene in the mouse liver tissue after Liposomal formulation F121, F123, F128 and the F129 administration;

Fig. 7 is Mouse Weight bar diagram before and after Liposomal formulation F120 and the F122 administration;

Fig. 8 is total cholesterol level bar diagram in the mice serum after Liposomal formulation F120 and the F122 administration;

Fig. 9 is the horizontal bar diagram of mRNA relative expression of ApoB gene in the mouse liver tissue after Liposomal formulation F120 and the F122 administration;

Figure 10 is Mouse Weight bar diagram before and after Liposomal formulation F157, F159, F165 and the F167 administration;

Figure 11 is the horizontal bar diagram of mRNA relative expression of ApoB gene in the mouse liver tissue after Liposomal formulation F157, F159, F165 and the F167 administration;

Figure 12 is Mouse Weight bar diagram before and after Liposomal formulation F155 and the F156 administration;

Figure 13 is the horizontal bar diagram of mRNA relative expression of ApoB gene in the mouse liver tissue after Liposomal formulation F155 and the F156 administration;

Among the figure, abscissa represents each experimental group, and vertical coordinate represents the mRNA relative expression level of ApoB gene.

The specific embodiment

For the present invention is become apparent, hereby with preferred embodiment, and cooperate accompanying drawing to be described in detail below.

Embodiment 1

Preparation 6,9,28,31-tetraene-19-three Heptadecyl alcohols (heptatriaconta-6,9,28,31-tetra-en-19-ol, DLM, 6a)

Step 1: inferior oleyl alcohol 2 synthetic, reaction equation is as follows:

Formula 1

Pass into dry argon gas in the 1L flask, then linoleic acid 1 (30g, 107mmol) and THF (320mL) are added in the reactor.Use acetone-the dry ice bath to be cooled to 0 ℃.The toluene solution (73mL, 60%wt/vol) of red aluminum is slowly dropped in the reactor, maintain the temperature at below 0 ℃ in the dropping process.After dropwising, room temperature reaction 2 hours.React complete after, solution is cooled to 0 ℃, slowly adds saturated metabisulfite solution (5.75g Na ₂SO ₄Be dissolved in the 7.85mL water), time for adding is not less than 45min.After dropwising, splash into ethyl acetate (130mL) in the 30min, and vigorous stirring.Reacting liquid filtering, solid merges organic facies with ethyl acetate (90mL) flushing, and is concentrated.Product is dissolved in the ethyl acetate (90mL), and water (45mL) washes twice, and uses anhydrous sodium sulfate drying.Filter, concentrate organic facies and remove organic solvent with vacuum pump, obtain product 2 (28.8g).

Step 2: the inferior grease 3 of Loprazolam synthetic, reaction equation is as follows:

Formula 2

Pass into dry argon gas in the 500mL flask, then add above-mentioned product 2 (25g, 94mmol) and dichloromethane (DCM, 210mL), then add triethylamine (TEA, 53mL) and DMAP (1.15g, 2.0mol), solution uses acetone-the dry ice bath to be cooled to-10 ℃.Loprazolam acid anhydride (32.7g, 188mmol) is dissolved among the DCM (45mL), slowly drops in the reactor.Time for adding is not less than 1 hour, and remains that reacting liquid temperature is below 0 ℃.Reactant liquor dropwises, and continues to keep 0 ℃ of reaction 1 hour.React complete after, frozen water (80mL) adds in the reactant liquor, water is with DCM (45mL) extraction.Merge organic facies, organic facies with dilute hydrochloric acid (9mLHCl is dissolved in the 36mL water) (2 * 45mL), water (2 * 35mL) and saline (50g NaCl is dissolved in the 45mL water) (45mL) wash sodium sulfate (12.5g) drying.Filter, concentrate organic facies and remove organic solvent with vacuum pump, obtain product 3 (32.3g).

Synthesizing of the inferior oily alkane 4 of step 3:1-bromo, reaction equation is as follows:

Formula 3

Pass into dry argon gas in the 500mL flask, then add DMF (110mL) and product 3 (30g, 87mmol), solution uses acetone-the dry ice bath to be cooled to-10 ℃.LiBr (11.5g, 132mmol) is dissolved in DMF (110mL), stirs and slowly drops in the reactor.Keep reacting liquid temperature below 0 ℃.After dropwising, reactant liquor is warming up to 45 ℃, stirring reaction 18-20 hour.React complete after, add entry (300mL), and extract with normal hexane (240mL).Merge organic facies, and (2 * 45mL) wash sodium sulfate (17g) drying with saline (59gNaCl is dissolved in the 45mL water).Filter, concentrate organic facies and remove organic solvent with vacuum pump, obtain crude product (27.5g).With 60-120 order silica gel purification (normal hexane is mobile phase), obtain sterling 4 (23g, three step productive rates are 81%). ¹H-NMR(CDCl ₃，400MHz)，δ＝5.41-5.29(m，4H)，4.20(d，2H)，3.40(t，2H)，2.77(t，2H)，2.09-2.02(m，4H)，1.88-1.00(m，2H)，1.46-1.27(m，18H)，0.88(t，3H)。

Step 4:6,9,28,31-tetraene-19-, three Heptadecyl alcohol 6a's is synthetic, and reaction equation is as follows:

Formula 4

Pass into dry argon gas in the 250mL there-necked flask, then add Mg (2.21g, 92mmol) and the absolute ether (12mL) of activation.Product 4 (20g, 61mmol) is dissolved in the absolute ether (40mL).Under the argon shield, this solution (8mL) adds in the reactor, and adds methylene bromide (0.2mL, 2.8mmol).Reactor is warming up to 40 ℃ in water-bath.After the reaction beginning, remove thermal source, surplus solution (32mL) is dropped to (in 1 hour) in the reactor, allow mixture keep the gentle reflux state.After dropwising, begin heating and make it keep reflux state reaction 1 hour.After raw material reaction was complete, reactant liquor was cooled to below 10 ℃ with ice bath, then slowly added the diethyl ether solution (2.2mL is dissolved in the 32mL ether) of Ethyl formate.Room temperature reaction 1 hour.Then the sulfuric acid solution (27.2mL sulphuric acid is dissolved in the 272mL frozen water) that adds frozen water (56mL) and 10% separates organic facies, water ether (3x80mL) extracting.Merge organic facies, and wash sodium sulfate (16g) drying with (saline 80mL).Filter, concentrate organic facies and remove organic solvent with vacuum pump, obtain crude product (alcohol and benzoate mixtures).Crude product adds NaOH solution (7.5g is dissolved in the 150mL water) with 100mL THF dissolving, is heated to 65 ℃ of reactions 18 hours.After reacting completely, reactant is cooled to room temperature, and with ether (3*100mL) extracting, merges organic facies, and washs with saline (40mL).Sodium sulfate (40g) drying.Filter concentrated organic facies.Crude product obtains sterling 6a (11.6g, productive rate are 80%) with 60-120 order silica gel purification (4% ether/normal hexane). ¹H-NMR(CDCl ₃，400MHz)，δ＝5.47-5.24(m，8H)，3.70-3.50(m，1H)，2.85-2.66(m，4H)，2.12-1.91(m，9H)，1.55-1.17(m，46H)，0.90-0.80(m，6H)。The overall reaction equation is as follows:

Formula 5

Embodiment 2

N-(poly glycol monomethyl ether base) carbamic acid-6,9,28,31-tetraene-19-three Heptadecyl alcohol ester (heptatriaconta-6,9,28,31-tetraen-19-ol methoxy poly (ethylene glycol) 2000carbamate, PEG-DLM, 8a) synthesis step as follows:

Step 1: carbonic acid-O-p-nitrophenyl, O '-6,9,28,31-tetraene-19-heptatriacontane base diester 7a's is synthetic

Add 6,9,28,31-tetraene-19-, three Heptadecyl alcohol 6a (0.6g, 1.1mmol) in the 100mL flask, with anhydrous DCM (20mL) dissolving, then add chloro-carbonic acid-4-nitro phenyl ester (0.4g, 2.0mmol) and TEA (0.8mL).Room temperature reaction spends the night.After reacting completely, reactant liquor saturated common salt water washing (30mL * 3), anhydrous sodium sulfate drying filters and is spin-dried for solvent and obtains crude product.Crude product column purification (mobile phase is 4% diethyl ether hexane solution) obtains product 7a (0.57g, productive rate are 74.7%).

