CN102864085A - Rhodotorula minuta and separating and culturing method and application thereof - Google Patents
Rhodotorula minuta and separating and culturing method and application thereof Download PDFInfo
- Publication number
- CN102864085A CN102864085A CN2012103518210A CN201210351821A CN102864085A CN 102864085 A CN102864085 A CN 102864085A CN 2012103518210 A CN2012103518210 A CN 2012103518210A CN 201210351821 A CN201210351821 A CN 201210351821A CN 102864085 A CN102864085 A CN 102864085A
- Authority
- CN
- China
- Prior art keywords
- rhodotorula
- little
- little rhodotorula
- application
- peptone
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the technical field of living beings, in particular to rhodotorula minuta and a separating and culturing method and application thereof, and aims to separate, culture and purify a novel rhodotorula minuta strain which can cause human onychomycosis. The rhodotorula minuta is filed in CGMCC (China General Microbiological Culture Collection Center) by No.6019 on April 16, 2012. Morphological characteristics, culturing characteristics and carbon source utilization of the strain are researched further. The invention further provides the separating and culturing method of the strain and the application in screening antifungal drugs.
Description
Technical field
The present invention relates to biological technical field, be specifically related to a kind of little rhodotorula and isolation cultivation method and application.
Background technology
Little rhodotorula is the environment fungi; a few species is pathogenic bacterium; can cause immunosuppressed patient systemic infection (Thanos L; Mylona S; Kokkinaki A; Pomoni M, Tsiouris S, Batakis N.Multifocal skeletal tuberculosis with Rhodotorula minuta co-infection.Scand J Infect Dis.2006; 38 (4): 309-11.).
Mankind's tinea unguium is the fungi infestation of the deck He Jia undertissue that caused by pathogenic fungus.Tinea unguium mainly by Epidermophyton as trichophyton, alpha fungus etc., minority is caused by the filamentous fungus of yeast and non-dermatophytosis.Be a common disease, frequently-occurring disease.At present, clinical tinea unguium is divided into to 5 types: type (endonyx onychomycosis) and first damage type (total distropic onychomycosis) entirely in shallow vindication A type (superficial white onychomycosis), position, distal side first mo(u)ld bottom half (distal and lateral subungual onychomycosis), near-end first mo(u)ld bottom half (proximal subungual onychomycosis), first.This disease can occur in diabetes, immunocompromised patient and normal population bacterium.
There is no at present bibliographical information and separate the little rhodotorula that successfully can cause mankind's tinea unguium, and to the epidemiology of such little rhodotorula and the further investigation of mechanism of causing a disease.
Summary of the invention
The object of the invention is to little rhodotorula (Rhodotorula minuta) bacterial strain of new the caused mankind tinea unguium of separation and Culture purifying one strain, and its separation and Culture purification process is provided, and the application of this bacterial strain in the screening antifungal drug.
The invention provides the little rhodotorula of a strain (Rhodotorula minuta), on April 16th, 2012, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCCNo.6019.
This bacterial strain is separating obtained in a sick first of 15 years old immune normal female patient tinea unguium in Long March hospital dermatology department in 2011, through ITS order-checking and API 20C yeast identification kit, turns out to be little rhodotorula.
Little rhodotorula of the present invention (Rhodotorula minuta) bacterial strain CGMCC No.6019 belongs to Basidiomycota (Basidiomycota), load spore order (Sporidiales), Rhodotorula (Rhodotorula).
1. morphological specificity:
Sick first with 10%KOH, process after under light microscopic visible little, ellipsoideus yeast, 3.5-6.5 * 3.5 μ m.
2. cultural characteristic:
This bacterium can be leached substratum (MEA at Fructus Hordei Germinatus; Oxoid, Basingstoke, UK) upper 25 ℃ show as pink, smooth colony, clear border while cultivating.
3. utilization of carbon source:
Can assimilate glucose, sucrose, glycerine, succinate.The urea test positive.
