CN102888403A - Application of micro ribonucleic acid (miRNA)-539 and miRNA-539antisense nucleotide, and medicinal composition for miRNA-539 antisense nucleotide - Google Patents

Abstract

The invention provides application of micro ribonucleic acid (miRNA)-539 and miRNA-539 antisense nucleotide, and a medicinal composition for the miRNA-539 antisense nucleotide, in particular application of the miRNA-539 antisense nucleotide to preparation of a medicine or a kit for preventing and treating heart diseases, and application of miRNA-539 to preparation of a medicine or a kit for diagnosis and/or prognosis estimation of heart diseases. The sequence of the miRNA-539 antisense nucleotide is a nucleotide sequence 5'-CCUCUUUCAAUAGGAACCACACA-3' shown as SEQ ID NO:1, wherein each basic group is subjected to 2'-O-methyl modification. The miRNA-539 antisense nucleotide has the effect of protecting a heart by inhibiting myocardium cell apoptosis, and also has potential value of preventing and treating different heart diseases.

Description

The purposes of miRNA-539 and antisense nucleotide thereof and its pharmaceutical composition

Technical field

The present invention relates to the new drug purposes of the little RNAs of a kind of endogenic non-coding, relate in particular to miRNA-539 and antisense nucleotide thereof the purposes in prevention or treatment heart disease, belong to diagnosis, prevention and the treatment field of heart disease.

Background technology

Cardiovascular disorder is the chief threat of human health and life, is the No.1 killer of human health, and have 1,007 million peoples to die from cardiovascular disorder every year in the worldwide, and its mortality ratio is near the summation of all cancer mortalities.In China, along with living standards of the people improve change with dietary structure day by day, the cardiovascular disorder mortality ratio is obvious ascendant trend, and surpassing cancer becomes the first cause of death.Recent statistics result according to health ministry announcement in the end of the year 2004 shows, China 18 years old and above prevalence of hypertension rate are 18.8%, estimate national number of patients more than 1.6 hundred million, the patient of the relevant heart diseases of apoptosis such as the myocardial hypertrophy that causes thus, myocardial infarction, coronary heart disease and heart failure reaches several ten million.Still imperfectly understand about the heart disease pathogeny at present, the prevention of heart disease, diagnosis and treatment still can not reach satisfactory effect, are badly in need of the new technology of exploitation, method for cardiopathic diagnosis, control.

MiRNA is a class endogenous non-coding small RNA molecular of recently studying discovery, and many miRNA of studies show that have vital role for keeping the heart normal physiological function, and the miRNA unconventionality expression in the heart is relevant with the generation of many heart diseases.Therefore, with the target spot of miRNA as cardiac disease treatment, the exploitation related drugs has potential clinical value.Single miRNA can act on the expression of the mRNA of a plurality of target genes simultaneously, and drug effect can be regulated the expression of a plurality of participation heart pathogenetic genes in a miRNA like this, affects a plurality of signal paths, reaches on the whole the purpose for the treatment of disease.Because miRNA expression level under the heart pathological state is different, therefore can come the predictive diagnosis disease by the expression level that detects miRNA.

Apoptosis (apoptosis) claims again apoptosis, be phalangeal cell under certain physiology or pathological conditions, follow the program of self, the process of own end lives.It is a process active, high-sequential, that participated in by Gene Handling and a series of enzyme, to normal embryo development, keep in cell colony and the malignant change process all playing an important role, in the healthy survival processes that guarantees multicellular organism, playing the part of crucial role.Under many myocardial damages or heart pathological state, such as myocardial ischemia reperfusion injury, myocardial hypertrophy, heart failure etc., the myocardial cell understands apoptosis.Because ripe myocardial cell can not division growth, myocardial cell's excessive Apoptosis will inevitably make myocardial cell's reduced number, and this point may be the mechanism of some heart diseases morbidities.At present research finds that many miRNA participate in apoptotic generation by the expression of the relevant target protein of modulating apoptosis, these miRNA have short apoptosis, also has to press down apoptosis.Seek miRNA specifically expressing, that participate in apoptosis of cardiac muscle in the heart, illustrate its mechanism of action, have and important meaning and application prospect for diagnosis, the treatment of exploitation take miRNA as the heart disease of strategy.