Step 2:N-(poly glycol monomethyl ether base) carbamic acid-6,9,28,31-tetraene-19-three Heptadecyl alcohol esters (8a) synthetic

Add carbonic acid-O-p-nitrophenyl in the 100mL flask, O '-6,9,28,31-tetraene-19-heptatriacontane base diester 7a (0.45g, 0.65mmol) and dioxane (25mL), behind the material dissolution, amido modified poly glycol monomethyl ether (0.87g, 0.43mmol).Room temperature reaction 2 days.Reactant liquor saturated common salt water washing (30mL * 3), anhydrous sodium sulfate drying filters and is spin-dried for solvent and obtains crude product.Crude product column purification (mobile phase is the DCM solution of 0-4% methanol) obtains product 8a (0.7g, productive rate are 59.8%). ¹H-NMR(CDCl ₃，400MHz)，δ＝5.46-5.23(m，8H)，3.70-3.20(PEG-CH ₂)，2.80-2.70(m，4H)，2.10-2.00(m，8H)，1.50-1.10(m，46H)，0.95-0.75(m，6H)。

Embodiment 3

The synthesis step of N-(poly glycol monomethyl ether base) carbamic acid-15-nonacosanol ester (nonacosan-15-ol methoxypoly (ethylene glycol) 2000carbamate, PEG-DMM, 8b) is as follows:

Step 1:15-nonacosanol 6b's is synthetic

Pass into dry argon gas in the 250mL there-necked flask, then add Mg (2.21g, 92mmol) and the absolute ether (12mL) of activation.1-bromo-tetradecane (20g, 72mmol) is dissolved in the absolute ether (40mL).Under the argon shield, this solution (8mL) adds in the reactor, and adds methylene bromide (0.2mL, 2.8mmol).Reactor is warming up to 40 ℃ in water-bath.After the reaction beginning, remove thermal source, surplus solution (32mL) is dropped to (in 1 hour) in the reactor, allow mixture keep the gentle reflux state.After dropwising, begin heating and make it keep reflux state reaction 1 hour.After raw material reaction was complete, reactant liquor was cooled to below 10 ℃ with ice bath, then slowly added the diethyl ether solution (2.2mL is dissolved in the 32mL ether) of Ethyl formate.Time for adding is no less than 1 hour, after dropwising, and room temperature reaction 1 hour.Then the sulfuric acid solution (27.2mL sulphuric acid is dissolved in the 272mL frozen water) that adds frozen water (56mL) and 10% separates organic facies, water ether (3*80mL) extracting.Merge organic facies, and wash sodium sulfate (16g) drying with (saline 80mL).Filter, concentrate organic facies and remove organic solvent with vacuum pump, obtain crude product (alcohol and benzoate mixtures).Crude product adds NaOH solution (7.5g is dissolved in the 150mL water) with 100mL THF dissolving, is heated to 65 ℃ of reactions 18 hours.After reacting completely, reactant is cooled to room temperature, and with ether (3*100mL) extracting, merges organic facies, and washs with saline (40mL).Sodium sulfate (40g) drying.Filter concentrated organic facies.Crude product obtains sterling 6b (5.5g, productive rate are 35.9%) with 60-120 order silica gel purification (4% ether/normal hexane). ¹H-NMR(CDCl ₃，400MHz)，δ＝3.70-3.50(m，1H)，1.55-1.35(m，4H)，1.35-1.20(m，48H)，0.90-0.80(m，6H)。

Step 2: carbonic acid-O-p-nitrophenyl, O '-15-nonacosyl diester (7b) synthetic

Add 15-nonacosanol (6b) (0.6g, 1.4mmol) in the 100mL flask, with anhydrous DCM (25mL) dissolving, then add chloro-carbonic acid-4-nitro phenyl ester (0.93g, 4.3mmol) and TEA (0.8mL).Room temperature reaction spends the night.After reacting completely, reactant liquor saturated common salt water washing (30mL * 3), anhydrous sodium sulfate drying filters and is spin-dried for solvent and obtains crude product.Crude product column purification (mobile phase is 4% diethyl ether hexane solution) obtains product 7b (0.56g, productive rate are 66.3%). ¹H-NMR(CDCl ₃，400MHz)，δ＝8.35-8.25(m，2H)，7.45-7.35(m，2H)，4.90-4.80(m，1H)，1.8-1.6(m，4H)，1.50-1.20(m，48H)，0.90-0.75(m，6H)。

Synthesizing of step 3:N-(poly glycol monomethyl ether base) carbamic acid-15-nonacosanol ester (8b)

Add carbonic acid-O-p-nitrophenyl in the 100mL flask, O '-15-nonacosyl diester (7b) (0.50g, 0.83mmol) and DCM (20mL) are behind the material dissolution, add amido modified poly glycol monomethyl ether (0.8g, 0.40mmol).Room temperature reaction 2 days.Reactant liquor saturated common salt water washing (30mL * 3), anhydrous sodium sulfate drying filters and is spin-dried for solvent and obtains crude product.Crude product column purification (mobile phase is the DCM solution of 0-4% methanol) obtains product 8b (0.48g, productive rate are 46.2%). ¹H-NMR(CDCl ₃，400MHz)，δ＝4.75-4.65(m，1H)，3.70-3.20(m，PEG-CH ₂)，1.8-1.6(m，4H)，1.50-1.20(m，48H)，0.90-0.75(m，6H)。

Embodiment 4

The synthesis step of N-(poly glycol monomethyl ether base) carbamic acid cholesteryl ester (cholesterol methoxy poly (ethyleneglycol) 2000carbamate, PEG-Chol, 8c) is as follows:

Step 1: carbonic acid-O-p-nitrophenyl, O '-cholesterol diester (7c) synthetic

Add cholesterol 6c (0.6g, 1.5mmol) in the 100mL flask, with anhydrous DCM (20mL) dissolving, then add chloro-carbonic acid-4-nitro phenyl ester (0.62g, 3.1mmol) and TEA (0.8mL).Room temperature reaction spends the night.After reacting completely, reactant liquor saturated common salt water washing (30mL * 3), anhydrous sodium sulfate drying filters and is spin-dried for solvent and obtains crude product.Crude product column purification (mobile phase is 4% diethyl ether hexane solution) obtains product 7c (0.35g, productive rate are 42.3%). ¹H-NMR(CDCl ₃，400MHz)，δ＝8.35-8.25(m，2H)，7.45-7.35(m，2H)，5.55-5.45(m，1H)，4.65-4.50(m，1H)，2.50-0.80(m，40H)，0.65-0.60(m，3H)。

Step 2:N-(poly glycol monomethyl ether base) carbamic acid cholesteryl ester 8c's is synthetic

Add carbonic acid-O-p-nitrophenyl in the 100mL flask, O '-cholesterol diester 7c (0.30g, 0.54mmol) and DCM (20mL) behind the material dissolution, add amido modified poly glycol monomethyl ether (1.0g, 0.50mmol).Room temperature reaction 2 days.Reactant liquor saturated common salt water washing (30mL * 3), anhydrous sodium sulfate drying filters and is spin-dried for solvent and obtains crude product.Crude product column purification (mobile phase is the DCM solution of 0-4% methanol) obtains product 8c (0.60g, productive rate are 47.0%). ¹H-NMR(CDCl ₃，400MHz)，δ＝5.55-5.45(m，1H)，4.65-4.50(m，1H)，3.40-3.20(m，PEG-CH ₂)，2.50-0.80(m，40H)，0.65-0.60(m，3H)。

Embodiment 5

4-(N, N-dimethyl amido) butanoic acid-6,9,28,31-tetraene-19-three Heptadecyl alcohol ester (heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino) butanoate, CL01) synthetic, reaction equation is as follows:

Formula 6

Add product 6a (5g in the 100mL flask, 9.5mmol) be dissolved among the DCM (40mL), add raw material 9 (4-(dimethylamino) butyrate hydrochlorate) and (1.9g11.4mmol), then add diisopropyl ethyl amine (2.5mL) and DMAP (0.14g1.4mmol).Behind the stirring at room 5min, add EDCHCl (2.78g, 14.5mmol) in the solution, stirred overnight at room temperature.After reacting completely, solution dilutes with 20mL DCM.Then use the saturated NaHCO of 16mL ₃, the washing of 16mL water and 16mL saturated common salt, anhydrous Na ₂SO ₄Drying is filtered, and concentrated organic facies obtains the about 6.25g of thick product.(90g silica gel contains the DCM upper prop of 0.1%TEA with 210mL to use the Flash column purification; Mobile phase is respectively: the DCM of 140mL0.1%TEA; 560mL2% methanol+98% contains the DCM of 0.1%TEA; 140mL2.5% methanol+97.5% contains the DCM of 0.1%TEA; 420mL3% methanol+97% contains the DCM of 0.1%TEA) separate and to obtain pure product 10 (CL01,5.5g, 91%) colorless oil product. ¹H-NMR(CDCl ₃，400MHz)，δ＝5.47-5.24(m，8H)，4.93-4.77(m，1H)，2.85-2.66(m，4H)，2.37-2.22(m，4H)，2.12-1.91(m，9H)，1.85-1.69(m，2H)，1.49(d，J＝5.4，4H)，1.39-1.17(m，39H)，0.90-0.80(m，6H)。