Described little rhodotorula ITS1,5.8S rDNA and ITS2 district amplification sequence measurement: adopt the fungi universal primer
Upstream primer ITS5:5 '-GGAAGTAAAAGTCGTAACAAGG-3 ' (as shown in SEQ ID NO:1);
Downstream primer ITS4:5 '-TCCTCCGCTTATTGATATGC-3 ' (as shown in SEQ ID NO:2).
With genome amplification, PCR reaction system 50 μ L:10 * PCR buffer 5 μ L, 2.5mmol/L dNTP mixture 8 μ L, each 1ul of 10umol/L primer, template 2ul, Taq enzyme 0.5ul, sterilized water 32.5 μ L.The pcr amplification condition: 94 ℃ of denaturations 5 minutes, 94 ℃ of sex change 1 minute, 55 ℃ of annealing 1 minute, 70 ℃ are extended 2 minutes, 30 circulations; Preserve 10 minutes for 72 ℃.The gained amplified production is by twice of the two-way order-checking of ABI 3730DNA automatic sequencer.Sequencing result is as shown in SEQ ID NO:3; Sequencing result is carried out in the NCBI website sequence alignment (
http:// blast.ncbi.nlm.nih.gov/Blast.cgi), with little rhodotorula CBS4407 than homology 99%.
The present invention also provides the separation and Culture purification process of described little rhodotorula, and the method comprises:
Little rhodotorula is inoculated in the sabouraud's agar flat board, and 25 ℃, growth in the 3rd day, obtain little rhodotorula bacterium colony;
The method also comprises cultivates and preserves step: take out and preserve pipe from-70 ℃ of refrigerators, be positioned over immediately in 37 ℃ of water-baths and suitably shake 30s, open cryopreservation tube, get 1 transfering loop bacterium liquid and access on fresh Sharpe slant medium; During preservation, by bacterium liquid spread plate, put into 4 ℃ of refrigerator short-term preservations after 48 hours or put into the YEPD liquid nutrient medium-70 that contains 25% glycerine ℃ frozen.
Component and the weight percent of described Sharpe slant medium are as follows: glucose 4%, peptone 1%, agar 1.5%, and every 1000ml adds 200mg paraxin, standby after 121 ℃ of sterilizings in 10 minutes;
Component and the weight percent of described yeast leaching cream peptone (YEPD) liquid nutrient medium are as follows: 1% yeast leaches cream, 2% peptone, 2% glucose.
The present invention also provides the application of this bacterial strain in the screening antifungal drug.
Described antifungal drug is specially anti-human class tinea unguium medicine.
With reference to M27-A3 method (Clinical Laboratory and Standards Institute.Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts.Approved standard M27-A3.Wayne, PA:National Committee for Clinical Laboratory Standards, 2008.), this little rhodotorula is measured the drug susceptibility of amphotericin b, flucytosine, fluconazole, itraconazole and voriconazole.Its MIC value is respectively<0.5,<4,16,<0.125,<1 μ g/mL.Little rhodotorula of the present invention can be used for screening new antifungal drug.
The accompanying drawing explanation
Fig. 1 is the KOH microscopy figure of the little rhodotorula of the present invention;
Fig. 2 is the onychonosus reason figure (PAS dyeing) of the little rhodotorula of the present invention.
Microbial preservation information: little rhodotorula (LWQ2010,), Classification And Nomenclature: little rhodotorula Rhodotorula minuta, on April 16th, 2012, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC), address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.6019.
Embodiment
Now in conjunction with the embodiments and accompanying drawing, the invention will be further described, but enforcement of the present invention is not limited in this.
Embodiment 1: little rhodotorula (Rhodotorula minuta) bacterial strain CGMCC No.6019
Little rhodotorula (LWQ2010), Classification And Nomenclature: little rhodotorula Rhodotorula minuta belongs to Basidiomycota (Basidiomycota), load spore order (Sporidiales), Rhodotorula (Rhodotorula).