Summary of the invention

Therefore, the objective of the invention is to determine or find the miRNA of the specific heart expression of regulation and control apoptosis of cardiac muscle, further determine its keying action in the heart diseases such as myocardial ischemia-reperfusion, myocardial infarction, coronary heart disease, myocardial hypertrophy and myocardial fibrosis, apply it in the diagnosis, control of these heart diseases.

For above-mentioned purpose, technical scheme of the present invention is as follows:

On the one hand, the invention provides a kind of miRNA-539 antisense nucleotide, the sequence of described antisense nucleotide is the nucleotide sequence shown in the following SEQ ID NO:1:

5 '-CCUCUUUAAUAGGAACCACACA-3 ', wherein each base all carried out 2 '-the O-methyl modifies.

Another aspect the invention provides miRNA-539 antisense nucleotide of the present invention for the preparation of prevention or the treatment medicine of heart disease or the purposes in the test kit.

Also on the one hand, the invention provides a kind of miRNA-539 for the preparation of diagnosis and/or the medicine of prognosis evaluation heart disease or the purposes in the test kit, the sequence of described miRNA-539 is the nucleotide sequence shown in the following SEQ ID NO:2:

5’-UGUGUGGUUCCUAUUAAAGAGG-3’。

Preferably, described heart disease is selected from one or more in flesh infarct, treating myocardial ischemia damage, myocardial hypertrophy and the myocardial fibrosis.

On the other hand, the invention provides a kind of pharmaceutical composition for prevention or treatment heart disease, described pharmaceutical composition contains miRNA-539 antisense nucleotide of the present invention and pharmaceutically acceptable carrier, virus or auxiliary material.

Preferably, the content of described miRNA-539 antisense nucleotide is 0.5～1g/ml.

Preferably, described carrier is selected from one or more in chitosan, cholesterol, nano particle and the liposome.

Preferably, described pharmaceutical composition is with oral or injection system administration.

Preferably, described injection is intravenous injection, intramuscular injection, intracoronary injection or direct myocardial injection.

Again on the one hand, the invention provides a kind of test kit for preventing or treat the heart disease of heart disease, described test kit contains miRNA-539 antisense nucleotide of the present invention.

Also on the one hand, the invention provides a kind of test kit for diagnosis and/or prognosis evaluation heart disease, described test kit contains miRNA-539 Nucleotide or is used for probe or the primer of specific detection miRNA-539;

The sequence of described miRNA-539 is the nucleotide sequence shown in the following SEQ ID NO:2:

5’-UGUGUGGUUCCUAUUAAAGAGG-3’；

Described probe or primer are the nucleotide sequence shown in SEQ ID NO:5 or the SEQ ID NO:6.

Preferably, described heart disease is selected from one or more in flesh infarct, treating myocardial ischemia damage, myocardial hypertrophy and the myocardial fibrosis.

The present invention found through experiments miRNA-539 miRNA-539 in the apoptosis of cardiac muscle process for the treatment of myocardial ischemia damage and hypoxia inducible and expresses significantly rise.The expression that suppresses miRNA-539 by transfection and injection miRNA-539 antisense nucleotide can suppress apoptosis of cardiac muscle and treating myocardial ischemia damage, and myocardial infarction area reduces.

Above description of test miRNA-539 antisense nucleotide has provide protection by suppressing apoptosis of cardiac muscle to heart, and the miRNA-539 antisense nucleotide has potential prevention and therapeutic value to many heart diseases.The expression that gives miRNA-539 rising miRNA-539 then can be induced apoptosis of cardiac muscle, and treating myocardial ischemia damage can be more serious.

Concrete, the inventor finds that miRNA-539 antisense nucleotide (5 '-CCUCUUUAAUAGGAACCACACA-3 ') has provide protection by suppressing apoptosis of cardiac muscle to heart.Myocytes Anoxia or treating myocardial ischemia damage process miRNA-539 express significantly and raise, and the rise of miRNA-539 may have been induced the generation of apoptosis of cardiac muscle.MiRNA-539 is up-regulated in the cardiac muscular tissue of ischemia-reperfusion animal model, miRNA-539 can be used as the sign of diagnosis of heart disease, suppresses endogenic miRNA-539 mouse, can resist myocardial ischemia-reperfusion injury, myocardial infarction area reduces, and heart function significantly improves.The miRNA-539 antisense nucleotide is combined with suitable carrier forms medicine, import in heart or the body, will have prevention and therapeutic action to many heart diseases.Can consider the packings such as miRNA-539 antisense nucleotide and chitosan, cholesterol, liposome, nano particle are formed drug molecule, by oral, intravenous injection, intramuscular injection, intracoronary injection or the direct mode of myocardial injection, be used for the control heart disease, improve heart function, stop the generation of myocardial fibrosis and myocardial remodelling.

Description of drawings

Below, describe by reference to the accompanying drawings embodiment of the present invention in detail, wherein:

Fig. 1 shows the variation of miRNA-539 expression level in the apoptosis of cardiac muscle process for the treatment of myocardial ischemia damage and anaerobic treatment (Anoxia), wherein Figure 1A shows former generation Myocytes Anoxia processing miRNA-539 expression level, wherein ordinate zou represents take 0 minute miRNA-539 expression amount as benchmark, the expression amount of miRNA-539 under the different time in treating myocardial ischemia damage and anaerobic treatment process; Figure 1B shows mouse cardiac muscle ischemic injuries miRNA-539 expression level, and wherein ordinate zou represents take 0 minute miRNA-539 expression amount as benchmark, the expression amount of miRNA-539 under the different time in treating myocardial ischemia damage and anaerobic treatment process;

Fig. 2 shows the endogenic miRNA-539 of inhibition to the resistant function of apoptosis of cardiac muscle, and wherein Fig. 2 A represents that former generation myocardial cell transfection miRNA-539 antisense nucleotide (anta-539) suppresses the expression of endogenic miRNA-539; Fig. 2 B represents the impact on the apoptosis of cardiac muscle of hypoxia inducible, transfection NC is as negative control, wherein ordinate zou represents, in the apoptosis of cardiac muscle process with the benchmark that is expressed as of miRNA-539 among the myocardial cell who does not add any mass treatment, the expression amount of miRNA-539 in the different samples;

Fig. 3 shows that the miRNA-539 antisense nucleotide is to the resistant function for the treatment of myocardial ischemia damage; Wherein Fig. 3 A is the test-results of implementing the myocardial ischemia-reperfusion operation after the mouse cardiac muscle injection miRNA-539 antisense nucleotide, ARR/LV represents the hazardous area total area/left ventricle area, INF/AAR represents Infarct area/hazardous area total area, INF/LV represents Infarct area/left ventricle area, wherein every group from left to right is followed successively by the control group I that does not add any mass treatment, through the control group II (Con) of ischemia-reperfusion, through the negative control treatment group (NC) of ischemia-reperfusion with through the miRNA-539 of ischemia-reperfusion antisense nucleotide treatment group (Anta-539); Fig. 3 B detects the miRNA-539 antisense nucleotide to the test-results of myocardial infarction area after the mouse cardiac muscle injection miRNA-539 antisense nucleotide, wherein every group from left to right is followed successively by the control group I that does not add any mass treatment, through the control group II (Con) of ischemia-reperfusion, through the negative control treatment group (NC) of ischemia-reperfusion with through the miRNA-539 of ischemia-reperfusion antisense nucleotide treatment group (Anta-539); Fig. 3 C is the result of cardiomyocyte apoptosis after the mouse cardiac muscle injection miRNA-539 antisense nucleotide, wherein not add the in contrast group of any mass treatment.

Embodiment

Further describe the present invention below in conjunction with specific embodiment, advantage and disadvantage of the present invention will be more clear along with description.

Unless otherwise indicated, below the various experiment materials that relate among each embodiment, experimental technique and operation, comprise primary myocardial cell culture, infect myocardial cell's dosage, cell transfecting, the myocardial ischemia and reperfusion operating procedure, Evans blue/TTC is two to be dyed, TUNEL detects all can be referring to Publication about Document: Wang JX, et al, miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1.2011 January 17:71-78.Which is hereby incorporated by reference for above-mentioned document.

Unless otherwise indicated, below the test in used material: experimental animal is mouse, and its kind is that the mouse kind is C57/BL6, available from Beijing Medical University.

Unless specialize, used enzyme such as restriction enzyme, amplification enzyme and reversed transcriptive enzyme etc. in following examples are all available from Beijing Boao Biological Co., Ltd.

Unless specialize, used primer all entrusts the large gene of Beijing China to synthesize in following examples.

Unless specialize, used reagent is analytical pure level reagent in following examples, and can be commercially available from regular channel.

In the apoptosis of cardiac muscle process that experimental example 1 myocardial ischemia and Myocytes Anoxia are induced The miRNA-539 expression detects

For the apoptosis of cardiac muscle experimental model, the method that adopts this laboratory to set up is cultivated the former generation myocardial cell of rat suckling mouse, hypoxemia incubator (oxygen concn is lower than 1%) is cultivated different time, extract RNA, Real-Time Fluorescent Quantitative PCR Technique detection miRNA-539(SEQ ID NO:2:5 '-UGUGUGGUUCCUAUUAAAGAGG-3 ') expression level, PCR system 25 μ l, the PCR condition is as follows: circulation of 95 ℃ of 1min; 95 ℃ of 15s, 56 ℃ of 15sec, 72 ℃ of 1min totally 28 circulations; Last 72 ℃ are extended 5min, and the PCR design of primers is as follows, and amplified fragments is the complete encoding sequence SEQ ID NO:4 of 126bp(miRNA-539 approximately, and its sequence is TCACTCCCAAGAGGCCTATGGATGCTGGTATTCCTGCTGTGCTACTGTTTCATACTTGAGGAGAAATTATCCTTGGT GTGTTGGCTCTTTTGGATGAATCATACA AGGATAATTTCTTTTTGAGTA, the part of its acceptance of the bid underscore is the upstream and downstream primer, the C-terminal sequence reverse complemental of downstream primer and this sequence):

Upstream primer: 5 '-TCACTCCCAAGAGGCCTATGG-3 ' (SEQ ID NO:5),

Downstream primer: 5 '-TACTCAAAAAGAAATTATCCT-3(SEQ ID NO:6) '.The miRNA-539 expression level significantly raises (Figure 1A) in hypoxemia is processed 4h-8h.

This experiment adopts the Banded Rats coronary artery to set up myocardial infarction and ischemia model, ischemic different time core dirty ischemic region and non-ischemic region cardiac muscular tissue, extract total RNA, detect the expression level of miRNA-539 by Real-Time Fluorescent Quantitative PCR Technique, PCR system 25 μ l, the PCR condition is as follows: circulation of 95 ℃ of 1min; 95 ℃ of 15s, 56 ℃ of 15s, 72 ℃ of 1min totally 28 circulations; Last 72 ℃ are extended 5min), amplified fragments is 126bp(SEQ ID NO:4 approximately), the PCR design of primers is as follows

Upstream primer: 5 '-TCACTCCCAAGAGGCCTATGG-3 ' (SEQ ID NO:5),

Downstream primer: 5 '-TACTCAAAAAGAAATTATCCT-3 ' (SEQ ID NO:6).

The result shows that ischemic 30min-120min myocardial ischemia organizes more non-ischemic tissue and non-ischemia model group miRNA-539 expression level significantly to rise (Figure 1B), wherein organizes in contrast with sham operated rats (sham).

Experimental example 2miRNA-539 antisense nucleotide suppresses the experiment of apoptosis of cardiac muscle

Use the myocardial cell of former culture to be model in this experiment.(the miRNA-539 antisense base sequences is the sequence with the complete reverse complemental of miRNA-539 sequence to transfection miRNA-539 antisense nucleotide (this sequence by Shanghai JiMa pharmacy Technology Co., Ltd synthetic), 5 '-CAGUACUUUUGUGUAGUACAA-3 ' (SEQ ID NO:1, wherein each base all carried out 2 '-the O-methyl modifies.It can be combined to suppress with miRNA-539 the expression of miRNA-539), transfection assay can be referring to article (Wang JX, et al, miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1.2011 January 17:71-78).After the transfection 24 hours, in the hypoxemia incubator, cultivate and processed cell 3 hours, cell death inducing.Platform expects that blue dyeing process detects the apoptosis of cardiac muscle situation.The results are shown in Figure 2, the result shows that inhibition endogenous miRNA-539 can significantly suppress the apoptosis of cardiac muscle of hypoxia inducible.

Experimental example 3miRNA-539 antisense nucleotide suppresses the treating myocardial ischemia damage experiment

Take the C57/BL6 mouse as experimental subjects, every group of 8 mouse, the result who records is carried out statistical analysis (referring to Wang JX with one-way ANOVO statistical software, et al, miR-499 regulates mitochondrial dynamics by targeting calcineurin and dynamin-related protein-1.2011 January 17:71-78), by the following method respectively with 30mg/kgmiRNA-539 antisense nucleotide (anta-539) and its negative control (NC) injection mouse (this miRNA be, wherein each base all carried out 2 '-the O-methyl modifies, namely at the hydroxyl of 2 ' end of nucleic acid by methoxy substitution to strengthen the stability of nucleic acid.This modification is modified by Shanghai JiMa pharmacy Technology Co., Ltd, it does not suppress to have now the expression of known any gene, its sequence is SEQ ID NO:3:5 '-CAGUACUUUUGUGUAGUACAA-3 ', wherein each base all carried out 2 '-the O-methyl modifies).Mouse is weighed and anaesthetizes, and dorsal position is fixed, and cropping is also used the iodine disinfection field of operation.Neck medisection tracheae and intubate, interlock thing respirator carries out positive airway pressure, and at the left border of sternum place and the about 3cm of heartbeat place longitudinal incision skin, successively blunt separation subcutis, muscle are opened chest, carefully mention pericardium and cut off, and fully expose heart.In phosphate buffered saline buffer (PBS), will calculate antisense nucleotide (anta-539) and its negative control (NC) that needs by every mouse weight respectively, the dilution final volume is 200 μ L, enter the artery root by No. 26 conduits from the apex of the heart respectively again, aorta and pulmonary artery are closed in injection simultaneously folder, and lasting folder closed 20 seconds.Monitoring 5min treats that heart recovers Dou Lvhou, removes in the thoracic cavity hematocele and spends the needle applicator intake-gas and close the thoracic cavity.Deng mouse clear-headed after, separating respiratory machine is put back in the cage.The whole surgical procedure of electrocardiogram monitoring.

Injection antisense nucleotide (anta-539) and its negative control (NC) carry out the heart ischemia reperfusion operation after 3 days, concrete operations are as follows: behind the mouse anesthesia, experiment is fixed in on the plank in back of the body position, and carries out electrocardiogram monitoring.Neck medisection tracheae and intubate, interlock thing breathing apparatus opens chest in the 4th intercostal, carefully mentions pericardium and cuts off, and fully exposes heart, blood vessel.Between pulmonary conus and left auricle of heart, take the great cardiac vein trunk as sign, in 2mm place, left auricle of heart root below inserting needle, depth of needle 0.5mm; Pass myocardium top layer with 6/0 band pin suture line, at pulmonary artery cone branch pin; After electrocardiogram(ECG recovers to stablize 10min, give ligation ramus descendens anterior arteriae coronariae sinistrae (LAD).With I, the aVL ST-Segment back of a bow upwards raise greater than 0.1mv and more than the lasting 0.5h as the sign of ligation success.After the ischemic 45min, unclamp ligature and begin to pour into again.Drop to sign with the ST section.Remove in the thoracic cavity hematocele and spend the needle applicator intake-gas and close the thoracic cavity.Pour into again 24 hours with the two mensuration myocardial infarction areas that dye of Evans blue/TTC.The result shows: the mouse I/R group myocardial infarction area of injection miRNA-539 antisense nucleotide obviously reduces than wild mouse I/R group, and significant difference (p＜0.01) is arranged, and sees Fig. 3 A.

Heart stalk area calculates as follows: left ventricle area (left ventricle, LV) is blue, red and white area sum; The hazardous area total area (area at risk, AAR) is red and white area sum; Infarct area (infarct area, INF) is white area.Dangerous area (AAR/LV, %)=(the hazardous area total area/left ventricle area) * 100%, heart stalk area (INF/AAR, %)=(Infarct area/hazardous area total area) * 100%.Detected again simultaneously the impact of injection miRNA-539 antisense nucleotide on the apoptosis of I/R, detect (Fig. 3 B) with TUNEL, the result shows that the miRNA-539 antisense nucleotide can significantly suppress the generation of the apoptosis of cardiac muscle that myocardial ischemia-reperfusion causes, wherein organizes in contrast with sham operated rats.

Above presentation of results mouse underwent coronary injection miRNA-539 antisense nucleotide can significantly suppress myocardial ischemia-reperfusion injury.

Claims (10)

1. miRNA-539 antisense nucleotide, the sequence of described antisense nucleotide is the nucleotide sequence shown in the following SEQ ID NO:1:

5 '-CCUCUUUAAUAGGAACCACACA-3 ', wherein each base all carried out 2 '-the O-methyl modifies.

2. miRNA-539 antisense nucleotide according to claim 1 is for the preparation of prevention or the treatment medicine of heart disease or the purposes in the test kit.

3. a miRNA-539 is for the preparation of diagnosis and/or the medicine of prognosis evaluation heart disease or the purposes in the test kit, and the sequence of described miRNA-539 is the nucleotide sequence shown in the following SEQ ID NO:2:

5’-UGUGUGGUUCCUAUUAAAGAGG-3’。

4. according to claim 2 or 3 described purposes, it is characterized in that, described heart disease is selected from one or more in flesh infarct, treating myocardial ischemia damage, myocardial hypertrophy and the myocardial fibrosis.

5. a pharmaceutical composition that is used for prevention or treatment heart disease is characterized in that, described pharmaceutical composition contains miRNA-539 antisense nucleotide claimed in claim 1 and pharmaceutically acceptable carrier, virus or auxiliary material.

6. pharmaceutical composition according to claim 5 is characterized in that, the content of described miRNA-539 antisense nucleotide is 0.5～1g/ml.

7. according to claim 5 or 6 described pharmaceutical compositions, it is characterized in that, described carrier is selected from one or more in chitosan, cholesterol, nano particle and the liposome.

8. each described pharmaceutical composition in 7 according to claim 5 is characterized in that, described pharmaceutical composition is with oral or injection system administration; Preferably, described injection is intravenous injection, intramuscular injection, intracoronary injection or direct myocardial injection.

9. test kit that is used for prevention or treatment heart disease, described test kit contains miRNA-539 antisense nucleotide claimed in claim 1.

10. test kit that is used for diagnosis and/or prognosis evaluation heart disease, described test kit contains miRNA-539 Nucleotide or is used for probe or the primer of specific detection miRNA-539;

The sequence of described miRNA-539 is the nucleotide sequence shown in the following SEQ ID NO:2:

5’-UGUGUGGUUCCUAUUAAAGAGG-3’；

Described probe or primer are the nucleotide sequence shown in SEQ ID NO:5 or the SEQ ID NO:6;

Preferably, described heart disease is selected from one or more in flesh infarct, treating myocardial ischemia damage, myocardial hypertrophy and the myocardial fibrosis.

Images