Embodiment 6

Synthesizing of 3-(N, N-dimethyl amido) propanoic acid-cholesteryl ester (cholesteryl3-(dimethylamino) propanoate, CL06), reaction equation is as follows:

Formula 7

Add product cholesterol (1.1g in the 100mL flask, 2.84mmol) be dissolved among the DCM (20mL), add raw material 11 (4-(dimethylamino) propionate hydrochlorate) (0.7g4.55mmol), then add diisopropyl ethyl amine (1mL) and DMAP (0.056g, 0.56mmol).Behind the stirring at room 5min, add EDCHCl (1.1g, 5.6mmol) in the solution, stirred overnight at room temperature.After reacting completely, solution dilutes with 20mL DCM.Then use the saturated NaHCO of 16mL ₃, the washing of 16mL water and 16mL saturated common salt, anhydrous Na ₂SO ₄Drying is filtered, and concentrated organic facies obtains the about 1.1g of thick product.(90g silica gel contains the DCM upper prop of 0.1%TEA with 210mL to use the Flash column purification; Mobile phase is respectively: the DCM of 140mL0.1%TEA; 560mL2% methanol+98% contains the DCM of 0.1%TEA; 140mL2.5% methanol+97.5% contains the DCM of 0.1%TEA; 420mL3% methanol+97% contains the DCM of 0.1%TEA) separate and to obtain pure product 12 (CL06,600mg, 43.6%). ¹H-NMR(CDCl ₃，400MHz)，δ＝5.55-5.45(m，1H)，4.65-4.50(m，1H)，2.6(m，2H)，2.5(m，2H)，2.3(m，2H)，2.2(m，6H)，2.50-0.80(m，28H)，0.65-0.60(m，3H)。

Embodiment 7

Synthesizing of 2-(N, N-dimethyl amido) acetic acid-cholesteryl ester (cholesteryl2-(dimethylamino) acetate, CL08), reaction equation is as follows:

Formula 8

Add product cholesterol (1.1g in the 100mL flask, 2.84mmol) be dissolved among the DCM (20mL), add raw material 13 (4-(dimethylamino) propionate hydrochlorate) (0.7g, 5.0mmol), then add diisopropyl ethyl amine (1mL) and DMAP (0.056g, 0.56mmol).Behind the stirring at room 5min, add EDCHCl (1.1g, 5.6mmol) in the solution, stirred overnight at room temperature.After reacting completely, solution dilutes with 20mL DCM.Then use the saturated NaHCO of 16mL ₃, the washing of 16mL water and 16mL saturated common salt, anhydrous Na ₂SO ₄Drying is filtered, and concentrated organic facies obtains the about 1.1g of thick product.(90g silica gel contains the DCM upper prop of 0.1%TEA with 210mL to use the Flash column purification; Mobile phase is respectively: the DCM of 140mL0.1%TEA; 560mL2% methanol+98% contains the DCM of 0.1%TEA; 140mL2.5% methanol+97.5% contains the DCM of 0.1%TEA; 420mL3% methanol+97% contains the DCM of 0.1%TEA) separate and to obtain pure product 14 (CL08,1000mg, 74.6%). ¹H-NMR(CDCl ₃，400MHz)，δ＝5.55-5.45(m，1H)，4.65-4.50(m，1H)，3.3(m，2H)，2.4(m，6H)，2.50-0.80(m，28H)，0.65-0.60(m，3H)。

Embodiment 8

Synthesizing of 3-(N, N-dimethylamino)-1,2-PD two inferior oily ethers (1,2-Dilinoleyloxy-N, N-dimethyl-3-aminopropane, DLinDMA), reaction equation is as follows:

Formula 9

Under the nitrogen protection, add in the 100mL flask NaH (986mg, 80%, 32.3mmol) and anhydrous benzene.Stir lower anhydrous benzene (10mL) solution that in reaction bulb, adds 3-(N, N-dimethylamino) propylene glycol (401mg, 33.7mmol).Stirring at room 15min.Inferior oily bromine (3g, 9.15mmol) is dissolved in the anhydrous benzene (16mL), drops in the reaction bulb.Behind the stirring at room 30min, reflux 2 days.After reacting completely, be cooled to room temperature, reactant liquor ethanol toluene mixture liquid (1: Isosorbide-5-Nitrae 0mL) process.Organic facies water (25mL) washes twice, and saturated brine (30mL) washes twice, anhydrous sodium sulfate drying.Solvent evaporated obtains crude product (3.1g), the Flash column purification, and mobile phase is MeOH/DCM (0-3%), obtains sterling (1.1g, 39.1%). ¹H-NMR(CDCl ₃，400MHz)，δ＝5.47-5.24(m，8H)，3.65-3.5(m，7H)，2.85-2.66(m，4H)，2.45(m，2H)，2.3(s，6H)，2.1(m，8H)，1.5(m，4H)，1.4-1.2(m，38H)，0.9(t，6H)。

Embodiment 9

N-(2,3-20 tetraether propyl group) carbamic acid poly glycol monomethyl ether ester (N-[(methoxypoly (ethylene glycol) 2000) carbamoyl]-1,2-dimyristyloxypropyl-3-amine, PEG-c-DMA) synthesis step as follows:

Step 1:DMA's is synthetic, and reaction equation is as follows:

Formula 10

1.DMPO-Allyl preparation

3-pi-allyl oxygen-1; 2-propylene glycol (9.24g; 70mmol); 1-bromotetradecane (61.0g; 213mmol) and potassium hydroxide (90% purity; mixture 16g) places anhydrous benzene (500mL), flows through next time night (17hrs) in argon (Ar) protection, and removes with the Dean-Stark part flow arrangement and to anhydrate.Behind the mixture cool to room temperature, with the dilution of 200mL benzene.Three times (3 * 150mL), twice (2 * 150mL), rear usefulness is got anhydrous magnesium sulfate drying to the extraction of organic facies (oil phase) difference water in the strong brine extraction.Solvent removed in vacuo gets the limpid yellow oil of 56g.Silicagel column purification (particle diameter 230-400mesh, consumption 1400mL), mobile phase is 0-5% ethyl acetate/hexane gradient elution.End-product DMPO-Allyl is 35g, yield 95%.

2.DMPO preparation

The 40mL trifluoroacetic acid is joined in the alcoholic solution of DMPO-Allyl (30g, 57mmol) (500mL).After adding four (triphenyl phosphorus) palladiums (9.0g, 7.8mmol), reactant mixture lead to argon (Ar) black out backflow spend the night (16hrs).After the backflow, vacuum is removed solvent, gets brown oil.Crude product silicagel column purification (particle diameter 230-400mesh, consumption 1400mL), mobile phase is 0-1% methanol/DCM gradient elution.End-product DMPO is yellow wax, gets 17.8g, yield 64%.

3.DMPO-Ms preparation

Under argon (Ar) protection, 6mL pyridine (74mmol) is added drop-wise in anhydrous methylene chloride (150mL) solution of methanesulfonic acid acid anhydride (96% purity, 13.0g, 71.6mmol).In this suspension, add the DMPO (17.8g, 36.7mmol) that is dissolved in anhydrous methylene chloride (150mL).Reactant mixture ambient temperature overnight under argon (Ar) protection stirs (17hrs).After the reaction, reactant mixture dilutes with the 200mL dichloromethane, successively water (200mL) extraction three times, and strong brine (200mL) extraction one time, rear with anhydrous magnesium sulfate (MgSO ₄) drying.The solvent distillation is removed, and gets yellow wax-like crude product DMPO-Ms20.9g.Thick product is not done purification, uses as next step reactant.

4.DMPI preparation

Upper step crude product DMPO-Ms (20.8g, 37mmol) mixes with phthalimide potassium (18g, 97mmol) in 400 milliliters of DMF solution, after 70 ℃ of stirred overnight (20hrs), gets yellow suspension under argon (Ar) protection.Behind the solution cool to room temperature, pour in the 800mL frozen water.Water ethyl acetate extraction three times (350ml).The organic facies that merges three extractions is used respectively deionized water (300mL) extraction one time, and strong brine (300mL) extraction one time is rear with anhydrous magnesium sulfate (MgSO ₄) drying.Vacuum is removed solvent, gets the mixture of grease and solid.Mixture is dissolved in the 500ml hexane, filters out insoluble matter, again with the flushing of 100mL hexane.The hexane filter liquor distillation of collecting gets wax crude product 19.6g.Crude product silicagel column purification (particle diameter 230-400mesh, consumption 600mL), mobile phase is 0-5% ethyl acetate/hexane gradient elution.Get sterling white wax DMPI12.7g, yield 56%.