Bacterial strain of the present invention is identified by Shanghai Long March Hospital Dermatology Department separation and detection in tinea unguium disease first.Be deposited in China Committee for Culture Collection of Microorganisms's common micro-organisms center (CGMCC) on April 16th, 2012, preservation registration number is CGMCCNO.6019.
1. morphological specificity:
Sick first with 10%KOH, process after under light microscopic visible little, ellipsoideus yeast, 3.5-6.5 * 3.5 μ m, as shown in Figure 1 and Figure 2.
2. cultural characteristic:
This bacterium can be leached substratum (MEA at Fructus Hordei Germinatus; Oxoid, Basingstoke, UK) upper 25 ℃ show as pink, smooth colony, clear border while cultivating.
3. utilization of carbon source:
Test method is referring to chief editors such as reference book: Liao Wanqing etc. " mycosis ", People's Health Publisher, 1989 years.Can assimilate glucose, sucrose, glycerine, succinate.The urea test positive.
4. the separation and Culture of bacterial strain and Techniques of preserving
The strain separating purification technique of little rhodotorula of the present invention comprises: little rhodotorula is inoculated in sabouraud's agar flat board (25 ℃), and growth in the 3rd day, obtain little rhodotorula bacterium colony.
Slant culture and the Techniques of preserving of described little rhodotorula comprise: take out and preserve pipe from-70 ℃ of refrigerators, be positioned over immediately in 37 ℃ of water-baths and suitably shake 30s, open cryopreservation tube, get 1 transfering loop bacterium liquid and access on fresh Sharpe slant medium.The sabouraud culture medium formula: glucose 4%, peptone 1%, agar 1.5%, every 1000ml adds 200mg paraxin, standby after 121 ℃ of sterilizings in 10 minutes.During preservation, by bacterium liquid spread plate, put into 4 ℃ of refrigerator short-term preservations after 48 hours or put into the YEPD liquid nutrient medium-70 that contains 25% glycerine ℃ frozen.YEPD liquid culture based formulas: 1% yeast leaches cream, 2% peptone, 2% glucose.
5. fungi authenticate technology
Described little rhodotorula ITS1,5.8S rDNA and ITS2 district amplification sequence measurement: adopt the fungi universal primer
Upstream primer ITS5:5 '-GGAAGTAAAAGTCGTAACAAGG-3 ' (as shown in SEQ ID NO:1);
Downstream primer ITS4:5 '-TCCTCCGCTTATTGATATGC-3 ' (as shown in SEQ ID NO:2).
With genome amplification, PCR reaction system 50 μ L:10 * PCR buffer 5 μ L, 2.5mmol/L dNTP mixture 8 μ L, each 1ul of 10umol/L primer, template 2ul, Taq enzyme 0.5ul, sterilized water 32.5 μ L.The pcr amplification condition: 94 ℃ of denaturations 5 minutes, 94 ℃ of sex change 1 minute, 55 ℃ of annealing 1 minute, 70 ℃ are extended 2 minutes, 30 circulations; Preserve 10 minutes for 72 ℃.The gained amplified production is by twice of the two-way order-checking of ABI 3730DNA automatic sequencer.Sequencing result:
GGGATTTTGCGTCTGATGATTTGAGATCTAAGCTTAAGTGCTATAAAGCGCATTAGAAGCACCTCTTATATTTGAAGAAGACGTCCTTAGCGAAATAATTATTACGCCAAGTCAAACCGTCTATTTCAATAGGGTTGCTCGTGTATTTCAGTTGAGCCGGCAATTACGCCGACAGACAACCATAATCCAAGCCCACGCCCATTTCATTACAAAATAGGGGGGTTGAGAGTTTCATGATACTCAAACAGACATACTCTTCGGAATACCAAAGAGTGCAAGGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTTTATTTTTGTTTATGCTCAATTAAGAGACTATTACATTCTTATACTAATGTGTTAAAAGTGTGTGTAAAAAGAAGTGTGTGCACAGTGTAAGAAAATGAAATGGTCGGACTTCTAAAAAGAACGTCCTAAAATTCATTAATGATCCTTCCGCAGGTTGACCTACGGAAACCT. ( as SEQ ID NO:3 shown ) ； Sequencing result is carried out in the NCBI website sequence alignment (
Http:// blast.ncbi.nlm.nih.gov/Blast.cgi), with little rhodotorula CBS4407 than homology 99%.
