CN102876786B - Kit for detecting natriuretic peptide precursor A (NPPA) gene polymorphism by pyro-sequencing method and method - Google Patents

Abstract

The invention discloses a kit for detecting natriuretic peptide precursor A (NPPA) gene polymorphism by pyro-sequencing method and a method. By the kit, the NPPA gene polymorphism, particularly rs5065(G)T) single nucleotide polymorphism is detected. The kit comprises primers which are shown as SEQ ID NO.2-4. By the kit, the accurate, quick and high-throughout detection of NPPA gene polymorphism can be realized, so that safe, reasonable and effective individual administration of substrates can be realized.

Description

Tetra-sodium sequencing detects test kit and the method for NPPA gene pleiomorphism

Technical field

The invention belongs to biology field, the concrete test kit and the method that relate to tetra-sodium sequencing detection NPPA gene pleiomorphism.

Background technology

NPPA genes encoding ANP precursor, ANP(atrial natriuretic peptide) play diuretic(s) effect, it regulates ECFV and ionogen stable state.

Calcium ion antagonist is the chemicals reducing blood pressure by retardance calcium channel.It can enter (being again calcium channel blocker, calcium antagonists) in cell by the calcium channel of selectivity inhibition Ca2+ on cytolemma, there is vasodilation and negative inotropic action, lax vascular smooth muscle, reduce peripheral vascular resistance, thereby reduce blood pressure, but brain, coronary artery and renal blood flow do not reduce.Calcium antagonist suppresses myocardium convergent force and conduction, and the contraction that suppresses vascular smooth muscle is expanded blood vessel.Nifedipine, amlodipine are the hypertensive calcium ion antagonists for the treatment of of commonly using.

Diuretic(s) is mainly by promoting cylinder electrolyte (sodium ion is main) and moisture to discharge, making hypovolemia, blood pressure drops, and this medicine hypotensive effect is gentleer, and effect is lasting.Thiazide diuretic treatment hypertension, is specially adapted to light moderate hypertension patient,, the patient of isolated systolic hypertension in old people, obesity and hypertensive patients heart failure is of a specified duration.Although this medicine because of cheap this medicine be a kind of medicine and the low price that hyperpietic's common drug is conventional, some patients were takes this medicine effect not as other patients.

Studies have shown that NPPA T2238C genic mutation type patient is good to the more responsive result for the treatment of of the reaction of hydragog(ue), and not mutated patient is to using cerebrocrast effect better, detect NPPA genotype and be conducive to the antihypertensive drug that patient selects to be suitable for oneself, prevent the generation of side reaction at a specified future date.NPPA gene T2238C variation with CHD, cerebral apoplexy, full cause death; the Different therapeutical effect associated that merges CHD and merging cardiovascular diseases and different pharmaceutical; for TT genotype patient, select amlodipine by being better than other diuresis classes and angiotensin-convertion enzyme inhibitor (JAMA.2008; 299 (3): 253).

The test kit of developing quick, efficient, accurate, convenient, economic detection NPPA gene pleiomorphism will play positive pushing effect for the clinical individualized treatment of its substrate medicine.

Tetra-sodium order-checking (Pyro sequencing) technology is DNA sequence analysis technology of new generation, and this technology need not be carried out electrophoresis, and DNA fragmentation also need not fluorescent mark, is a kind of universal technology platform.Easy and simple to handle, the feature such as testing cost is low, required sample size is little, quick, accurate, high-throughput that this technology has, meets Big Clinical Samples testing requirement.

Summary of the invention

The present invention aims to provide a kind of test kit and the method that tetra-sodium sequencing detects NPPA gene (SEQ ID NO.1) polymorphism, to realize its substrate of quick, easy, accurate, efficient, practical, economic detection (as hydragog(ue) etc.) personalized medicine genes involved SNP.

In order to achieve the above object, technical scheme provided by the invention is: a kind of tetra-sodium sequencing detects the test kit of NPPA gene pleiomorphism, comprises following primer:

(1) amplimer:

Upstream primer: 5 '-ACA GGA GCC TCT TGC AGT CT-3 ' (SEQ ID NO.2);

Downstream primer:: 5 '-ACC AAG CCA GAT ATG TCT GTG TTC-3 ' (SEQ ID NO.3);

Wherein, 5 of downstream primer ' carry out biotin labeling;

(2) sequencing primer: 5 '-TCT GTG TTC TCT TTG CAG TA-3 ' (SEQ ID NO.4);

In test kit, other reagent and solution are the conventional reagent of PCR and the order-checking of DNA tetra-sodium.Apply the method that mentioned reagent box detects NPPA gene pleiomorphism, comprise the steps:

(1) DNA extraction;

(2) polymerase chain reaction:

Prepare 50 μ l pcr amplification systems, comprise: 10 * PCR buffer, 5.0 μ l, dNTP 1.5 μ l, upstream primer 0.5 μ l, downstream primer 0.5 μ l, rTaq0.5 μ l, water 40 μ l, template 2.0 μ l; Cycling program is: 95 ° of C 5min denaturations; Successively at 95 ° of C 30S, 55 ° of C 30S, 72 ° of C 15S, carry out 35 circulations; 72 ° of C keep 5min, finally remain on 4 ° of C, obtain amplified production;

(3) tetra-sodium order-checking strand sample purifying;

(4) tetra-sodium order-checking and interpretation of result.

Test kit of the present invention is analyzed and is detected NPPA RS5065 target sequence, and this target sequence comprises: wild-type TCCCTGGCTGTTATCTTCAGTACTGCAAAGAGAACACAG(SEQ ID NO.5) and saltant type TCCCTGGCTGTTATCTTCGGTACTGCAAAGAGAACACAG(SEQ ID NO.6).

Owing to having designed the high primer of specificity, and select suitable method, test kit of the present invention to be applicable to NPPA gene pleiomorphism to carry out rapid detection, can be widely used in the gene test of NPPA substrate medicine personalized medicine solution formulation clinically.Compared with prior art, its application tetra-sodium sequencing technologies can carry out short dna sequential analysis quickly and accurately, is convenient to build normalizing operation flow process; There is the features such as high-throughput, low cost; PCR product can be directly used in order-checking, does not need to carry out the secondary treatments such as product purification, operates very easyly, and required sample size is little.

Accompanying drawing explanation

Fig. 1 is NPPA of the present invention (rs5065) wild-type homozygote tetra-sodium sequencing result.

Embodiment

Below in conjunction with embodiment, mentioned reagent box and detection method are described in detail.

Embodiment 1:

NPPA-pyroF(upstream primer): 5 '-ACA GGA GCC TCT TGC AGT CT-3 ' (SEQ ID NO.2);

NPPA-pyroR(downstream primer): 5 '-ACC AAG CCA GAT ATG TCT GTG TTC-3 ' (SEQ ID NO.3);

Sequencing primer: 5 '-TCT GTG TTC TCT TTG CAG TA-3 ' (SEQ ID NO.4);

1.DNA extracts

Before 1.1 experiments, reagent material is prepared with inspection work as follows:

(1) check the test kit quality guaranteed period and guarantee to have added in Wash Buffer 1 and 2 ethanol, and respective identification place ticks √ on bottle; (2) Virahol (as nothing, available dehydrated alcohol substitutes) and 75% ethanol; (3) pipe of the 1.5mL Eppendorf in autoclaving validity period and all kinds of liquid transfer gun head.

1.2 take out the EDTA anticoagulant tube that whole blood is housed from 4 ℃ of refrigerators, turn upside down and mix for several times;

1.3 manage corresponding sample uniqueness sign at 1.5mL Eppendorf carries out mark;

1.4 pipette respectively the 1.5mL Eppendorf pipe that 900uL Cell Lysis Solution adds to sterilizing;

1.5 carefully pipette the 1.5mL EP pipe that 300uL whole blood is transferred to the above-mentioned Cell of being added with Lysis Solution;

1.6 cover Eppendorf pipe lid, incubated at room 10min;

Centrifugal 20 seconds of 1.713,000rpm room temperature;

1.8 take out Eppendorf pipe, observe white precipitate;

1.9 open Eppendorf pipe lid, hand-held pipe bottom, and the inclination EP mouth of pipe discards the red supernatant of part, red supernatant is exhausted as far as possible;

1.10 cover Eppendorf pipe, with finger attack EP pipe bottom, make white precipitate resuspended;

1.11 pipette 300uL Nuclei Lysis Solution enters in above-mentioned Eppendorf pipe, covers pipe, turns upside down and mixes for several times;

1.12 open Eppendorf pipe, pipette 100uL Protein Precipitation Solution and enter in above-mentioned Eppendorf pipe, cover pipe pipe, and on vibrator, thermal agitation is 20 seconds; The centrifugal 3min of 13,000rpm room temperature;

1.13 pipette supernatant transfers to the new 1.5mL of sterilizing Eppendorf pipe;

1.14 pipette 300uL Virahol enters EP pipe, and lid upper tube cap, turns upside down and mix for several times, and visible white cotton-shaped gDNA separates out;

The centrifugal 1min of 1.1513,000rpm room temperature;

1.16 open Eppendorf pipe, and hand is pinched pipe bottom, inclination mouth of pipe supernatant discarded;

1.17 pipette 300uL 75% ethanol adds Eppendorf pipe, lid upper tube cap, the washing precipitation of softly turning upside down;

The centrifugal 1min of 1.1813,000rpm room temperature;

1.19 open Eppendorf pipe, hand-held pipe bottom, inclination mouth of pipe supernatant discarded;

1.20 place new filter paper on experiment table, and back-off Eppendorf pipe blots liquid, by Eppendorf pipe uncap be sidelong air-dry;

1.21 range estimation precipitation sizes, add 50 ~ 100ul DNA Rehydration Solution to precipitation;

1.22 spend the night carries out nucleic acid concentration mensuration with Nano-Space ultraviolet spectrophotometer after dissolving, nucleic acid concentration be greater than 50ng/ul be considered as qualified, as concentration is inadequate, add ethanol again to precipitate DNA, then again add appropriate DNA Rehydration Solution dissolving DNA.

1.23 cover SD sample exclusive number again at tube wall and pipe, and are wound around protection with scotch tape;

1.24 preserve nucleic acid sample to 4 ℃ refrigerator;

2. polymerase chain reaction

2.1 prepare 50 μ l pcr amplification systems (template add except) in reagent area in preparation, each component and addition are as following table:

10×PCRbuffer	5.0μl
		dNTP	1.5μl

NPPA-pyroF	0.5μl
		NPPA-pyroR (5 '-Bio mark)	0.5μl
rTaq	0.5μl
		Water	40μl

2.2 prepare district to filling the of short duration centrifugal rear interpolation 2.0 μ l of gDNA template to amplification system at sample, mark sample uniqueness sign on PCR tube wall, and pipe covers marker detection item designation.The concussion of PCR pipe mixes, of short duration centrifugal on desktop whizzer;

2.3 carry out pcr amplification reaction in amplification region, according to loop parameter below, amplification instrument is set:

Step number	Temperature	Treatment time	Cycle number
					1	95℃	5min
2	95℃	30s
				3	55℃	30s
4	72℃	15s	Goto step2，for 35cycle
				5	72℃	5min
6	18℃	holding

After 2.4 setting programs, in drop-down menu subsequently, select " tube ";

2.5 click " start " starts instrument operation.

3. tetra-sodium order-checking strand sample purifying

Before 3.1 purifying, reagent and instrument are prepared:

Carry out before sample purifying, guarantee that all solution all reaches room temperature; Open precise temperature control process furnace, make temperature reach 80 ℃.

3.2 strand sample purification process:

3.2.1 in PSQ 96 plates, first add 40 μ lAnnealing Buffer and 2 ~ 3 μ l sequencing primers (10uM);

3.2.2 on vibrator, fully mix Sepharose Beads;

3.2.3 required Sepharose Beads amount (every sample 3 μ l calculate) is transferred to 1.5mL Eppendorf pipe;

3.2.4 in Sepharose Beads, add Binding Buffer, make average each sample approximately have the volume the same with PCR system, on vibrator, mixture is fully mixed;

3.2.5 Sepharose Beads mixture is added in approximately 40 μ l PCR products, every sample adds 40 μ l;

3.2.6 under normal temperature, on vibrator, PCR plate is mixed to 10 minutes;

3.2.7 in Vacuum prep workstation, in four liquid tanks, add successively 180ml pure water, 120ml 70% ethanol, Denaturation Buffer and Washing Buffer;

3.2.8 outwell the waste liquid in the waste collection bucket being connected with vacuum pump;

3.2.9 open vacuum pump and the valve of Vacuum Prep Workstation, Vacuum Prep Tool is cleaned 30 seconds in pure water;

3.2.10 Vacuum prep Tool is moved on in PCR plate hole, capture the Sepharose Beads that combines biotin labeling nucleic acid;

3.2.11 pick up PCR plate, check whether Beads has all been attracted on Vacuum Prep Tool;

3.2.12 Vacuum Prep Tool is put into 70% ethanol 5 seconds;

3.2.13 Vacuum Prep Tool is moved on in Denatureation Buffer to 5 seconds;

3.2.14 again Vacuum Prep Tool is moved on in Washing Buffer and cleaned 10 seconds;

3.2.15 the outstanding Pyro Sptting plate that is placed on of Tool;

3.2.16Vacuum Prep Tool puts into the Sptting plate that contains sequencing primer, and rotation is shaken, to discharge Sepharose Beads;

3.2.17 PSQ 96 plates that are placed with purifying sample are placed on Thermo Plate, are placed in 80 ℃ of process furnace and heat 2min, naturally cool to room temperature after taking-up, carry out downstream Pyrosequencing reaction.

3.3 clean after purifying:

3.3.1 do not open vacuum pump and valve, use a small amount of pure water to clean Vacuum Prep Tool, the Beads not coming off is on a small quantity eluted;

3.3.2 after changing pure water, open again vacuum pump and valve, with about 300mL pure water, clean Tool;

3.3.3 turn off vacuum pump and valve, Vacuum Prep Tool is sidelong, room temperature is dried;

3.3.4 clean the plastic channel of all splendid attire reagent solutions, naturally dry;

3.3.5 with wet cloth wiping purifier apparatus surface.

4. tetra-sodium order-checking

4.1 call in the run program file of aforementioned setting, click the drop-down key of " View ", select " Run ", automatically calculate each using amount of reagent of this experiment according to software, add each reagent composition to agent bin;

The corresponding position of instrument is put in 4.2 ready samples and reagent cabin, and " Run " that click screen bottom righthand side starts tetra-sodium order-checking;

4.3 detected after, " close " key of first clicking software process status window is to preserve sequencing result.

5. tetra-sodium sequencing result is analyzed

In " SNP Runs " folder, double-click mouse, open above-mentioned operating file, select " SNP mode ", click " Analyze All " key, all detection samples are carried out to gene type assay; Select " AQmode ", click " Analyze All " key, all detection samples are carried out to gene frequency analysis.To pattern detection NPPA gene pleiomorphism, tetra-sodium detected result is as figure.Fig. 1 is that NPPA wild-type homozygote, Fig. 2 are NPPA saltant type heterozygote.Can find out, adopt test kit of the present invention and method, can simple and direct, intuitive and accurate NPPA genotype be detected and interpretation.Clinician can be according to NPPA genotype, the using dosage when judging different genotype patient and using the treatments such as hydragog(ue).

To sum up, the target sequence that the present invention is selected, and apply test kit of the present invention and can realize quick, easy, accurate, efficient, practical, economic detection NPPA genotype, can meet the requirement of Clinical Laboratory real work, the individuation that is beneficial to NPPA substrate (as diuretic(s) etc.) is used.

SEQUENCE LISTING

<110> Zhou Honghao

<120> tetra-sodium sequencing detects test kit and the method for NPPA gene pleiomorphism

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 401

<212> DNA

<213> homo sapiens

<400> 1

aggaagtcac catcaaacca ctttatctac agttagcata agatgtgaga agtgttgaca 60

ggaagctgca gcttagatgg gatgatcaca actccatggc aacaagatga cacaaatgca 120

gcagagaccc caggggacag gagcctcttg cagtctgtcc ctaggcccag ccctgcttgt 180

cctccctggc tgttatcttc rgtactgcaa agagaacaca gacatatctg gcttggtgac 240

ctggctgtcc tggaaaagtc agcttcatgt atgagtgtgc ccatcctctg aacttgatta 300

ctgaccacct gcttcccacc ggcccccacc ccagcctgat gaccctctga gcttcatgaa 360

ttgataagca agttactcat cagagtaaat ttcacttaag c 401

<210> 2

<211> 20

<212> DNA

<213> homo sapiens

<400> 2

acaggagcct cttgcagtct 20

<210> 3

<211> 24

<212> DNA

<213> homo sapiens

<400> 3

accaagccag atatgtctgt gttc 24

<210> 4

<211> 20

<212> DNA

<213> homo sapiens

<400> 4

tctgtgttct ctttgcagta 20

<210> 5

<211> 39

<212> DNA

<213> homo sapiens

<400> 5

tccctggctg ttatcttcag tactgcaaag agaacacag 39

<210> 6

<211> 39

<212> DNA

<213> homo sapiens

<400> 6

tccctggctg ttatcttcgg tactgcaaag agaacacag 39

Claims (2)

1. tetra-sodium sequencing detects a test kit for NPPA gene pleiomorphism, it is characterized in that, comprises following primer:

(1) amplimer:

Upstream primer: 5 '-ACA GGA GCC TCT TGC AGT CT-3 ';

Downstream primer: 5 '-ACC AAG CCA GAT ATG TCT GTG TTC-3 ';

Wherein, 5 ' of downstream primer carries out biotin labeling;

(2) sequencing primer: 5 '-TCT GTG TTC TCT TTG CAG TA-3 '.

2. primer as claimed in claim 1 detects the application in NPPA gene pleiomorphism reagent in preparation.

Images