5.DMA preparation

Above-mentioned DMPI (12.7g, 20.7mmol) and hydrazine hydrate (15.0mL, 310mmol) are dissolved in alcoholic solution (300mL), and refluxed overnight (16hrs) produces a large amount of white decorating films.Behind the suspension cool to room temperature, decorating film filters with ethanol (100mL) and cleans twice.Collect filter liquor, ethanol distillation is fallen.Residue is dissolved in the 500mL chloroform, and insoluble matter (white solid) again filters and cleans one time with chloroform (100mL).The chloroform that merges uses deionized water (200mL) to clean twice mutually, and strong brine (200mL) cleans one time, and uses anhydrous magnesium sulfate drying.After the solvent distillation, get light oily crude product 10.1g.Silicagel column purification (particle diameter 230-400mesh, consumption 300mL), mobile phase is 0-10% methanol/chloroform gradient elution.Sterling DMA is light grease, obtains 9.55g, yield 95%.

Step 2:PEG-c-DMA's is synthetic, and reaction equation is as follows:

Formula 11

In mono methoxy polyethylene glycol 2000 (28g, 14mmol) dissolving and the 150mL temperature anhydrous benzene, solvent distills to remove residual moisture.Product is dissolved in the 250mL anhydrous methylene chloride.In the situation of full argon, add trichloromethyl chloroformate (6.92g, 35mmol), stirring at room 3 hours.After the solvent vacuum distilling is removed, add the 150ml anhydrous benzene in reactant, the vacuum distilling solvent is until drying.In the situation that argon fills, in the reactant that obtains, add DMA (9.5g, 20mmol are dissolved in the 200mL anhydrous methylene chloride) solution, and then add anhydrous triethylamine (3.9mL, 28mmol).The reactant mixture ambient temperature overnight stirs (18 hours).Product is diluted with the 250mL dichloromethane.Organic facies extracts with 1%HCl aqueous solution (200ml), the rear deionized water (200mL) of using respectively, 0.1% sodium carbonate liquor (200mL), deionized water (200mL) and strong brine (200mL) are washed and are dripped, and use at last anhydrous magnesium sulfate drying.After distilling solvent, get light pulpous state crude product 44g.Crude product uses first silicagel column purification (particle diameter 230-400mesh), consumption 1600mL.Mobile phase is 0-10% methanol/chloroform gradient elution, gets the mixture of product P EG-c-DMA and unreacted DMA, is white in color or faint yellow wax.Wax-like mixture adds the 150ml ether, dissolves unreacted DMA.Filter to collect white solid, and wash droplet twice with ether (150mL), vacuum drying gets 30.7g sterling (white powder), yield 87%. ¹H?NMR(400MHz，CDCl ₃)δ：5.11(1H，m，NH)，4.17(2H，m，CH ₂)，3.80-3.1(8H，m)，3.60(130H，s，OCH ₂CH ₂O)，3.34(3H，s，OCH ₃)，2.42(2H，m，NCH ₂)，1.49(4H，m，2x?CH ₂)，1.21(44H，s，22x?CH ₂)，0.84(6H，t，2x?CH ₃)ppm。

Embodiment 10

Liposomal formulation F113 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: CL01, embodiment 5 preparations; The second positive lipid: CL08, embodiment 7 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-c-DMA, embodiment 9 preparations.

1.1.2TNS available from Sigma-Aldrich company, other biochemical reagents: dehydrated alcohol, methanol, chloroform, citric acid, sodium citrate, NaCl etc. are import or domestic analytical reagent.

1.2ApoB-siRNA, synthetic by Biomics Bioisystech Co., Ltd, the lyophilized powder state, its sequence is:

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

1.3 main material: ion exchange column: Vivapure D Mini H (U.S. Sartorius stedim company), Ultracel-100 centrifugal ultrafiltration pipe (U.S. Millipore company), dialyzer: Nuclepore MembraneCircles (80nm) (U.S. Whatman company), bag filter and syringe-driven filter are available from giving birth to the biological company limited of worker, bag filter MD24 (MW:20000, the graceful biology of upper Hypon), syringe-driven filter (worker is given birth in Shanghai), 50mL Falcon manages (U.S. Corning company)

1.4 key instrument: vortex oscillation device (U.S. VWR company), thermostat water bath (the grand instrument in sky, Jiangsu), centrifuge (U.S. Eppendorf company), ultraviolet-visible spectrophotometer (upper Nereid section), magnetic stirring apparatus (Mei Ying Pu, Shanghai instrument), NLI liposome extruder (Canadian ATS company), superclean bench (Suzhou purification), High speed refrigerated centrifuge (Saite Hunan instrument), spectrofluorophotometer (RF-5301PC, Japanese Shimadzu company) etc.

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.1.1siRNA dissolving buffer (10mM citric acid, 30mM NaCl, pH6.0): with water for injection or without the preparation of the water of RNase, adjust behind the pH value with 0.22 μ m membrane filtration, after the packing-20 ℃ frozen.

2.1.2 the preparation buffer (the 50mM citric acid, pH4.0): the same 2.1.1 of preparation method.

2.1.3 dialysis buffer liquid: 1 * phosphate buffer (phosphate-buffered saline, PBS) (Biomics Bioisystech Co., Ltd).

2.2siRNA liquid storage preparation:

2.2.1 dissolving siRNA: with 10mM citric acid/30mM NaCl, the theoretical final concentration of the solution preparation of pH6.0 is the ApoB-siRNA liquid storage of 50mg/mL.

2.2.2 get an amount of ApoB-siRNA liquid storage, with 2000 times of PBS dilutions, for detection of siRNA concentration.Each sample is done three Duplicate Samples.

2.2.3 UV spectrophotometer measuring A ₂₆₀Value, and calculate the actual concentrations of ApoB-siRNA liquid storage, as shown in table 1, i.e. A ₂₆₀Value * 50g/mL per OD * 2000/1000=64.62mg/mL.

The A that table 1.ApoB-siRNA measures ₂₆₀Value

2.3 preparation lipid liquid storage:

2.3.1 with the first positive lipid, the second positive lipid, phospholipid, long-acting lipid before weighing at the about 30min of equilibrium at room temperature.

2.3.2 the first positive lipid is mixed with the liquid storage of 40mg/mL with 100% ethanol, and the second positive lipid is mixed with the liquid storage of 20mg/mL with 100% ethanol, DSPC is mixed with the liquid storage of 20mg/mL with 100% ethanol.Long-acting lipid is mixed with the liquid storage of 50mg/mL with 100% ethanol.

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 2.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 2.F113 preparation

Cumulative volume: 4.0mL

2.4.2 preparation siRNA Liposomal formulation:

The volume required PFV of packing packs in the 50mL Falcon pipe, pre-equilibration 4～5min in 35 ℃ of water-baths.The ApoB-siRNA liquid storage of 34 μ L (64.62mg/mL) is mixed with siRNA/ preparation buffer/alcoholic solution of 0.8mL, guarantees that ethanol accounts for 30% of cumulative volume.Then siRNA/ preparation buffer/alcoholic solution is slowly joined among the above-mentioned PFV, hatch 30min for 35 ℃.Hatch and get 600 μ L after finishing and hatch product and be used for A ₂₆₀Analyze.With the bag filter MD24 above-mentioned siRNA Liposomal formulation of dialysing, 1 * PBS dialysed overnight, reclaim the dialysis afterproduct, filter the dialysis afterproduct with 0.2 μ m syringe-driven filter and carry out filtration sterilization, get 600 μ L degerming afterproducts and be used for the envelop rate detection.

2.4.3 entrapment efficiency determination:

Liposome encapsulation is measured and free drug need to be separated with liposome.The Vivapure DMini H microtrabeculae that we use is commercially available anion-exchange column, free siRNA itself is electronegative, by will be owing to electrostatic interaction is adsorbed on the post behind the ion exchange column, and be positioned at the inside of cationic-liposome by the siRNA that cationic-liposome wraps up, can't be incorporated on the post, can separate with free siRNA through centrifugal.Get 300 μ L degerming afterproducts and cross Vivapure D Mini H (ion exchange column), be sample behind the chromatography, the use of exchange column operates to specifications.Remaining 300 μ L are sample before the chromatography.

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

The sample preparation of table 3.OD pH-value determination pH

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), the result is as shown in table 4.

The A of table 4. Liposomal formulation F113 ₂₆₀Value

3) envelop rate calculates:

According to the actual A that records ₂₆₀Value is calculated actual concentrations (mg/mL) * 0.03 (mL) * 1000/ (siRNA Liposomal formulation cumulative volume (mL) * the hatch product A of the ApoB-siRNA liquid storage volume (mL) of actual concentrations coefficient (mg/mL)=adding * ApoB-siRNA liquid storage ₂₆₀Value * 1.1 (mL)), calculate the actual concentrations coefficient and be: 53.90, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 4 with this coefficient calculations.According to siRNA concentration, the computational envelope rate, envelop rate is defined as: envelop rate=(the medicine total amount in the drug/lipid body preparation of sealing in the liposome) * 100%.Computing formula is: sample siRNA concentration=0.188/0.277 * 100%=67.9% before sample siRNA concentration/chromatography behind envelop rate=chromatography, and envelop rate is 67.9%, the ApoB-siRNA concentration of sealing is 0.188mg/mL.

2.4.4PFV pKa detect:

Utilize fluorescent dye 6-p-totuidine base-2-LOMAR PWA EINECS 246-676-2 potassium salt (6-[(4-methylphenyl) amino]-2-na, TNS) not luminous in aqueous solution or only have faint fluorescence, and in organic environment, it has the characteristic of very strong fluorescence to measure the pKa value of PFV.If in the cation lipid liquid solution, add TNS, because TNS is electronegative, can be enriched in the surface of liposome and send fluorescence, and free TNS is not luminous in aqueous solution, so the fluorescence intensity of solution (in finite concentration) is directly proportional with the quantity of surface of liposome positive charge.Like this, by fluorescence intensity, just can obtain degree of ionization amino in the cationic-liposome.And according to the definition of dissociation constant, when the degree of ionization of weak acid in solution was 50%, the pH value of solution was this sour pKa value as can be known.As from the foregoing, if by fluorescent intensity pH value is mapped, the pH value of gained fluorescent intensity mid point is the apparent pKa value of this cationic solution.

Concrete assay method is: each 2mL of PBS solution (pH value is respectively 2.5,3.0,3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0,7.5,8.0,8.5,9.0,9.5,10.0,10.5,11.0, regulates pH value with HCl and NaOH) that 1) adds different pH value in sample bottle.2) each adds the sodium chloride solution of 3.85M of acetic acid ammonia solution, 80 μ L of 250mM of HEPES solution, 80 μ L of 250mM of 250mM4-morpholino b acid solution, 80 μ L of 80 μ L and the PFV of 60 μ L successively in each sample bottle.3) be the 83.5 μ MTNS solution that add 40mL in 2.5 the sample bottle at pH value, after stirring 30s, solution is taken out, with its emitted luminescence intensity of fluorescence spectrophotometer measurement (excitation wavelength is 321nm, and emission wavelength is 445nm) 4) according to the method described above, measure the emitted luminescence intensity of TNS under the different pH value, and take pH value as the x axle, the emission light intensity is the mapping of y axle, and wherein the strong midpoint pH value of utilizing emitted light is the apparent pKa value of PFV, and calculating the pKa value is 6.55.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 67.92nm and 63.17nm.

Embodiment 11

Liposomal formulation F115 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: CL01, embodiment 5 preparations; The second positive lipid: CL06, embodiment 6 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-c-DMA, embodiment 9 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.2.3 UV spectrophotometer measuring A ₂₆₀Be worth, and calculate the actual concentrations of ApoB-siRNA liquid storage, i.e. A ₂₆₀Value * 50g/mL per OD * 2000/1000=64.62mg/mL.

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 5.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 5.F115 preparation

Cumulative volume: 4.0mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

Get 300 μ L degerming afterproducts and cross Vivapure D Mini H (ion exchange column), be sample behind the chromatography, the use of exchange column operates to specifications.Remaining 300 μ L are sample before the chromatography.

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), as shown in table 6.

The A of table 6. Liposomal formulation F115 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 52.26, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 6 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 55.4%, and the ApoB-siRNA concentration of sealing is 0.148mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 7.32.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 65.43nm and 69.37nm.

Embodiment 12

Liposomal formulation F120 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: CL01, embodiment 5 preparations; The second positive lipid: CL06, embodiment 6 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-DLM, embodiment 2 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.2.3 UV spectrophotometer measuring A ₂₆₀Value, and calculate the actual concentrations of ApoB-siRNA liquid storage, as shown in table 7, i.e. A ₂₆₀Value * 50g/mL per OD * 2000/1000=38.51mg/mL.

The A that table 7.ApoB-siRNA measures ₂₆₀Value

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 8.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 8.F120 preparation

Cumulative volume: 4.0mL

2.4.2 preparation siRNA Liposomal formulation:

The volume required PFV of packing packs in the 50mL Falcon pipe, pre-equilibration 4～5min in 35 ℃ of water-baths.The ApoB-siRNA liquid storage of 52 μ L (38.51mg/mL) is mixed with siRNA/ preparation buffer/alcoholic solution of 0.8mL, guarantees that ethanol accounts for 30% of cumulative volume.Then siRNA/ preparation buffer/alcoholic solution is slowly joined among the above-mentioned PFV, hatch 30min for 35 ℃.Hatch and get 600 μ L after finishing and hatch product and be used for A ₂₆₀Analyze.With the bag filter MD24 above-mentioned siRNA Liposomal formulation of dialysing, 1 * PBS dialysed overnight, reclaim the dialysis afterproduct, filter the dialysis afterproduct with 0.2 μ m syringe-driven filter and carry out filtration sterilization, get 600 μ L degerming afterproducts and be used for the envelop rate detection.

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), as shown in table 9.

The A of table 9. Liposomal formulation F120 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 35.25, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 9 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 55.4%, and the ApoB-siRNA concentration of sealing is 0.073mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 7.42.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 61.85nm and 111.5nm.

Embodiment 13

Liposomal formulation F121 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: CL01, embodiment 5 preparations; The second positive lipid: CL06, embodiment 6 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-DMM, embodiment 3 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.1 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 10.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 10.F121 preparation

Cumulative volume: 4.0mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 11.

The A of table 11. liposome medicament preparation F121 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 49.07, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 11 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 36.6%, and the ApoB-siRNA concentration of sealing is 0.2764mg/mL.

2.4.4PFV pKa detect

With embodiment 9, recording the pKa value is 7.45.

2.4.5 granularmetric analysis

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 58.90nm and 68.03nm.

Embodiment 14

Liposomal formulation F122 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: CL01, embodiment 5 preparations; The second positive lipid: CL08, embodiment 7 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-DLM, embodiment 2 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 12.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 12.F122 preparation

Cumulative volume: 4.0mL

2.4.2 preparation siRNA Liposomal formulation:

The volume required PFV of packing packs in the 50mL Falcon pipe, pre-equilibration 4～5min in 35 ℃ of water-baths.The ApoB-siRNA liquid storage of 52 μ L (38.51mg/mL) is mixed with siRNA/ preparation buffer/alcoholic solution of 0.8mL, guarantees that ethanol accounts for 30% of cumulative volume.Then siRNA/ preparation buffer/alcoholic solution is slowly joined among the above-mentioned PFV, hatch 30min for 35 ℃.Hatch and get 600 μ L after finishing and hatch product and be used for A ₂₆₀Analyze.With the bag filter MD24 above-mentioned siRNA Liposomal formulation of dialysing, 1 * PBS dialysed overnight, reclaim the dialysis afterproduct, filter the dialysis afterproduct with 0.2 μ m syringe-driven filter and carry out filtration sterilization, get 600 μ L degerming afterproducts and be used for the envelop rate detection.2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 13.

The A of table 13. liposome medicament preparation F122 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 41.46, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 13 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 71.5%, and the ApoB-siRNA concentration of sealing is 0.1856mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 6.65.

2.4.5 granularmetric analysis

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 57.00nm and 68.88nm.

Embodiment 15

Liposomal formulation F123 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: CL01, embodiment 5 preparations; The second positive lipid: CL08, embodiment 7 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-DMM, embodiment 3 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 14.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 14.F123 preparation

Cumulative volume: 2mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 15.

The A of table 15. liposome medicament preparation F123 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 41.9, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 15 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 87.8%, and the ApoB-siRNA concentration of sealing is 0.1969mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 6.58.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 60.84nm and 69.43nm.

Embodiment 16

Liposomal formulation F128 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: CL01, embodiment 5 preparations; The second positive lipid: CL06, embodiment 6 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-chol, embodiment 4 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.1 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 16.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 16.F128 preparation

Cumulative volume: 2mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 17.

The A of table 17. liposome medicament preparation F128 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 42.40, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 17 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 89.3%, and the ApoB-siRNA concentration of sealing is 0.2301mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 7.56.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 84.01nm and 67.52nm.

Embodiment 17

Liposomal formulation F129 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: CL01, embodiment 5 preparations; The second positive lipid: CL08, embodiment 7 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-chol, embodiment 4 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 18.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 18.F129 preparation

Cumulative volume: 2mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 19.

The A of table 19. liposome medicament preparation F129 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 40.13, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 19 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 98.2%, and the ApoB-siRNA concentration of sealing is 0.2474mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 6.74.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 102.2nm and 66.07nm.

Embodiment 18

Checking Liposomal formulation F113, the effectiveness of F115

1 main agents, material and instrument

1.1 main agents, material: Liposomal formulation F113 (embodiment 9 preparations), F115 (embodiment 10 preparations), sodium chloride injection (the healthy and free from worry pharmaceutcal corporation, Ltd in Shandong), RISO ^TMRNA extracts reagent (hundred Ao Maike), EzOmics ^TMOne-Step qPCR kit (Biomics Bioisystech Co., Ltd), 1mL asepsis injector (He'nan Shuguang Medical Equipment Co., Ltd.), T-CHOL (CHO enzyme process) testing cassete (biology is built up in Nanjing).

1.2 laboratory animal: 4-6 ICR mice in age in week, female, 18-22g is available from Nantong University comparative medicine center.

1.3 key instrument: LightCycler480 real-time fluorescence quantitative PCR instrument (U.S. Roche company), ultraviolet-visible spectrophotometer UV759s (upper Nereid section).

2 experimental techniques

2.1 experiment grouping: weighing Mouse Weight before the administration, divide into groups by body weight, be divided into 3 groups, be respectively the F113 group, the F115 group, the normal saline group, injection volume is as follows:

The F113 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the Liposomal formulation F113;

The F115 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the Liposomal formulation F115;

Normal saline group: inject 300 μ L sodium chloride injections.

2.2 administration: with the fixing mice of mouse fixing device, be that 3mg/kg carries out drug administration by injection by mouse tail vein with the 1mL asepsis injector by siRNA amount in the Liposomal formulation, matched group is injected 300 μ L sodium chloride injections.

2.3 the mice serum total cholesterol level detects

48h weighing Mouse Weight after the administration gathers mouse blood by winning eyeball, and about 800 μ L place 1h for 4 ℃, and 3000rpm is centrifugal, and 10min isolates serum, and is to be detected.The mice serum of getting 10 μ L separation carries out serum total cholesterol by T-CHOL (CHO enzyme process) testing cassete description and detects, and measures the 500nm absorbance.

The cholesterol level computational methods are: cholesterol level=(working sample A ₅₀₀Value/standard substance A ₅₀₀Value) * concentration of standard solution (concentration of standard solution: 200mg/dL (5.17mM)).

2.4 real-time quantitative PCR (Real time quantity PCR, RT-qPCR) detects the mrna expression level of ApoB gene in the mouse liver

48h behind the injecting lipid body preparation puts to death mice, dissects mice and gets 3 block organizations from the different parts of liver, uses RISO ^TMRNA extracts reagent, extracts to specifications total RNA of mouse liver tissue, detects the mrna expression level of mouse liver ApoB gene with RT-qPCR.

With the expression of ApoB gene mRNA in the gene-specific primer detection sample, the house-keeping gene GAPDH that increases simultaneously contrasts as confidential reference items.Each sample increase simultaneously TF gene and reference gene GAPDH, each reaction do 3 parallel.Carry out quantitative response with One-Step qPCR kit, set up following reaction system: 2 μ L RNA templates, 12.5 2 * Master Mix of μ L, 5 ' end primer (10 μ M) and 3 ' each 0.5 μ L of end primer (10 μ M), 0.5 50 * SYBR Green I Solution of μ L uses without the water of RNase and supplies system to 25 μ L.Behind the mix homogeneously, place on the real-time PCR and react.

5 ' the end primer that detects the ApoB gene mRNA is: AAGCACCTCCGAAAGTACGTG, 3 ' end primer is: CTCCAGCTCTACCTTACAGTTGA.5 ' the end primer that detects house-keeping gene GAPDH is: GTATGACTCCACTCACGGCAAA, 3 ' end primer is: GGTCTCGCTCCTGGAAGATG.Required primer is synthetic by Biomics Bioisystech Co., Ltd.

Reaction condition: 42 ℃ of reverse transcription 30min, 95 ℃ of denaturation 5min, 95 ℃ of degeneration 20sec, 58 ℃ of annealing 30sec, 72 ℃ are extended 30sec, circulate 45 times.And do the solubility curve reaction: 95 ℃/5min, 58 ℃/5min, be warming up to 95 ℃ with 0.5 ℃/5sec.

2.5 statistical disposition

Analyze with the SPSS14.0 statistical software, continuous data is used Expression, many group differences significance test one factor analysis of variance, relatively with the t check, P＜0.05 expression difference has statistical significance between two groups.

3 experimental results

3.1 Mouse Weight changes, and detects respectively the variation of Mouse Weight before and after the injecting lipid body preparation, can indirect reaction toxicity, and as shown in Figure 1, each group Mouse Weight before and after administration shows that without significant change Liposomal formulation is without overt toxicity.

3.2 total cholesterol level changes, and as shown in Figure 2, compares with matched group, Liposomal formulation F113 and F115 have all reduced the total cholesterol level in the mice serum (* P＜0.05) simultaneously.

3.3ApoB the mRNA level of gene changes, as shown in Figure 3, Liposomal formulation F113 and F115 establishment the expression (* P＜0.05) of liver ApoB mRNA.

Experimental result to sum up, Liposomal formulation F113 and F115 can transfer to target tissue or organ such as siRNA with nucleic acid drug, and can effectively bring into play the function of nucleic acid drug.

Embodiment 19

The effectiveness of checking Liposomal formulation F121, F123, F128 and F129

1 main agents, material and instrument

1.1 main agents, material: Liposomal formulation F121 embodiment 12 preparation), F123 embodiment 14 preparations), F128 embodiment 15 preparations) and F129 (embodiment 16 preparations), sodium chloride injection (the healthy and free from worry pharmaceutcal corporation, Ltd in Shandong), RISO ^TMRNA extracts reagent (hundred Ao Maike), EzOmics ^TMOne-Step qPCR kit (Biomics Bioisystech Co., Ltd), 1mL asepsis injector (He'nan Shuguang Medical Equipment Co., Ltd.), T-CHOL (CHO enzyme process) testing cassete (biology is built up in Nanjing).

2 experimental techniques

2.1 experiment grouping: weighing Mouse Weight before the administration, divide into groups by body weight, be divided into 5 groups, be respectively the F121 group, the F123 group, the F128 group, the F129 group, the normal saline group, injection volume is as follows:

The F121 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F121;

The F123 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F123;

The F128 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F128;

The F129 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F129;

Normal saline group: inject 300 μ L sodium chloride injections.

2.2 administration: with the fixing mice of mouse fixing device, be that 3mg/kg carries out drug administration by injection by mouse tail vein with the 1mL asepsis injector by siRNA amount in the Liposomal formulation, matched group is injected 300 μ L sodium chloride injections.2.3 the mice serum total cholesterol level detects

2.4RT-qPCR the mrna expression level of ApoB gene in the detection mouse liver

2.5 statistical disposition

Analyze with the SPSS14.0 statistical software, continuous data is used

Expression, many group differences significance test one factor analysis of variance, relatively with the t check, P＜0.05 expression difference has statistical significance between two groups.

3 experimental results

3.1 Mouse Weight changes, and detects respectively the variation of Mouse Weight before and after the injecting lipid body preparation, can indirect reaction toxicity, and as shown in Figure 4, each group Mouse Weight before and after administration shows that without significant change Liposomal formulation is without overt toxicity.

3.2 total cholesterol level changes, and as shown in Figure 5, compares with matched group, Liposomal formulation F121, F123, F128 and F129 have all reduced the total cholesterol level in the mice serum (* P＜0.05) simultaneously.

3.3ApoB the mRNA level of gene changes, as shown in Figure 6, Liposomal formulation F121, F123, F128 and F129 establishment the expression (* P＜0.05) of liver ApoB mRNA.

Experimental result to sum up, Liposomal formulation F121, F123, F128 and F129 can transfer to target tissue or organ such as siRNA with nucleic acid drug, and can effectively bring into play the function of nucleic acid drug.

Embodiment 20

The effectiveness of checking Liposomal formulation F120, F122

1 main agents, material and instrument

1.1 main agents, material: Liposomal formulation F120 (embodiment 12 preparations), F122 (embodiment 14 preparations), sodium chloride injection (the healthy and free from worry pharmaceutcal corporation, Ltd in Shandong), RISO ^TMRNA extracts reagent (hundred Ao Maike), EzOmics ^TMOne-Step qPCRkit (Biomics Bioisystech Co., Ltd), 1mL asepsis injector (He'nan Shuguang Medical Equipment Co., Ltd.), T-CHOL (CHO enzyme process) testing cassete (biology is built up in Nanjing).

2 experimental techniques

2.1 experiment grouping: weighing Mouse Weight before the administration, divide into groups by body weight, be divided into 3 groups, be respectively the F120 group, the F122 group, the normal saline group, injection volume is as follows:

The F120 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F120;

The F122 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F122;

Normal saline group: inject 300 μ L sodium chloride injections.

2.3 the mice serum total cholesterol level detects

48h weighing Mouse Weight after the administration gathers mouse blood by winning eyeball, and about 800L places 1h for 4 ℃, and 3000rpm is centrifugal, and 10min isolates serum, and is to be detected.The mice serum of getting 10 μ L separation carries out serum total cholesterol by T-CHOL (CHO enzyme process) testing cassete description and detects, and measures the 500nm absorbance.

2.4RT-qPCR the mrna expression level of ApoB gene in the detection mouse liver

2.5 statistical disposition

3 experimental results

3.1 Mouse Weight changes, and detects respectively the variation of Mouse Weight before and after the injecting lipid body preparation, can indirect reaction toxicity, and as shown in Figure 7, each group Mouse Weight before and after administration shows that without significant change Liposomal formulation is without overt toxicity.

3.2 total cholesterol level changes, and as shown in Figure 8, compares with matched group, Liposomal formulation F120, F122 have all reduced the total cholesterol level in the mice serum (* P＜0.05) simultaneously.

3.3ApoB the mRNA level of gene changes, as shown in Figure 9, Liposomal formulation F120, F122 establishment the expression (* P＜0.05) of liver ApoB mRNA.

Experimental result to sum up, Liposomal formulation F120, F122 can transfer to target tissue or organ such as siRNA with nucleic acid drug, and can effectively bring into play the function of nucleic acid drug.

Embodiment 21

Liposomal formulation F157 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: DLinDMA, embodiment 8 preparations; The second positive lipid: CL08, embodiment 7 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-c-DMA, embodiment 9 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 20.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 20.F157 preparation

Cumulative volume: 4mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 21.

The A of table 21 liposome medicament preparation F157 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 33.78, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 21 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 66.4%, and the ApoB-siRNA concentration of sealing is 0.155mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 5.97.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 74.00nm and 66.29nm.

Embodiment 22

Liposomal formulation F159 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: DLinDMA, embodiment 8 preparations; The second positive lipid: CL08, embodiment 7 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-DMM, embodiment 3 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

1.3 main material: ion exchange column: Vivapure D Mini H (U.S. Sartorius stedim company), Ultracel-100 centrifugal ultrafiltration pipe (U.S. Millipore company), dialyzer: Nuclepore MembraneCircles (80nm) (U.S. Whatman company), bag filter and syringe-driven filter are available from giving birth to the biological company limited of worker, bag filter MD24 (MW:20000, the graceful biology of upper Hypon), syringe-driven filter (worker is given birth in Shanghai), 50mLFalcon manages (U.S. Corning company)

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 22.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 22.F159 preparation

Cumulative volume: 4mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 23.

The A of table 23. liposome medicament preparation F159 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 39.43, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 23 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 64.6%, and the ApoB-siRNA concentration of sealing is 0.183mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 6.01.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 74.25nm and 65.01nm.

Embodiment 23

Liposomal formulation F165 preparation

1 main agents, material and instrument

1.1 main agents:

1.1.1 lipid: the first positive lipid: DLinDMA, embodiment 8 preparations; The second positive lipid: CL06, embodiment 6 preparations; Phospholipid: DSPC is available from Shanghai Advanced viecle Technology Co., Ltd.; Long-acting lipid: PEG-c-DMA, embodiment 9 preparations.

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 24.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 24.F165 preparation

Cumulative volume: 4mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 25.

The A of table 25. liposome medicament preparation F165 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 36.95, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 25 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 59.4%, and the ApoB-siRNA concentration of sealing is 0.3375mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 6.87.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 71.72nm and 64.39nm.

Embodiment 24

Liposomal formulation F167 preparation

1 main agents, material and instrument

1.1 main agents:

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 26.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 26.F167 preparation

Cumulative volume: 4mL

2.4.2 preparation siRNA Liposomal formulation:

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), such as table 27.

The A of table 27. liposome medicament preparation F167 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 36.87, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 27 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 46.6%, and the ApoB-siRNA concentration of sealing is 0.293mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 6.83.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 67.81nm and 64.75nm.

Embodiment 25

The effectiveness of checking Liposomal formulation F157, F159, F165, F167

1 main agents, material and instrument

1.1 main agents, material: Liposomal formulation F157 (embodiment 20 preparations), F159 (embodiment 21 preparations), F165 (embodiment 22 preparations), F167 (embodiment 23 preparations), sodium chloride injection (the healthy and free from worry pharmaceutcal corporation, Ltd in Shandong), RISO ^TMRNA extracts reagent (hundred Ao Maike), EzOmics ^TMOne-Step qPCRkit (Biomics Bioisystech Co., Ltd), 1mL asepsis injector (He'nan Shuguang Medical Equipment Co., Ltd.), T-CHOL (CHO enzyme process) testing cassete (biology is built up in Nanjing).

2 experimental techniques

2.1 experiment grouping: weighing Mouse Weight before the administration, divide into groups by body weight, be divided into 5 groups, be respectively F157, F159, F165, F167 group, the normal saline group, injection volume is as follows:

The F157 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F157;

The F159 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F159;

The F165 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F165;

The F167 group: injection volume is that 3mg/kg calculates by the amount of siRNA among the F167;

Normal saline group: inject 300 μ L sodium chloride injections.

2.3 the mice serum total cholesterol level detects

2.4RT-qPCR the mrna expression level of ApoB gene in the detection mouse liver

2.5 statistical disposition

3 experimental results

3.1 Mouse Weight changes, and detects respectively the variation of Mouse Weight before and after the injecting lipid body preparation, can indirect reaction toxicity, and as shown in figure 10, each group Mouse Weight before and after administration shows that without significant change Liposomal formulation is without overt toxicity.

3.2ApoB the mRNA level of gene changes, as shown in figure 11, Liposomal formulation F157, F159, F165, F167 establishment the expression (* P＜0.05) of liver ApoB mRNA.

Experimental result to sum up, Liposomal formulation F157, F159, F165, F167 can transfer to target tissue or organ such as siRNA with nucleic acid drug, and can effectively bring into play the function of nucleic acid drug.

Embodiment 26

Liposomal formulation F155 preparation

1 main agents, material and instrument

1.1 main agents:

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’；

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 28.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 28.F155 preparation

Cumulative volume: 3.0mL

2.4.2 preparation siRNA Liposomal formulation:

The volume required PFV of packing packs in the 50mL Falcon pipe, pre-equilibration 4～5min in 35 ℃ of water-baths.The ApoB-siRNA liquid storage of 19.7 μ L (64.62mg/mL) is mixed with siRNA/ preparation buffer/alcoholic solution of 0.8mL, guarantees that ethanol accounts for 30% of cumulative volume.Then siRNA/ preparation buffer/alcoholic solution is slowly joined among the above-mentioned PFV, hatch 30min for 35 ℃.Hatch and get 600 μ L after finishing and hatch product and be used for A ₂₆₀Analyze.With the bag filter MD24 above-mentioned siRNA Liposomal formulation of dialysing, 1 * PBS dialysed overnight, reclaim the dialysis afterproduct, filter the dialysis afterproduct with 0.2 μ m syringe-driven filter and carry out filtration sterilization, get 600 μ L degerming afterproducts and be used for the envelop rate detection.

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), shown in table 29.

The A of table 29. Liposomal formulation F155 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 49.61, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 29 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 80.9%, and the ApoB-siRNA concentration of sealing is 0.167mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 5.89.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 60.07nm and 63.63nm.

Embodiment 27

Liposomal formulation F156 preparation

1 main agents, material and instrument

1.1 main agents:

ApB-S：5’-GUCAUCACACUGAAUACCAAU-3’

ApB-AS：5’-AUUGGUAUUCAGUGUGAUGACAC-3’。

The preparation of 2 Liposomal formulations

2.1 reagent is prepared:

2.2siRNA liquid storage preparation:

2.3 preparation lipid liquid storage:

2.4 preparation Liposomal formulation:

2.4.1 prepare prefabricated empty pocket bubble (pre-formed vesicles, PFV):

The first positive lipid in each Liposomal formulation, the second positive lipid, phospholipid, long-acting lipid were by 40: 40: 10: 10 mol ratio is mixed with the lipid alcoholic solution with dehydrated alcohol, and each lipid aequum sees Table 30.After all lipid dissolvings, while stir above-mentioned lipid alcoholic solution is joined in the preparation buffer, the final concentration that makes ethanol is 30% (v/v).Under the room temperature, under the 200psi pressure condition, extrude with the NLI liposome extruder that two-layer NucleporeMembrane Circles is housed, namely obtain the PFV of uniform particle diameter.PFV through extruder measures its particle diameter with particle size analyzer.

Each lipid aequum in the table 30.F156 preparation

Cumulative volume: 3.0mL

2.4.2 preparation siRNA Liposomal formulation:

The volume required PFV of packing packs in the 50mL Falcon pipe, pre-equilibration 4～5min in 35 ℃ of water-baths.The ApoB-siRNA liquid storage of 24.5 μ L (64.62mg/mL) is mixed with siRNA/ preparation buffer/alcoholic solution of 0.8mL, guarantees that ethanol accounts for 30% of cumulative volume.Then siRNA/ preparation buffer/alcoholic solution is slowly joined among the above-mentioned PFV, hatch 30min for 35 ℃.Hatch and get 600 μ L after finishing and hatch product and be used for A ₂₆₀Analyze.With the bag filter MD24 above-mentioned siRNA Liposomal formulation of dialysing, 1 * PBS dialysed overnight, reclaim the dialysis afterproduct, filter the dialysis afterproduct with 0.2 μ m syringe-driven filter and carry out filtration sterilization, get 600 μ L degerming afterproducts and be used for the envelop rate detection.

2.4.3 entrapment efficiency determination:

1) presses table 3 preparation OD value (A ₂₆₀) working sample.

2) detect at ultraviolet spectrophotometer wavelength 260nm place light absorption value (n=3, every group establish two parallel), shown in table 31.

The A of table 31. Liposomal formulation F156 ₂₆₀Value

3) envelop rate calculates:

With embodiment 9, calculate the actual concentrations coefficient and be: 52.13, obtain hatching the actual siRNA concentration of sample behind product, the front sample of chromatography and the chromatography, result such as table 31 with this coefficient calculations.According to siRNA concentration, the computational envelope rate is 29%, and the ApoB-siRNA concentration of sealing is 0.073mg/mL.

2.4.4PFV pKa detect:

With embodiment 9, recording the pKa value is 6.33.

2.4.5 granularmetric analysis:

Detect the particle diameter of prefabricated empty pocket bubble and siRNA Liposomal formulation with the Nicomp370 particle size analyzer, be respectively 82.88nm and 69.70nm.

Embodiment 28

The effectiveness of checking Liposomal formulation F155, F156

1 main agents, material and instrument

1.1 main agents, material: Liposomal formulation F155 (embodiment 25 preparations), F156 (embodiment 26 preparations), sodium chloride injection (the healthy and free from worry pharmaceutcal corporation, Ltd in Shandong), RISO ^TMRNA extracts reagent (hundred Ao Maike), EzOmics ^TMOne-Step qPCR kit (Biomics Bioisystech Co., Ltd), 1mL asepsis injector (He'nan Shuguang Medical Equipment Co., Ltd.), T-CHOL (CHO enzyme process) testing cassete (biology is built up in Nanjing).

1.2 laboratory animal: 4-6 ICR mice in age in week, female, 18-22g is available from Nantong University comparative medicine center.1.3 key instrument: LightCycler480 real-time fluorescence quantitative PCR instrument (U.S. Roche company), ultraviolet-visible spectrophotometer UV759s (upper Nereid section).

2 experimental techniques

2.1 experiment grouping: weighing Mouse Weight before the administration, divide into groups by body weight, be divided into 3 groups, be respectively F155, F156 group, the normal saline group, injection volume is as follows:

The F155 group: injection volume is that 1mg/kg calculates by the amount of siRNA among the F155;

The F156 group: injection volume is that 1mg/kg calculates by the amount of siRNA among the F156;

Normal saline group: inject 300 μ L sodium chloride injections.

2.2 administration: with the fixing mice of mouse fixing device, be that 1mg/kg carries out drug administration by injection by mouse tail vein with the 1mL asepsis injector by siRNA amount in the Liposomal formulation, matched group is injected 300 μ L sodium chloride injections.

2.3 the mice serum total cholesterol level detects

2.4RT-qPCR the mrna expression level of ApoB gene in the detection mouse liver

2.5 statistical disposition

3 experimental results

3.1 Mouse Weight changes, and detects respectively the variation of Mouse Weight before and after the injecting lipid body preparation, can indirect reaction toxicity, and as shown in figure 12, each group Mouse Weight before and after administration shows that without significant change Liposomal formulation is without overt toxicity.

3.2ApoB the mRNA level of gene changes, as shown in figure 13, Liposomal formulation F155, F156 establishment the expression (* P＜0.05) of liver ApoB mRNA.

Experimental result to sum up, Liposomal formulation F155, F156 can transfer to target tissue or organ such as siRNA with nucleic acid drug, and can effectively bring into play the function of nucleic acid drug.

Liposome of the present invention is transmission preparation in a kind of body for the treatment of usefulness, carries out vivo medicine-feeding and transfers to target tissue after can wrapping the medicine carrying thing; When containing the medicine such as nucleic acid when this liposome, it has the disease treatment effect, can be by different mode administrations, as by vein, intestinal is outer or administration is carried out in the abdominal cavity.By above embodiment as can be known, by liposome provided by the invention, nucleic acid can transfer in the cell, in the cell such as some target tissues such as lung, liver or Inflamed tissues; Also can treat mammalian diseases, comprise that the Liposomal formulation of complementary two positive lipids, phospholipid, long-acting lipid can transfer to nucleic acid drug the disease target tissue, treatment by gene expression or cross express relevant cause disease.

Liposomal formulation provided by the invention can be liquid, such as dropping liquid emulsion, emulsion form or aerosol form; This Liposomal formulation can be solid also, it can be dissolved as liquid before the administration, and this solid can be used as the powder administration, and its form can be capsule, tablet or gel.

Claims

1. a Liposomal formulation is characterized in that, comprises complementary two positive lipid, phospholipid and long-acting lipid.

2. Liposomal formulation as claimed in claim 1 is characterized in that, the molar percentage of complementary two positive lipids, phospholipid and long-acting lipid is respectively 20～80%, 10% and 10% in the described Liposomal formulation.

3. Liposomal formulation as claimed in claim 1, it is characterized in that, the two positive lipids of described complementation comprise: the first positive lipid and the second positive lipid, and the first positive lipid and the molar percentage of the second positive lipid in Liposomal formulation are respectively 20～60%; The described first positive lipid is 4-(N, N-dimethyl amido) butanoic acid-6,9,28,31-tetraene-19-three Heptadecyl alcohol ester or N, N-dimethyl-2,3-two inferior oily oxygen base propylamine; The described second positive lipid is 3-(N, N-dimethyl amido) propanoic acid-cholesteryl ester or 2-(N, N-dimethyl amido) acetic acid-cholesteryl ester.

4. Liposomal formulation as claimed in claim 1 is characterized in that, described phospholipid is diacyl phosphatidyl choline.

5. Liposomal formulation as claimed in claim 1, it is characterized in that, described long-acting lipid is N-(2,3-20 tetraether propyl group) carbamic acid poly glycol monomethyl ether ester, N-(poly glycol monomethyl ether base) carbamic acid-6,9, in 28,31-tetraene-19-, three Heptadecyl alcohol esters, N-(poly glycol monomethyl ether base) carbamic acid cholesteryl ester and N-(poly glycol monomethyl ether base) carbamic acid-15-nonacosanol ester any one.

6. Liposomal formulation as claimed in claim 1 is characterized in that, also comprises a kind of medicine with therapeutic effect.

7. Liposomal formulation as claimed in claim 6 is characterized in that, described medicine is nucleic acid; Described nucleic acid is functional r NA and the version that contains modification or analogies and DNA and contains the version of modification or any one or a few the mixture in the analogies.

8. Liposomal formulation as claimed in claim 7 is characterized in that, described functional r NA is any one or a few the mixture in siRNA, miRNA, little part RNA and the RNA aptamers.

9. the preparation method of Liposomal formulation claimed in claim 1 is characterized in that, forms prefabricated empty pocket bubble after the solution mixing with complementary two positive lipids, phospholipid, long-acting lipid, then mixes with nucleic acid solution, forms the nucleic acid Liposomal formulation.

10. the application of each described Liposomal formulation of claim 1～9 in the relevant disease that treatment is caused by gene unconventionality expression.