Embodiment 2: the fungal drug sensitive experiment
With reference to M27-A3 method (Clinical Laboratory and Standards Institute.Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts.Approved standard M27-A3.Wayne, PA:National Committee for Clinical Laboratory Standards, 2008.), this little rhodotorula is measured the drug susceptibility of amphotericin b, flucytosine, fluconazole, itraconazole and voriconazole.Its MIC value is respectively<0.5,<4,16,<0.125,<1 μ g/mL.
Above demonstration and described ultimate principle of the present invention, principal character and advantage of the present invention.The technician of the industry should understand; the present invention is not restricted to the described embodiments; that in above-described embodiment and specification sheets, describes just illustrates principle of the present invention; the present invention also has various changes and modifications without departing from the spirit and scope of the present invention, and these changes and improvements all fall in the claimed scope of the invention.The claimed scope of the present invention is defined by appending claims and equivalent thereof.
Claims (5)
1. the little rhodotorula of a strain (Rhodotorula minuta), deposit number is CGMCC No.6019.
2. the separation and Culture purification process of little rhodotorula according to claim 1, is characterized in that, the method comprises:
Little rhodotorula is inoculated in the sabouraud's agar flat board, and 25 ℃, growth in the 3rd day, obtain little rhodotorula bacterium colony.
3. the separation and Culture purification process of little rhodotorula according to claim 1 and 2, it is characterized in that, the method comprises that to cultivate and preserve step as follows: take out from-70 ℃ of refrigerators and preserve pipe, be positioned over immediately in 37 ℃ of water-baths and suitably shake 30s, open cryopreservation tube, get on 1 transfering loop bacterium liquid access Sharpe slant medium; By bacterium liquid spread plate, put into 4 ℃ of Refrigerator stores after 48 hours or put into the yeast that contains 25% glycerine that to leach cream peptone liquid nutrient medium-70 ℃ frozen during preservation;
Component and the weight percent of described Sharpe slant medium are as follows: glucose 4%, peptone 1%, agar 1.5%, and every 1000ml adds 200mg paraxin, standby after 121 ℃ of sterilizings in 10 minutes;
Component and the weight percent of described yeast leaching cream peptone liquid nutrient medium are as follows: 1% yeast leaches cream, 2% peptone, 2% glucose.
4. the application of little rhodotorula as claimed in claim 1 in the screening antifungal drug.
5. the application of little rhodotorula according to claim 4 in the screening antifungal drug is characterized in that described antifungal drug is anti-human class tinea unguium medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210351821.0A CN102864085B (en) | 2012-09-19 | 2012-09-19 | Rhodotorula minuta and separating and culturing method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210351821.0A CN102864085B (en) | 2012-09-19 | 2012-09-19 | Rhodotorula minuta and separating and culturing method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102864085A true CN102864085A (en) | 2013-01-09 |
| CN102864085B CN102864085B (en) | 2014-08-27 |
Family
ID=47443217
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210351821.0A Active CN102864085B (en) | 2012-09-19 | 2012-09-19 | Rhodotorula minuta and separating and culturing method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102864085B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114958632A (en) * | 2022-05-24 | 2022-08-30 | 鲁东大学 | Salt-tolerant rhodotorula minuta and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102046009A (en) * | 2008-06-03 | 2011-05-04 | 阿奇化工公司 | Compositions and methods for nail fungus treatment |
-
2012
- 2012-09-19 CN CN201210351821.0A patent/CN102864085B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102046009A (en) * | 2008-06-03 | 2011-05-04 | 阿奇化工公司 | Compositions and methods for nail fungus treatment |
Non-Patent Citations (4)
| Title |
|---|
| ANDREW WEINSTEIN等: "Topical Treatment of Common Superficial Tinea Infections", 《AMERICAN FAMILY PHYSICIAN》, vol. 65, no. 10, 15 May 2002 (2002-05-15), pages 2095 - 2102 * |
| CHEN，M.等: "HQ453971", 《GENBANK》, 27 April 2011 (2011-04-27), pages 1 * |
| 周与良 等: "抑菌试验用于测定T-2毒素", 《微生物学通报》, no. 3, 30 June 1990 (1990-06-30), pages 144 - 146 * |
| 陈丽娜 等: "临床疑诊甲真菌病1036例真菌学分析", 《中国皮肤性病学杂志》, vol. 18, no. 4, 30 April 2004 (2004-04-30), pages 217 - 218 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114958632A (en) * | 2022-05-24 | 2022-08-30 | 鲁东大学 | Salt-tolerant rhodotorula minuta and application thereof |
| CN114958632B (en) * | 2022-05-24 | 2023-05-26 | 鲁东大学 | Salt-tolerant rhodotorula parviflora and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102864085B (en) | 2014-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Strati et al. | Age and gender affect the composition of fungal population of the human gastrointestinal tract | |
| CN103740618B (en) | One Bacillus species novel bacterial and cultural method thereof and application | |
| Monteiro et al. | Antagonism of Bacillus spp. against Xanthomonas campestris pv. campestris | |
| Kindo et al. | Identification of Malassezia species | |
| Montoya et al. | Genotyping, extracellular compounds, and antifungal susceptibility testing of Trichosporon asahii isolated from Mexican patients | |
| Song et al. | Phylogenetic diversity of thermophilic actinomycetes and Thermoactinomyces spp. isolated from mushroom composts in Korea based on 16S rRNA gene sequence analysis | |
| Huai-Gu et al. | Composition of wheat rhizosphere antagonistic bacteria and wheat sharp eyespot as affected by rice straw mulching | |
| Leyronas et al. | Compared efficiency of the isolation methods for Botrytis cinerea | |
| Pruvost et al. | New media for the semiselective isolation and enumeration of Xanthomonas campestris pv. mangiferaeindicae, the causal agent of mango bacterial black spot | |
| CN112143658B (en) | Beauveria bassiana strain MQ-08 and application and microbial preparation thereof | |
| Zhang et al. | Microdochium paspali, a new species causing seashore paspalum disease in southern China | |
| CN101985605A (en) | Saprolegnia antagonist and application thereof | |
| Beyene et al. | Molecular identification and performance evaluation of wild yeasts from different Ethiopian fermented products | |
| CN103184171A (en) | Mycoplasma hyopneumoniae DJ-166 strain and application thereof | |
| Wen et al. | Onychomycosis associated with Exophiala oligosperma in Taiwan | |
| Zhang et al. | Microcycle conidiation and the conidial properties in the entomopathogenic fungus Metarhizium acridum on agar medium | |
| CN104877940B (en) | One plant of streptococcus thermophilus | |
| CN102876585A (en) | Cryptococcus gattii, and isolated culture method and application thereof | |
| CN102827777A (en) | Symbiotic and epiphytic aspergillus terreus of sponge and use for preparation of (+)- terrein | |
| Jackson | Dissolved oxygen levels affect dimorphic growth by the entomopathogenic fungus Isaria fumosorosea | |
| CN102864085B (en) | Rhodotorula minuta and separating and culturing method and application thereof | |
| CN113801804A (en) | Banana wilt biocontrol antagonistic strain and application thereof | |
| Wang et al. | Isolation and application of thermophilic and psychrophilic microorganisms in the composting process | |
| CN102864084B (en) | Cryptococcus uniguttulatus, and isolated culture method and application thereof | |
| Shen et al. | Methanolobus halotolerans sp. nov., isolated from the saline Lake Tus in Siberia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |