CN102851747B - Method of preparing bacterium nucleic acid fingerprinting database - Google Patents
Method of preparing bacterium nucleic acid fingerprinting database Download PDFInfo
- Publication number
- CN102851747B CN102851747B CN201210273570.9A CN201210273570A CN102851747B CN 102851747 B CN102851747 B CN 102851747B CN 201210273570 A CN201210273570 A CN 201210273570A CN 102851747 B CN102851747 B CN 102851747B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- bacterium
- bacteria
- pcr
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a nucleic acid fingerprinting feature spectral library for identifying and classifying bacteria and a preparation method thereof. The preparation method comprises steps of polymerase chain reaction (PCR) amplification, secreted acid phosphatase (SAP) enzymic digestion, transcription and nucleic acid digestion, purification, detection of a mass spectrometer and the like. Based on the preparation method, the nucleic acid fingerprinting feature spectral library of common bacteria is established. According to a mass spectrum feature map spectral library, identification and classification can be performed on the bacteria to be detected, and the nucleic acid fingerprinting feature spectral library can be widely applied to the fields of identification and classification of the bacteria, genetic evolution analysis, drug resistance screening, import and export inspection and the like.
Description
Technical field
The invention belongs to biological technical field, relate to a kind of method prepared by bacterial nucleic acid finger printing, and use the method, bacterium is carried out to the method for classification and identification.
Background technology
The classification of early stage bacteriology is mainly the traditional bacteriology sorting technique adopting take form cultural characteristic and physiological and biochemical property as foundation.But because this surface characteristic of bacterium is often subject to impact and the restriction of a lot of human factors, particularly the difference of people's subjective judgement is difficult to reflect the natural sibship of bacterium on the contrary, and this has just embodied the limitation that is only based upon the traditional taxonomy on morphological specificity and physiological and biochemical property basis.
Therefore, Colweel has proposed a new division bacteria technics " polyphase sort (Polyphasic taxonomy) ", and it refers to the multiple different information of comprehensive utilization microorganism, comprises the method that phenotype and genotypic information are classified.Molecular classification and phylogeny abundant information the content of polyphase sort, jointly promote division bacteria close towards natural classification system.The molecular indexes that is applied to classification is mainly DNA and RNA, and DNA homology analysis is to determine correct classification position, sets up the most direct method of natural classification system.Method is simple for this type of, and resolving power is high, plays a part more and more important in bacterial systematics research.
The principle of using mass-spectrometric technique to carry out division bacteria and evaluation is, the elementary cell of composition hereditary material DNA---between four kinds of Nucleotide, there is mass discrepancy, upper certain or certain the several fragments of bacterial genomes DNA are carried out after PCR and enzyme cut, molecular weight and the different fragment of abundance will be produced, use mass spectrometric detection can produce nucleic acid finger printing, between different bacterium, genomic dna there are differences, different nucleic acid finger printings will be produced, after building database, can experimental result and database compare, can complete the evaluation to bacterium.
More existing open source literatures are used mass-spectrometric technique microorganism is classified and identify, for example, Chinese patent application CN102337223A, " penicillium chrysogenum antifungal protein Pc-Arctin and preparation method thereof ", a kind of MALDI-TOF authentication method that detects penicillium chrysogenum antifungal protein Pc-Arctin is disclosed, wherein from flat board, picking Penicllium chrysogenum A096 spore inoculating is cultivated in SGY liquid nutrient medium, pre-treatment obtains the separation and purification in chromatographic column of crude protein solution, and separation and purification on carboxymethyl cation-exchange chromatography post, collect each elution fraction, each component centrifugal ultrafiltration is concentrated into volume required, take paecilomyces varioti as responsive tested indicator, follow the trail of anti-mycotic activity component, definite activeconstituents judgement obtains the purity of albumen, extract the single band on SDS-PAGE electrophorogram, carry out MALDI-TOF evaluation.The method is only applicable to specified microorganisms, and needs multiplexed protein purge process, finally uses MALDI-TOF identification mark albumen Pc-Arctin, and its process is loaded down with trivial details, applicable surface is narrow, can not realize the object of mass spectral classification bacterium or microorganism.
Chinese patent application 200910157210, " analytical procedure of fatty acid component in a kind of listeria cell " discloses the method that one utilizes gaschromatographic mass spectrometry (GC-MS) analytical method directed toward bacteria lipid acid to classify, comprise: listeria bacteria rejuvenation, with Oxford agar plate and trypticase soy yeast extract agar flat board separate and purifying listeria bacteria respectively, cultivate the listeria bacteria of single colonies typical and make bacteria suspension, use formalin-inactivated processing, bacteria suspension average mark after formaldehyde treated is contained in to centrifuge tube washing, with the mixed solution esterification of hydrochloric acid and methyl alcohol, the lipid acid making is carried out to gaschromatographic mass spectrometry (GC-MS) analysis.The limitation of systematic bacteriology although the method breaks traditions, reduce human factor to the traditional form error of bringing of classifying, simultaneously for the strong instrument that provides is provided in the classification of new bacterial classification and seed culture of viruses, but this method still belongs to, utilize mass spectroscopy to carry out CYTOCHEMICAL ANALYSIS classification, for nucleic acid, do not detect.
International Patent Application WO 2010/021548, " Method for identifying biological material e.g. bacteria in sample of patient, involves separating stream of liquid containing sample into successive portions to form flying drops and ionizing flying drops to measure mass spectra ", a kind of use MALDI-MS (substance assistant laser desorpted and MALDI-MS) is disclosed for identifying the method and apparatus of biomaterial, comprise the liquid that preparation comprises sample and MALDI substrate material, and use it for and form the continuous a fluid stream of liquid.This fluid stream is dispersed into part in succession, to form, is transmitted into aloft drop, or a fluid stream is transmitted into in-flight, be then dispersed into drop.Can use drop formation technology known from ink-jet printer.Aloft drop is ionized out to material.Measurement is from the mass spectrum of the ionization material of each drop.But the method object is how to improve the sensitivity of MALDI-MS detection of biological material, do not relate to Mass Spectrometric Identification and any microorganism of classification, therefore can not solve the problems of the technologies described above.
The people such as Zhu Jian (" principium identification and the classification of high performance liquid chromatography-electrospray multi-stage mass method to each component in geldanamycin crude product ", < < China microbiotic > >, 03 phase in 2011) reported that application high performance liquid chromatography-electrospray multi-stage mass method (LC-ESI-MSn) carries out principium identification and the classification of the structural information aspect relevant to total mass number to each component in geldanamycin (GDM) crude product.The analysis and arrangement that the method is carried out for the multi-stage ms fragment of different components in geldanamycin (GDM), and various compounds have been carried out to accurate classification, thereby but do not relate to directed toward bacteria predetermined substance and detect the method that bacterium is classified.
Bang flood (" application of MALDI TOF MS in Bacteria Detection and in identifying ", < < microbiology immunology progress > >, 02 phase in 2003) reported " bacterial body contains chemical classification and the evaluation that a large amount of Biomarkers can be used for bacterium; for detecting and evaluation bacterium as the moiety acquisition finger printing according to bacterium ", and the method is predicted to its theoretic feasibility.But this research is only to have inquired in theory the direction of utilizing MALDI TOF MS to classify to bacterium, its which kind of component that had not both indicated institute directed toward bacteria detects, and concrete research method and process are not described yet.Because component (as albumen, DNA, RNA, the polysaccharide etc.) kind that can be used in bacterium classifying is too many, and mass-spectrometric technique also exists combination and the selection of various experiment parameters for different determinands, therefore in after this nearly 10 years, do not utilize MALDI TOF MS to carry out the new report of division bacteria.
As immediate prior art, Chinese patent application 201110154723, " MALDI TOF MS assistant identification list increases the method for listeria spp " and 201110154469, " method of MALDI TOF MS assistant identification vibrio cholerae " discloses a kind of method of the MALDI of utilization TOF MS technology assistant identification bacterium, comprise: pre-treatment bacterial cultures, gather the MALDI TOF MS collection of illustrative plates of all bacterial strain samples, according to software, prepare bacterium standard diagram, use identical method to detect and gather the collection of illustrative plates of tested bacteria, and the two collection of illustrative plates of comparison, according to coupling mark, judge.Because the method is used conventional processing and (is passed through dehydrated alcohol, formic acid and acetonitrile treatment, and be aided with centrifugal, finally drawing supernatant liquor detects), although it can characterize the characteristic spectrum of this bacterium to a certain extent, but owing to containing protein in its determinand, lipid, lipopolysaccharides and fat oligosaccharides, DNA, polypeptide and the ionizable molecule of other energy, the collection of illustrative plates set that its collection of illustrative plates obtaining is in fact above-mentioned various molecules, therefore both needed the collection of illustrative plates quantity of information of processing and comparison excessive, and because molecule to be checked is too huge, cause its collection of illustrative plates characteristic on the low side, be only applicable to certain concrete bacterium and cannot be generalized in other a large amount of Bacteria Detection.
Therefore, need at present one can directed toward bacteria in certain specific molecule to be checked carry out mass spectrometric detection, simultaneously the method again can be generally for mass spectral classification and the evaluation of most bacteriums.
Summary of the invention
The principle of the invention is: contriver is through groping in a large number and comparing, for the research of 841 kinds of bacteriums, discovery selects universal primer to carry out after pcr amplification DNA of bacteria, after using specific enzymes to process amplified production, carries out mass spectrometric detection and can obtain various bacterial nucleic acid fingerprint characteristic collection of illustrative plates.Then, on the basis of above-mentioned research, the nucleic acid fingerprint characteristic collection of illustrative plates of above-mentioned various bacteriums is carried out to system processing, thereby obtain nucleic acid fingerprint characteristic spectrum library.Because this spectrum storehouse can accurately characterize various bacteriums, through amplification, enzyme, cut mass spectral characteristic collection of illustrative plates after treatment, therefore utilize this characteristic spectrum storehouse can complete classification and the evaluation (evaluation, somatotype, classification etc.) of various bacteriums.
Therefore, the present invention's the first object is to provide a kind of preparation method of the bacterial nucleic acid fingerprint databases of cutting based on enzyme.It is characterized in that, which comprises at least following steps:
(1) PCR reaction: use the PCR universal primer of directed toward bacteria, the nucleic acid-templated of multiple bacteriums of increasing respectively, obtains the PCR product containing amplification target area;
(2) SAP enzymic digestion: the PCR product obtaining with alkaline phosphatase (SAP enzyme) treatment step (1);
(3) transcribe with nuclease and cut: use and specifically transcribe and restriction endonuclease, respectively in a reaction system, the digestion product of each bacterium that step (2) is obtained is transcribed with nuclease and is cut, and obtains the nucleic acid fragment that a series of length differs, abundance differs;
(4) purifying: the enzyme that uses resin treatment step (3) to obtain is cut product;
(5) mass spectrograph detects: on the purified product that step (4) is obtained, point is on the target sheet that contains matrix, and upper mass spectrograph detects, and obtains the feature nucleic acid fingerprint chromatogram of different bacterium.
(6) by the nucleic acid fingerprint characteristic collection of illustrative plates of the various bacteriums that obtain, by computer software, gather and arrange, obtaining described bacterial nucleic acid fingerprint characteristic spectrum library.
In one embodiment, described software is the BioExplore software that contriver researchs and develops voluntarily, and its copyright number is soft work step on word No. 136879, registration number 2009SR10700.
In one embodiment, PCR reacts the bacterial nucleic acid sequence increasing, including but not limited to a region on DNA of bacteria genome.In another embodiment, this sequence is including but not limited to the upper region of bacterial 16 S rDNA.In another embodiment, described bacterial 16 S rDNA region is selected from the region shown in SEQ ID NO:3, or has the sequence of at least 60% homology with sequence shown in SEQ ID NO:3.In preferred embodiment therein, preferably this sequence has the sequence of 62%, 65%, 68%, 70%, 72%, 75%, 78%, 80%, 82%, 85%, 88%, 89%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology.
In one embodiment, described universal primer includes but not limited to sequence shown in SEQ ID No:1 to SEQ ID No:2.
In another embodiment, the certain enzyme described in step 3, includes but not limited to RNaseA enzyme.In a specific embodiments, the purifying of step 5 is included in to transcribe with enzyme and cuts in product and add ultrapure water, after mixing, then adds resin, turns upside down and mixes 15 minutes.In another embodiment, wherein said mass spectrograph is MALDI TOF MS mass spectrograph.
In above-mentioned arbitrary scheme, wherein said bacterium comprises 836 kinds of bacteriums as listed in table 1.
Table 1
In above-mentioned arbitrary scheme, wherein said bacterium also comprises brucella (Brucella), mycobacterium tuberculosis (Mycobacterium tuberculosis), helicobacter pylori (Helicobacter pylori, Hp).Wherein, brucella comprises brucella melitensis (Brucella melitensis), B. abortus (Brucella abortus), pig kind brucella (Brucella suis).
The second object of the present invention is to provide the bacterial nucleic acid fingerprint characteristic spectrum library that utilizes aforesaid method prepared.
The present invention's the 3rd object is to provide the test kit that comprises above-mentioned bacterial nucleic acid fingerprint characteristic spectrum library, for division bacteria and evaluation, resistance, screens purposes, and this test kit comprises:
(1) for the universal primer of the DNA of bacteria that increases to and damping fluid;
(2) SAP enzyme and damping fluid thereof;
(3) RNAase and damping fluid thereof;
(4) for purifying enzyme, cut the resin of product;
(5) for comparing the analysis software of nucleic acid fingerprint characteristic collection of illustrative plates.
In one embodiment, wherein said primer is SEQ ID NO:1-2.
In another embodiment, wherein said software is BioExplore software, and its copyright number is (soft work is stepped on word No. 136879, registration number 2009SR10700).
The present invention's the 4th object is to provide utilizes above-mentioned characteristic spectrum storehouse or method that mentioned reagent box carries out Bacteria Identification and classification, comprising:
(1) PCR reaction: use the PCR universal primer of directed toward bacteria, amplification tested bacteria nucleic acid-templated, obtains the PCR product containing amplification target area;
(2) SAP enzymic digestion: the PCR product obtaining with alkaline phosphatase (SAP enzyme) treatment step (1);
(3) transcribe with nuclease and cut: use and specifically transcribe and restriction endonuclease, in a reaction system, the digestion product of the bacterium that step (2) is obtained is transcribed with nuclease and cut, and obtains the nucleic acid fragment that a series of length differs, abundance differs;
(4) purifying: the enzyme that uses resin treatment step (3) to obtain is cut product;
(5) mass spectrograph detects: on the purified product that step (4) is obtained, point is on the target sheet that contains matrix, and upper mass spectrograph detects, and obtains the nucleic acid fingerprint characteristic collection of illustrative plates of this bacterium;
(6) gained nucleic acid fingerprint characteristic collection of illustrative plates and bacterial nucleic acid fingerprint characteristic spectrum library are compared, thereby judge classification or the kind of tested bacteria.
In one embodiment, PCR reacts the bacterial nucleic acid sequence increasing, including but not limited to a region on DNA of bacteria genome.In another embodiment, the region on described genome is selected from the region shown in SEQ ID NO:3, or has the sequence of at least 60% homology with sequence shown in SEQ ID NO:3.In preferred embodiment therein, preferably this sequence has the sequence of 62%, 65%, 68%, 70%, 72%, 75%, 78%, 80%, 82%, 85%, 88%, 89%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology.
In one embodiment, described universal primer includes but not limited to sequence shown in SEQ ID No:1 to SEQ ID No:2.
In another embodiment, the certain enzyme described in step 3, includes but not limited to RNaseA enzyme.In a specific embodiments, wherein said mass spectrograph is MALDI TOF MS mass spectrograph.In another embodiment, step 6 compares detection by BioExplore software.
Definition
" division bacteria and evaluation " of the present invention, comprise to bacterium identify and identification, somatotype, point kind, classification.For example, in food safety detection, by division bacteria or evaluation, can accurately identify source of pollution and bacterium composition, in order to adopting rational approach to ensure food safety.And for example, in the evolution of research bacterium, by the identification to bacterium and classification/somatotype, can determine the far and near relation of relationship between various bacterium kinds.
A region on DNA of bacteria genome of the present invention, preferably has the region that the high conservative while has again certain polymorphism.Because bacterium belongs to unicellular lower eukaryote, in the genome of various bacteriums, be generally rendered as the conservative property of certain homology, therefore arbitrary relatively conservative region in directed toward bacteria genome, is used universal primer can amplify the nucleic acid region that various bacteriums correspond to each other.The DNA fragmentation enzyme of different microorganisms is cut, the collection of illustrative plates that takes on a different character, thereby actual nucleic acid mass-spectrogram is carried out to bioinformatic analysis, can realize the classification and identification of bacterium.
Conservative region of the present invention or conservative fragments, preferably bacterium rRNA region.RRNA is the important indicator of the evolution of research bacterium and sibship, its content reaches 80%, and be present in all bacteriums, rRNA gene is comprised of conserved regions and variable region, conservative at bacterium camber, have the title of " bacterial fossil ", is that bacterial systematics is learned useful and the most the most frequently used molecular clock in research.Wherein, 16S rDNA sequence is due to molecular size moderate (about 1.5kb), mutation rate is extremely low, become vital signs (the Olsen GJ that division bacteria and kind are identified, Pace NR, Nuell M, et al. Nucleic Acids Res, 1991,19 (supp l): 2017-2021.).Although 16S rDNA sequential analysis at present has become, bacterium kind is identified and the standard method of classification, and the 16S rDNA complete sequence of about 2500 kinds is in the news, and according to their sequence homology, has built the phylogenetic tree of each kind.But due to the high conservative of 16S rDNA sequence in prokaryotic organism, poor for the discriminating resolving power between the different strains in close kind or same.
The method of in addition, at present carrying out division bacteria and evaluation with 16S rDNA is mainly to adopt PCR product direct Sequencing, the method that result and database are compared.Sequencing is applied to clinical detection, and there are the following problems at present: (1) cost is high; (2) consuming time; (3), for mixing sample, order-checking easily produces cover peak, is difficult to effectively distinguish; (4) more than 16S rDNA total length 1.5kb, generally need to and result be spliced through twice order-checking, in this process, easily introduce error.
As previously mentioned, 16S rDNA identifies and has great importance division bacteria, but high, the consuming time length of method testing cost such as tradition order-checking; For the sample of polyinfection, sequencing is by the sequence peak figure that obtains mixing, be difficult to effectively distinguish, and utilize mass spectrum to carry out analyte analysis, need to select suitable determinand and optimize mass spectrum parameter, therefore need at present new division bacteria technology (as mass spectroscopy) realize fast, accurately, cheapness, classification results easily.
" universal primer " of the present invention is the upstream and downstream that can be positioned at the region to be amplified of various bacterial genomes, the primer of the respective segments that can increase in different bacterium genome.Wherein, region to be amplified on genome of the present invention is selected from the sequence with sequence shown in SEQ ID NO:3 with at least 60% homology, and preferably this sequence has the sequence of 62%, 65%, 68%, 70%, 72%, 75%, 78%, 80%, 82%, 85%, 88%, 89%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology.For example, due to for DNA of bacteria (16S rDNA), its sequence is comprised of conserved regions and variable region conventionally, and variable region mostly be discontinuous or short-movie section even SNP form be mixed in the middle of conserved regions or two ends, therefore use the universal primer respective segments that can increase in different bacterium genome.Because this fragment of various bacteriums all has certain homology, thus having in the fragment of at least 60% homology with sequence shown in SEQ ID NO:3, through enzyme cut with mass spectrum after can obtain the nucleic acid fingerprint characteristic collection of illustrative plates of tested bacteria.
In one embodiment, the specific region of bacterial 16 S rDNA is bacterial 16 S rDNA sequence C TGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCC TCTCAGGTCGGCTATGCATCGTTGCCTTGGTAGGCCATTACCCTACCAACTAGCTA ATGCACCGCGGGCCCATCTGTAAGCGATAGCCGAAACCATCTTTCAAAAGCGTGGC ATGCGCCACACTTTATCATTCGGTATTAGCCCCGGTTTCCCGGAGTTATCCCCAAC TTACAGGCAGGTTGCCCACGTGTTACTCACCCGTCCGCCACTAACTTTGGAAGAGC AAGCTCTTCCTCCGTTCGTTCGACTTGCATGTATTAGGCACGCCGCCAGCGTTCGT CCTGAGCCAGGATCAAACTCT, it is SEQ ID NO:3(listeria bacteria, 358bp).In a specific embodiments, the primer of this specific region is SEQ ID No:1 and SEQ ID No:2.
In another embodiment, in step 5, relate to and use BioExplore software to carry out data analysis, and the database of Criterion bacterial strain.
In another embodiment, the described certain enzyme of cutting for nuclease is RNaseA enzyme.
Also in another embodiment, described mass spectrum is MALDI-TOF mass spectrum.
Beneficial effect
1, the enzyme that the present invention studies 841 kinds of bacteriums is repeatedly cut and mass spectrometric detection result, find and obtain various bacterial nucleic acid fingerprint characteristic collection of illustrative plates, can effectively identify the existence of various bacteriums, and not be subject to the interference of the non-bacterium microbe (as fungi, virus etc.) similar to bacterial genomes.
2, due to the high sensitivity of mass spectrometric detection, the detection lower limit that uses this programme whether to exist bacterium can far exceed other technologies scheme (as biochemistry detection, order-checking detection etc.);
3, for different samples, the present invention can compare the nucleic acid finger printing that they produce, and the nucleic acid finger printing that experiment is produced and the collection of illustrative plates of database Plays bacterial strain contrast, through bioinformatic analysis, can judge and belong to which kind, or with the sibship distance of a certain kind;
4, for the bacterium of all kinds of sudden changes of easy generation, in the nucleic acid finger printing that experiment is produced and database, the collection of illustrative plates of not mutated strain contrasts, and through bioinformatic analysis, can judge whether to exist sudden change;
5, the sample mixing for various bacteria, the contrasting of the collection of illustrative plates of nucleic acid finger printing and the database Plays bacterial strain that experiment is produced, through bioinformatic analysis, contains the bacterium of which kind in can judgement sample.
6, use this programme can carry out the classification and identification of bacterium, and be widely used in the many aspects such as division bacteria, food safety detection, disease prevention and control, disease propagation Study of way, epidemiology survey, clinical drug-resistant Mutation Screening, import and export inspection and quarantine.
7, with respect to order-checking classification, whole process only completes in a few hours, time saving and energy saving;
8, with respect to order-checking peak figure, bacterial nucleic acid finger printing has better resolving power for biased sample.Through groping, design first and utilize mass spectrometric detection to detect 16S rDNA region, obtain the flow process of bacterium finger printing;
9, in addition, the present invention proposes the 16S rDNA region of bacterium to carry out mass spectrometric detection as determinand first, to obtain the nucleic acid finger printing of different bacterium, for the research of phylogenetic analysis and the classification and identification of bacterium.
Accompanying drawing explanation
Fig. 1 is listerial nucleic acid fingerprint characteristic collection of illustrative plates.
Fig. 2 is the nucleic acid fingerprint characteristic collection of illustrative plates of bacillus aceticus.
Fig. 3 is the nucleic acid fingerprint characteristic collection of illustrative plates of nitrogen-fixing rhizobia.
Fig. 4-Figure 100 is the nucleic acid fingerprint characteristic collection of illustrative plates of 97 kinds of bacteriums shown in table 2, wherein, Fig. 4: No. 1 bacterial classification (Acaryochloris marina MBIC11017 chromosome) in table 2, Figure 26: No. 23 bacterial strain (Capnocytophaga ochracea DSM 7271 chromosome) in table 2, Figure 49: No. 46 bacterial classification (Megasphaera elsdenii DSM 20460), Figure 72: No. 69 bacterial classification (Rhodobacter sphaeroides 2.4.1 chromosome chromosome 1), Figure 95: No. 92 bacterial classification (Thiomicrospira crunogena XCL-2 chromosome), Figure 100: No. 97 bacterial classification (Xanthobacter autotrophicus Py2 chromosome).
Figure 101-103 are the nucleic acid fingerprint characteristic collection of illustrative plates of sheep kind (Brucella melitensis), ox kind (Brucella abortus), pig kind brucella (Brucella suis).
Figure 104 is the nucleic acid fingerprint characteristic collection of illustrative plates of mycobacterium tuberculosis.
Figure 105 is the nucleic acid fingerprint characteristic collection of illustrative plates of helicobacter pylori.
Figure 106 is the nucleic acid fingerprint characteristic collection of illustrative plates of the autotrophy Flavobacterium to be measured (Xanthobacter autotrophicus Py2 chromosome) of embodiment tetra-.
Figure 107 is the bacterial nucleic acid fingerprint characteristic collection of illustrative plates of milk preparation to be measured in embodiment five.
Figure 108 is the microbial culture figure of control experiment in embodiment five.
Figure 109 is Ke's Albert'stain Albert figure of embodiment five control experiments.
Figure 110 is the nucleic acid fingerprint characteristic collection of illustrative plates of the meat product Bacteria Detection of embodiment six.
Figure 111 is Ke's Albert'stain Albert figure of embodiment six control experiments.
Figure 112 is gel electrophoresis figure after the pcr amplification of embodiment six control experiments.
Figure 113 is the bacterial nucleic acid fingerprint characteristic collection of illustrative plates of the source of pollution to be checked of embodiment seven.
Figure 114 is the cultivation figure of the Roche solid medium of the control experiment of embodiment seven.
Figure 115 is the luxuriant sodium resistance to acid smear method colored graph of the control experiment of embodiment seven.
Figure 116 is the bacterial nucleic acid fingerprint characteristic collection of illustrative plates of the sputum sample of embodiment eight.
Figure 117 is the fluorescence quantitative PCR detection figure of embodiment eight.
Figure 118 is the bacterial nucleic acid fingerprint characteristic collection of illustrative plates of the source of pollution to be checked of embodiment nine.
Figure 119 is the magenta method result figure of the microbial culture of embodiment nine control experiments.
Figure 120 is the bacterial nucleic acid fingerprint characteristic collection of illustrative plates of the fresh milk to be checked of embodiment ten.
Figure 121 is the rear gel electrophoresis figure of bacteria PCR amplification of embodiment ten control experiments.
Figure 122 is the constructed bacterium Phylogenetic tree of embodiment 11.
Figure 123 is the nucleic acid fingerprint characteristic collection of illustrative plates of embodiment 11 bacterium to be measured.
Figure 124 is the genetic evolution relation according to bacterium to be measured that evolutionary tree is determined in embodiment 11.
Embodiment
Now only with reference below the mode of nonrestrictive embodiment further describe the present invention.But should be appreciated that the following examples are only as illustration, should be by any way when doing the restriction overall to the invention described above.Unless have other explanation, embodiments of the invention are used traditional molecular biology, cytobiology, pcr amplification and mutating technology in this area etc.These technology are known by the technical staff, and have in the literature detailed explanation.Referring to, for example,
Sambrook and Russell″Molecular Cloning：A Laboratory Manual″(2001)；
Cloning：A Practical Approach，″Volumes I and II(D.N.Glover， ed.，1985)″；
T.A Brown “Genome” BIOS Scientific Publishers Limited;
PY Kwok Annu. Rev. Genomics Hum. Genet.(2001), 235–58.
The foundation of embodiment mono-, single bacterial nucleic acid fingerprint characteristic collection of illustrative plates
One, design and select universal primer
According in the conservative region (SEQ ID No:3) of the 16S rDNA of listeria bacteria (Listeria monocytogenes EGD-e, NCBI accession number: NC_003210.1), design universal PC R primer, is respectively:
5-aggaagagagAGAGTTTGATCCTGGCTCAG-3（SEQ ID No：1）
5-cagtaatacgactcactatagggagaaggctCTGCTGCGTCCCGTAG-3（SEQ ID No：2）
Wherein sequence A GAGTTTGATCCTGGCTCAG and CTGCTGCGTCCCGTAG respectively with 16S rDNA Region Matching to be amplified, aggaagagag and cagtaatacgactcactatagggagaaggct are the additional sequences of adding on upstream and downstream PCR primer, guarantee for PCR product is transcribed, the 5' of SEQ ID No:1 primer holds the tag(aggaagagag that contains 10bp), the 5' of SEQ ID No:2 primer holds the tag(cagtaatacgactcactatagggagaaggct that contains 31bp).
Relevant primer synthesizes in Sangon Biotech (Shanghai) Co., Ltd..
Two, universal primer amplification
To the DNA of the bacteriums such as listeria bacteria, use ABI 9700 type PCR instrument, carry out biological experiment operation.
1、PCR
(1) reaction system of PCR is:
PCR reaction buffer (10x PCR Buffer with 20mM MgCl
2): 0.5ul;
dNTP mix（25mM each）：0.04ul；
Taq enzyme (PCR Enzyme, 5U/ul): 0.04ul;
SEQ ID No：1（1μM）：1ul
SEQ ID No：2（1μM）：1ul；
DNA of bacteria: 1ul;
Ultrapure water: 1.42ul.
Above reagent, except DNA of bacteria, ultrapure water, primer, all comes from U.S. Sequenom company.
(2) loop parameter of PCR is:
95 ℃, 4 minutes, 1 circulation,
95 ℃, 20 seconds, 56 ℃, 30 seconds, 72 ℃, 60 seconds, 45 circulations,
72 ℃, 3 minutes, 1 circulation,
4 ℃, preserve.
2, SAP enzymic digestion
(1) reaction system of SAP enzymic digestion is:
In the PCR of 5ul product, add RNase-free ddH
2o:1.7ul, SAP enzyme (SAP enzyme, 1.7U/ul): 0.3ul.
Above reagent all comes from U.S. Sequenom company.
(2) reaction parameter of SAP enzymic digestion is:
37 ℃, 20 minutes, 1 circulation,
85 ℃, 5 minutes, 1 circulation,
4 ℃, preserve.
3, transcribe with nuclease and cut
(1) transcribing the reaction system of cutting with nuclease is:
The digestion product of getting 2ul, adds:
RNase-free ddH2O：3.21ul，
5xT7 Polymerase Buffer：0.89μl
T Cleavage Mix：0.22μl
DTT（100mM）：0.22μl
T7 RNA & DNA Polymerase：0.4μl
RNaseA：0.06μl
Above reagent, all comes from U.S. Sequenom company.
(2) transcribing the reaction parameter of cutting with enzyme is:
37℃，3h。
4, purifying
In transcribing of 7ul cut product with enzyme, add 20ul ultrapure water, after mixing, then add 6mg resin (resin, U.S. Sequenom company), turn upside down and mix 15 minutes.
Three, set up the nucleic acid fingerprint characteristic collection of illustrative plates of single bacterium listeria bacteria (Listeria monocytogenes EGD-e)
Product after purifying is used to receive and rises point sample instrument (Nanodispenser, U.S. Sequenom company), point extremely contains on the chip of matrix (SpectroCHIP, U.S. Sequenom company), and uses time-of-flight mass spectrometer (U.S. Sequenom company) to detect and result judgement.
Result can be found out by experiment, the conservative region of the selected listerial 16S rDNA of this programme, through biological experiment operation, this bacterium, produced the nucleic acid fragment combination of different lengths and different abundance, through mass spectrometric detection, form special nucleic acid finger printing, detected result, through bioinformatic analysis, can be carried out the classification and identification of Related Bacteria.
Repeat twice, all obtain identical nucleic acid fingerprint characteristic collection of illustrative plates (Fig. 1).
Embodiment bis-, the preparation method of one nucleic acid fingerprint characteristic collection of illustrative plates is implemented in checking among a small circle
Use method and primer described in embodiment mono-, Dichlorodiphenyl Acetate bacillus (Acetobacter pasteurianus IFO 3283-01), nitrogen-fixing rhizobia (Azorhizobium caulinodans ORS 571 chromosome) carry out that enzyme is cut and Mass Spectrometric Identification.
Repeat twice, all obtain identical nucleic acid fingerprint characteristic collection of illustrative plates, wherein Fig. 2, Fig. 3 show respectively the nucleic acid fingerprint characteristic collection of illustrative plates of bacillus aceticus and nitrogen-fixing rhizobia.
The foundation of the nucleic acid fingerprint characteristic spectrum library of embodiment tri-, bacterium
According to method and primer described in embodiment mono-, in his-and-hers watches 1, listed bacterium carries out that enzyme is cut and Mass Spectrometric Identification, obtains germy nucleic acid fingerprint characteristic collection of illustrative plates.
By these characteristic spectrums, by Bioexplore software, carry out confluence analysis, thereby obtain the nucleic acid fingerprint characteristic spectrum library including most bacteriums.
As shown in table 2, Fig. 4-Figure 100 shows respectively the nucleic acid fingerprint characteristic collection of illustrative plates of 97 kinds of bacteriums.
Table 2(note: table 2 is the italic content in table 1)
Figure 101-103 are sheep kind, ox kind, the brucellar nucleic acid fingerprint characteristic of pig kind collection of illustrative plates, the nucleic acid fingerprint characteristic collection of illustrative plates that Figure 104 is mycobacterium tuberculosis, the nucleic acid fingerprint characteristic collection of illustrative plates that Figure 105 is helicobacter pylori.
The nucleic acid fingerprint characteristic spectrum library of the bacterium that embodiment tetra-, utilization are set up, identifies the environmental safety of hospital
At the generate heat water tap, ditch etc. of certain hospital of disease of doubtful outburst infant, locate, collect source of pollution samples, after the dilution of sample to be tested appropriateness, be divided into two, wherein sample to be tested 1 is carried out after pcr amplification, enzyme cut according to the method for embodiment 1, carry out mass spectrometric detection, whole process 1-2 hour consuming time.
Use BioExplore software (its copyright number step on word for soft work No. 136879, registration number 2009SR10700), the mass spectral characteristic figure (Figure 106) of gained is compared with the bacterial nucleic acid fingerprint characteristic spectrum library of implementing to obtain in three, and the judging criterion of employing is:
When 2.300≤coupling mark≤3.000, represent that the confidence level of strain identification is very high;
As 2.000≤coupling mark < 2.300, represent conservative identification of bacteria or possible strain identification;
Between 1.700≤coupling mark < 2.000, the identification of bacteria expressing possibility;
Between 0.000≤coupling mark < 1.700, represent incredible evaluation.
Comparative analysis result is as follows:
Compared with Figure 100 in the spectrum library that testing sample collection of illustrative plates (Figure 106) is set up with embodiment tri-, coupling mark is 2.412, be greater than 2.300, meet completely with desired value, show that this testing sample is autotrophy Flavobacterium (Xanthobacter autotrophicus Py2 chromosome), the confidence level of its qualification result is very high.
Control experiment: the detection of the biochemical method of sample to be tested 2
1, sample to be tested is carried out to microscopy, present Gram-negative, thalline is shaft-like or club shape, unpowered gemma and pod membrane.
2, the sample to be tested 2 of separation and Culture first increases bacterium cultivation with meat soup, is then directly inoculated in blood agar or chocolate dull and stereotyped, cultivates 24 hours the further biochemical test of faint yellow bacterium colony and microscopy that picking is suspicious for 35 ℃.
3, biochemical reaction shows as: oxydase, catalase are positive, can decompose seminose, the ability of sugar fermentation slowly and slightly a little less than, aerobic growth, can be hydrolyzed Vitamin C2 and liquefy gelatin.Single bacterium colony after propagation is faint yellow, circular, diameter 1-1.5mm, smooth, transparent or semitransparent, slightly protruding, neat in edge.Above-mentioned reaction all meets single biochemical characteristic that increases autotrophy Flavobacterium, shows consistent with MALDI TOF MS qualification result.
By implementing the result that four nucleic acid fingerprint characteristic Atlas Method identifies, show, there is the pollution of Flavobacterium in this bulletin place, need to be to corresponding establishment disinfection, to prevent that public place from breaking out sporadic infection.
The nucleic acid fingerprint characteristic spectrum library of the bacterium that embodiment five, utilization are set up, detects milk preparation to be checked
To after milk preparation appropriateness to be checked dilution, be divided into two, wherein make with the following methods testing sample 1 to be detected:
One, the bacterial chromosomal dna that extracts milk sample with the CTAB-NaCl method of optimizing, concrete steps are as follows:
(1) get 1.5mL milk preparation, the centrifugal 10min of 10,000r/min, abandons supernatant;
(2) with NET solution (50mM NaCl, 125mM EDTA, 50mM Tris-HCl, pH7.6) suspend and be precipitated to 400 μ L, add 200 μ L 10% (w/v) SDS solution to final concentration 3.4% (w/v), put 80 ℃ of water-bath 10min, cooled on ice 3min;
(3) add respectively 3 μ L Proteinase Ks (200 mg/mL) and RNaseA (200mg/mL) to final concentration 1mg/mL, 50 ℃ of water-bath 2h;
(4) add 100 μ L 5M NaCl solution, (taking 4.1g NaCl is dissolved in 80mL water after mixing, to add 300 μ L to be preheated to the CTAB-NaCl solution containing 10% (w/v) CTAB and 0.7M NaCl of 65 ℃, slowly add 10g CTAB, heating for dissolving, be settled to 100mL), CTAB and the NaCl final concentration in extracting solution is respectively 3.4% (w/v) and 0.7M, 65 ℃ of water-bath 10min;
(5) add 600 μ L chloroforms: primary isoamyl alcohol (24: 1), room temperature concussion 2min, the centrifugal 5min of 10,000r/min; Carefully supernatant is transferred in clean centrifuge tube, added 600 μ L chloroforms: primary isoamyl alcohol (24: 1) repeats extracting 1 time;
(6) in supernatant, add 2/3 volume Virahol, mix, room temperature is placed 5min, and the centrifugal 10min of 10,000r/min, abandons supernatant; Precipitation is washed 2 times with 70% ethanol, 37 ℃ of dry 10min;
(7) with 5 μ L ultrapure water dissolving DNA precipitations, for pcr amplification.
Two, according to the method for embodiment 1, carry out after pcr amplification, enzyme cut, carrying out mass spectrometric detection, whole process 1-2 hour consuming time.
Use BioExplore software (its copyright number step on word for soft work No. 136879, registration number 2009SR10700), mass spectral characteristic Figure 107 of gained is compared with the bacterial nucleic acid fingerprint characteristic spectrum library of implementing to obtain in three, comparative analysis result is as follows:
Compared with Brucella abortus (Brucella abortus) in the spectrum library that testing sample collection of illustrative plates is set up with the present invention standard diagram (Figure 102), coupling mark is 2.308, be greater than 2.300, be reported as Brucella abortus, meet completely with desired value, the confidence level of qualification result is very high.
The control experiment of embodiment five: the detection of the biochemical method of sample to be tested 1
According to standard method preparation serum glucose nutrient agar SDA, and add penicillin or cephamycin (100 μ g/100ml).
Choose fresh milk sample to be measured, draw 0.5ml sample, be coated in previously prepared microbiotic SDA culture dish under gnotobasis, cultivate 3 days at 37 ℃, observe colony growth situation, result as shown in Figure 4.
Figure 108 shows, generates the small colonies of moistening, flash of light, water white transparency, circle, surface elevation, neat in edge in culture dish.As parallel test, choose the fresh milk sample of 0.5ml process Bath sterilization sterilization in contrast, on SDA substratum, cultivate after 3 days and generate without any bacterium colony.Therefore, the bacterium colony in microbiotic SDA substratum is doubtful is Brucella abortus.
For further this doubtful bacterium colony of identifying, use Ke's Albert'stain Albert method (husky Huang and Victoria Green WPB are to dying) staining to detect fresh milk sample to be measured.
Under gnotobasis, with the doubtful bacterium colony of aseptic liquid-transfering gun suction nozzle picking, be placed in 10ml liquid SDA substratum, vibration mixes.
Draw 1ml sample, be coated in previously prepared Ke's Albert'stain Albert culture dish under gnotobasis, cultivate 3 days at 37 ℃, observe colony growth situation, result as shown in Figure 7.
Figure 109 shows, doubtful bacterium colony presents red bead bacilliform at Ke's Albert'stain Albert culture dish, and two ends are blunt round shape, meets brucellar biochemical characteristic.
Above-mentioned test all meets brucellar biochemical characteristic, shows consistent with MALDI TOF MS qualification result.
The result of embodiment five shows, the pollution of the existing Brucella abortus of these fresh milk goods to be checked, need to destroy immediately, and to the processing of quarantining of relevant milk cow.
The nucleic acid fingerprint characteristic spectrum library of the bacterium that embodiment six, utilization are set up, detects barbecue's meat product
In the mutton sample of roadside barbecue, with aseptic technique, take lean meat sample 25 g after shredding, be placed in sterilizing homogeneous cup, add 25 mL, buffering peptone water enrichment liquid (penicillin 100 μ g/100ml), with 8000～10000r/min homogeneous 1min, immigration fills in the 500mL wide-necked bottle of 200 mL buffering peptone water enrichment liquids, mixes, if pH is lower than 6.6, with sterilizing 1mol/L sodium hydroxide solution, adjust pH to 6.8 ± 0.2, in 37 ℃ of water-baths, cultivate 4h (counting while reaching 37 ℃ with enrichment liquid), carry out front increasing bacterium; , pipette 10mL transferred species in fill the 250mL vial of 100mLGN enrichment liquid in, shake up, in 42 ± 1 ℃ of cultivation 20 ± 2h, carry out selective enrichment (penicillin 100 μ g/100ml) thereafter.If desired, separately take the lean meat sample that 25g shreds, add 25mLGN enrichment liquid, carry out equally homogeneous simultaneously., move into the 500mL wide-necked bottle that fill 200mLGN enrichment liquid in (penicillin 100 μ g/100mls), mix, if pH is lower than 6.6, with sterilizing 1mol/L sodium hydroxide solution, adjust pH to 6.8 ± 0.2, in 37 ℃, cultivate 24 ± 2 h thereafter.Then sample 2 to be checked is divided into two, wherein sample to be tested 2 is carried out after pcr amplification, enzyme cut, carrying out mass spectrometric detection, whole process 1-2 hour consuming time according to the method for embodiment 1.
Use BioExplore software (its copyright number step on word for soft work No. 136879, registration number 2009SR10700), the mass spectral characteristic figure (Figure 110) of gained is compared with the bacterial nucleic acid fingerprint characteristic spectrum library of implementing to obtain in three, and comparative analysis result is as follows:
Compared with Brucella melitensis (Brucella melitensis) in the spectrum library that testing sample collection of illustrative plates is set up with the present invention standard diagram (Figure 101), coupling mark is 2.420, is greater than 2.300, is reported as Brucella melitensis, meet completely with given value, the confidence level of qualification result is very high.
The control experiment one of embodiment six: the biochemical method of sample to be tested 2 detects
According to the method for embodiment five control experiments, choose 1ml sample 2 to be checked, under gnotobasis, be coated in previously prepared Ke's Albert'stain Albert culture dish, at 37 ℃, cultivate 3 days, observe colony growth situation, result is as shown in Figure 111.
In Yin Ben experiment, not select single bacterium colony (as embodiment five), and contain other miscellaneous bacterias in sample 2 to be checked, therefore Figure 111 is presented at around green miscellaneous bacteria, is distributing and is justifying shape or the single bacterium colony of spherical redness, and Ke's Albert'stain Albert method result of this and Brucella melitensis is in full accord.
The control experiment two of embodiment six: the molecular Biological Detection of sample to be tested 2
One, design of primers
For Brucella melitensis (Brucella abortus)) the specific PCR amplification Oligonucleolide primers of outer membrane protein (OMP) 25kd gene design:
BP1：5’-CGT GCC GCA ATT ACC CTC-3’
BP2：5’-CCG TCA GCT TGG CTT CGA-3
Two, PCR
Choose single red bacterium colony in Ke's Albert'stain Albert culture dish, ordinary method multiplication culture bacterium colony, and extract bacteria total DNA.
According to following parameter, carry out PCR:
Reaction conditions is 94 ℃ of 10min, 94 ℃ of 1min, and 50 ℃ of 1min, 72 ℃ of 2min, circulate 35 times, and 72 ℃ are extended 10min.
After reaction finishes, get reaction product 5 μ l and be added on 1.0% sepharose (containing 0.5 μ g/ml EB) plate, electrophoresis observation result in TAE electrophoresis liquid.
Three, result and judgement
In PCR test, set up positive control and blank simultaneously, after all setting up, PCR detected result is judged: in test sample road, occur that 419bp amplified band person is as the Infected with Brucella positive; In test sample road, do not occur that 419bp amplified band person is for Infected with Brucella feminine gender, result is as shown in Figure 112: swimming lane 1 is DL 2000DNA Marker; Swimming lane 2 and 3 is OMP 25 amplified fragments; Swimming lane 4 is negative controls.
According to the result of embodiment six, can determine that the mutton fresh meat that this barbecue sells is infected by Brucella melitensis, need to destroy at once, and related personnel is isolated for treatment.
The concretion mycobacterium nucleic acid fingerprint characteristic spectrum library that embodiment seven, utilization are set up, identifies the environmental safety of kindergarten
In the water tap of certain public kindergarten of doubtful Child Pulmonary Tuberculosis contagium, ditch etc., locate, collect source of pollution sample, after the dilution of sample to be tested appropriateness, be divided into two, wherein sample to be tested 1 is carried out after pcr amplification, enzyme cut according to the method for embodiment 1, carry out mass spectrometric detection, whole process 1-2 hour consuming time.
Use BioExplore software (its copyright number step on word for soft work No. 136879, registration number 2009SR10700), the mass spectral characteristic of gained (Figure 113) and the bacterial nucleic acid fingerprint characteristic spectrum library of implementing to obtain in three are compared, and comparative analysis result is as follows:
Compared with the standard diagram 104 of the mycobacterium tuberculosis in the spectrum library that testing sample collection of illustrative plates (Figure 113) is set up with the present invention, coupling mark is 2.470, is greater than 2.300, is reported as mycobacterium tuberculosis, meet completely with given value, the confidence level of qualification result is very high.
The control experiment of embodiment seven: the biochemical analysis control experiment of sample to be tested 1
One, the initial analysis of sample to be tested 1
1, the sample to be tested 1 of separation and Culture is cultivated 2 weeks upper 35 ℃ of Roche solid medium (comprising potato, Victoria Green WPB etc.), produces the oyster white bacterium colony (seeing Figure 114) of particle or cauliflower form, the further biochemical test of bacterium colony and microscopy that picking is suspicious.
2, sample to be tested is carried out to microscopy, luxuriant sodium resistance to acid smear method presents redness, and it is elongated that thalline is, and holds extremely blunt circle, unpowered gemma and pod membrane (Figure 115).
Thus, can tentatively determine that sample to be tested is mycobacterium tuberculosis.
Two, the biochemical analysis of sample to be tested 1
1, by following formulated mycobacterium tuberculosis substratum:
Wherein, substratum making method: after first distilled water being mixed with glycerine, then add successively each composition, to be dissolved after with 10% HCl adjust ph value to 6.6～6.8, high pressure 0.7 × 105pa, 20min sterilizing.To be cooled to 56 ℃., add degerming calf serum, be mixed, be divided in culture dish, after 37 ℃ of aseptic mensuration 24h, store 4 ℃ of refrigerators standby.
In addition, under aseptic condition, use the asepsis injector of hyperfiltration Rifampin (100mg/L) to be added in the dull and stereotyped culture dish of having made, after coating evenly, then after 37 ℃ of aseptic mensuration 24h.
2, experiment test
Sample to be tested in embodiment bis-1 and blank (sterilized water) are made to bacteria suspension, get 0.1ml, slowly coat equably on the culture dish of blank substratum and Rifampin substratum, put in 37 ℃ of thermostat containers, after 2 weeks, report the result.
Test-results criterion is as follows:
The flat board of (-) substratum is without colony growth;
(+) colony number accounts for the platen area 1/4 of substratum;
(++) colony number accounts for the platen area 1/2 of substratum;
(+++) colony number accounts for the platen area 3/4 of substratum;
(++++) bacterium colony is the growth of lawn sample.
Report colony number: when pastille substratum colony number is below 20, the number of report bacterium colony.
Above-mentioned test all meets the biochemical characteristic of mycobacterium tuberculosis, shows consistent with MALDI TOF MS qualification result.
Result by embodiment seven shows, this bulletin place exists the pollution of mycobacterium tuberculosis, need to seal immediately garden, and to corresponding establishment disinfection, to prevent that kindergarten from breaking out sporadic infection.
The nucleic acid fingerprint characteristic spectrum library of the bacterium that embodiment eight, utilization are set up, to the rapid detection of frontier port suspected patient
In certain port of entry, airport, to occurring that certain foreign nationality passenger of doubtful caking appears in heating, acutely cough and X-ray lung, after isolating, choose its sputum sample 5ml, add in the aseptic centrifuge tube of 50 ml, add equivalent NACL-NaOH solution, the vibration of vortex oscillator, fully liquefy sputum sample, the standing 15min of room temperature, add 0.067 mol/L PBS solution, fully mix with in and Digestive system effect, centrifugal 15 min of 3 000 g, carefully abandon supernatant, in throw out, add the about 2ml of 0.067mol/LPBS again to mix, be postdigestive phlegm sample to be tested 2.
Sample to be checked is divided into two, wherein sample to be tested 2 is carried out after pcr amplification, enzyme cut, carrying out mass spectrometric detection, whole process 1-2 hour consuming time according to the method for embodiment 1.
Use BioExplore software (its copyright number step on word for soft work No. 136879, registration number 2009SR10700), compared with the standard diagram 104 of the mycobacterium tuberculosis in the spectrum library that the mass spectral characteristic figure (Figure 116) of gained is set up with the present invention, comparative analysis result coupling mark is 2.380, be greater than 2.300, be reported as mycobacterium tuberculosis, meet completely with given value, the confidence level of qualification result is very high.Judge that thus this passenger is as mycobacterium tuberculosis positive patient.
The control experiment of embodiment eight: the fluorescence quantitative PCR detection of sample to be tested 2
Sputum sample after digestion process is added to the 4%NaOH of 4 times of volumes, liquefaction 30min left and right, gets 0.5ml to centrifuge tube, adds 0.5ml 4%NaOH, centrifugal 5 min of 10000 r/min after 10min.Remove supernatant, precipitation adds stroke-physiological saline solution 1ml and mixes, the centrifugal 5min of 10000r/min, repeated washing 1 time.Precipitation adds 50 μ lDNA extracting solutions and mixes, and boiling water bath 10min, goes to 4 ℃ of standing 6-8h to guarantee abundant cracking.The centrifugal 5min of 10000r/min, gets supernatant liquor 2 μ l and increases, 93 ℃ of 2min denaturations, 93 ℃ of 45s, 10 circulations of 55 ℃ of 60s amplifications, 93 ℃ of 30s, 55 ℃ of 45s, 30 circulations of increasing.
Separately get negative quality control product, the each 40 μ l of positive quality control product add equivalent DNA extraction liquid and mix, boiling water bath 10min process.According to the result judging criterion of detection reagent specification sheets, carry out interpretation of result, result is as shown in Figure 117.
According to the result of embodiment eight, can make a definite diagnosis this passenger is lunger, need to isolate for treatment to it.
The concretion mycobacterium nucleic acid fingerprint characteristic spectrum library that embodiment nine, utilization are set up, identifies the safety of waterhead area
At the waterhead area of certain waterworks of doubtful helicobacter pylori contagium, collect source of pollution samples, after the dilution of sample to be tested appropriateness, be divided into two, wherein sample to be tested 1 is carried out after pcr amplification, enzyme cut according to the method for embodiment 1, carry out mass spectrometric detection, whole process 1-2 hour consuming time.
Use BioExplore software (its copyright number step on word for soft work No. 136879, registration number 2009SR10700), the mass spectral characteristic of gained (Figure 118) and the bacterial nucleic acid fingerprint characteristic spectrum library of implementing to obtain in three are compared, comparative analysis result is as follows: testing sample collection of illustrative plates divides compared with the standard diagram 105 of the helicobacter pylori (Helicobacter pylori) in the spectrum library of setting up with the present invention, coupling mark is 2.340, be greater than 2.300, be reported as helicobacter pylori, meet completely with given value, the confidence level of qualification result is very high.
The control experiment of embodiment nine: the biochemical analysis control experiment of sample to be tested 1
One, the biochemical analysis of sample to be tested 1
1, by following formulated helicobacter pylori isolation medium:
Under aseptic condition, in prefabricated brain heart leach liquor agar (purchased from Difco) liquid nutrient medium 150ml, add defiber sheep blood 8ml, and add mix microbiotic (vancomycin 10mg/L, Trimethoprim lactic acid salt 0.005mg/L, amphotericin B 10mg/L, PXB 0.005mg/L), regulating pH is 7.5, then pour in multiple culture dish preparation helicobacter pylori isolation medium into.
Control medium (being that microbiotic replaces with amoxycilline Trihydrate bp 10mg/L, levofloxacin 2mg/L) is set simultaneously
3, experiment test
Sample to be tested in embodiment bis-1 and blank (sterilized water) are made to bacteria suspension, get 0.1ml, slowly coat equably on the culture dish of isolation medium and control medium, put in 37 ℃ of thermostat containers, after 3 days, report the result.
Test-results criterion is as follows:
The flat board of (-) substratum is without colony growth;
(+) colony number accounts for the platen area 1/4 of substratum;
(++) colony number accounts for the platen area 1/2 of substratum;
(+++) colony number accounts for the platen area 3/4 of substratum;
(++++) bacterium colony is the growth of lawn sample.
(+-) the suspicious growth of bacterium
Report colony number: when pastille substratum colony number is below 20, the number of report bacterium colony.
4, use magenta method, the single bacterium colony of picking from isolation medium, dyeing is carried out microscopy after processing.
Under microscope, show that this bacterium is for red bending shaft-like or spirrillum, and background be white, contrast gradient clear (referring to Figure 119).
Above-mentioned test all meets the biochemical characteristic of helicobacter pylori, shows consistent with MALDI TOF MS qualification result.
The result of embodiment nine shows, the waterhead area of this waterworks, by the pollution of helicobacter pylori, need to carry out disinfecting to this waterhead area, removes periphery ight soil, livestock, excremental source of pollution.
The nucleic acid fingerprint characteristic spectrum library of the bacterium that embodiment ten, utilization are set up, detects fresh milk to be checked
According to the people such as Tian Yu (< < dairy industry science and technology > >, 2006) report, use the DNA of bacteria of optimizing in CTAB-NaCl method extraction fresh milk, and carry out after pcr amplification, enzyme cut according to the method for embodiment 1, carry out mass spectrometric detection, whole process 1-2 hour consuming time.
Use BioExplore software (its copyright number step on word for soft work No. 136879, registration number 2009SR10700), the mass spectral characteristic of gained (Figure 120) and the bacterial nucleic acid fingerprint characteristic spectrum library of implementing to obtain in three are compared, and comparative analysis result is as follows:
Compared with the standard diagram 105 of helicobacter pylori (Helicobacter pylori) in the spectrum library that testing sample collection of illustrative plates (Figure 120) is set up with the present invention, coupling mark is 2.470, be greater than 2.300, be reported as helicobacter pylori, meet completely with given value, the confidence level of qualification result is very high.
The control experiment of embodiment ten: the molecular Biological Detection of fresh milk
According to helicobacter Pylori urease gene, in Genebank, retrieve 1 gene order (Accession M60398).According to gene order, design following primer, with the fragment of the about 250bp that increases:
Forward primer: 5 ＇-AAGCTTTTAGGGGTGTTAGGGGTTT-3 ＇;
Reverse primer: 5 ＇-CAAGCCATCGCCGG TTTTAGC-3 ＇
Helicobacter pylori reference culture liquid and aseptic fresh milk standard control are set, carry out pcr amplification.
PCR reaction system:
Reaction conditions:
5 ℃ of denaturation 2mi n; 94 ℃ of sex change 1min, 61 ℃ of annealing 20s, 72 ℃ are extended 30s, 35 circulations;
72 ℃ are extended 5mi n.
Amplified production is carried out to gel electrophoresis, and result is as shown in following table and Figure 121
| Swimming lane | Test | Object fragment | |
| 1 | 10 ml standard bacterium liquid | ++ | |
| 2 | 10ml fresh milk to be measured | + | |
| 3 | 10ml fresh milk to be measured | + | |
| 4 | 9ml fresh milk+1ml standard bacterium liquid | + | |
| 5 | The aseptic fresh milk contrast of 10ml | - |
By implementing ten nucleic acid fingerprint characteristic Atlas Method, identify and PCR detection method, can determine that this fresh milk, by helicobacter pylori, need to destroy at once, and the relevant pathogeny of making a thorough investigation.
Embodiment 11, utilize the bacterial nucleic acid fingerprint characteristic collection of illustrative plates of setting up, for foundation and the classification of the Phylogenetic tree of different bacterium strain isolated
Utilize existing bacterial nucleic acid fingerprint characteristic spectrum library, extract wherein nuclease and cut information, utilize Phylogenetic tree or the phylogenetic tree (Figure 122) of 841 kinds of bacterium kinds described in Clustalx2.0 and MEGA4.1 software building.On evolutionary tree, can observe intuitively the evolutionary relationship of the not of the same race and different isolates of various Pseudomonas, can clearly judge the evolutionary relationship of bacterial strain to be measured and the each bacterium of this genus simultaneously.In addition, the foundation of phylogenetic tree also can be verified the analytical results of BE software, further proves the accuracy of Bacteria Identification.
For example, in oral cavity, separate and obtain a strain suis, according to the method for previous embodiment, compared with in the spectrum library that its collection of illustrative plates (Figure 123) is set up with the present invention respectively, result shows the standard diagram comparison of itself and Streptococcus sanguis (Streptococcus parasanguinis ATCC 15912), and coupling mark is greater than 2.300, is reported as Streptococcus sanguis, meet completely with given value, the confidence level of qualification result is very high.
According to phylogenetic tree, also verified that Pseudomonas to be measured is in streptococcus, simultaneously nearest with the sibship of Streptococcus sanguis (Streptococcus parasanguinis ATCC 15912).
SEQUENCE LISTING
<110> is to China
The purposes that <120> utilizes bacterial nucleic acid fingerprint characteristic spectrum storehouse to identify and classify
<130> 2012
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 30
<212> DNA
<213> artificial sequence
<400> 1
aggaagagag agagtttgat cctggctcag 30
<210> 2
<211> 47
<212> DNA
<213> artificial sequence
<400> 2
cagtaatacg actcactata gggagaaggc tctgctgcgt cccgtag 47
<210> 3
<211> 358
<212> DNA
<213> artificial sequence
<400> 3
ctgctgcctc ccgtaggagt ctgggccgtg tctcagtccc agtgtggccg atcaccctct 60
caggtcggct atgcatcgtt gccttggtag gccattaccc taccaactag ctaatgcacc 120
gcgggcccat ctgtaagcga tagccgaaac catctttcaa aagcgtggca tgcgccacac 180
tttatcattc ggtattagcc ccggtttccc ggagttatcc ccaacttaca ggcaggttgc 240
ccacgtgtta ctcacccgtc cgccactaac tttggaagag caagctcttc ctccgttcgt 300
tcgacttgca tgtattaggc acgccgccag cgttcgtcct gagccaggat caaactct 358
<210> 4
<211> 18
<212> DNA
<213> artificial sequence
<400> 4
cgtgccgcaa ttaccctc 18
<210> 5
<211> 18
<212> DNA
<213> artificial sequence
<400> 5
ccgtcagctt ggcttcga 18
<210> 6
<211> 25
<212> DNA
<213> artificial sequence
<400> 6
aagcttttag gggtgttagg ggttt 25
<210> 7
<211> 21
<212> DNA
<213> artificial sequence
<400> 7
caagccatcg ccggttttag c 21
Claims (2)
1. a method of preparing bacterial nucleic acid fingerprint databases, comprises step:
(1) PCR reaction: use the PCR universal primer of the target area in directed toward bacteria 16S rDNA, the nucleic acid-templated of multiple bacteriums of increasing respectively, obtains the PCR product containing amplification target area, and wherein said primer pair sequence is selected from:
SEQ ID NO：1 5-aggaagagagAGAGTTTGATCCTGGCTCAG-3
SEQ ID No：2 5-cagtaatacgactcactatagggagaaggctCTGCTGCGTCCCGTAG-3；
(2) SAP enzymic digestion: the PCR product obtaining with SAP enzyme treatment step (1);
(3) transcribe with nuclease and cut: use and specifically transcribe and restriction endonuclease, in a reaction system, the digestion product of each bacterium that step (2) is obtained is transcribed with nuclease and is cut, obtain the nucleic acid fragment that a series of length differs, abundance differs, the restriction endonuclease of wherein cutting for nuclease is RNaseA enzyme;
(4) purifying: the enzyme that uses resin treatment step (3) to obtain is cut product;
(5) mass spectrograph detects: on the purified product that step (4) is obtained, point is on the target sheet that contains matrix, and upper mass spectrograph detects, and obtains the feature nucleic acid fingerprint chromatogram of different bacterium;
(6) by the nucleic acid fingerprint characteristic collection of illustrative plates of the various bacteriums that obtain, by computer software, gather and arrange, obtain described bacterial nucleic acid fingerprint characteristic spectrum library, wherein said software is BioExplore software, and it is that No. 136879, registration number are 2009SR10700 that its soft work is stepped on word.
2. the process of claim 1 wherein that described bacterium comprises 836 kinds of bacteriums as listed in table 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210273570.9A CN102851747B (en) | 2012-05-08 | 2012-08-02 | Method of preparing bacterium nucleic acid fingerprinting database |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210139276 | 2012-05-08 | ||
| CN201210139276.9 | 2012-05-08 | ||
| CN201210273570.9A CN102851747B (en) | 2012-05-08 | 2012-08-02 | Method of preparing bacterium nucleic acid fingerprinting database |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102851747A CN102851747A (en) | 2013-01-02 |
| CN102851747B true CN102851747B (en) | 2014-04-30 |
Family
ID=47398706
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210273570.9A Active CN102851747B (en) | 2012-05-08 | 2012-08-02 | Method of preparing bacterium nucleic acid fingerprinting database |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102851747B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103352257B (en) * | 2012-05-08 | 2014-08-27 | 马庆伟 | Method for preparing bacterial nucleic acid fingerprint characteristic spectrum library |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2000135085A (en) * | 1998-10-29 | 2000-05-16 | Canon Inc | 16s ribosomal-rna gene, and detection of ps. alcaligenes kb2 strain by using dna sequence in the gene |
| CN101475987A (en) * | 2009-01-13 | 2009-07-08 | 南京大学 | Rapid molecule detecting method for microflora composition in waste water biological treatment reactor |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101967509A (en) * | 2009-07-28 | 2011-02-09 | 天津生物芯片技术有限责任公司 | Method, gene chip and detection reagent kit for detecting common cow pathogenic escherichia coli |
-
2012
- 2012-08-02 CN CN201210273570.9A patent/CN102851747B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2000135085A (en) * | 1998-10-29 | 2000-05-16 | Canon Inc | 16s ribosomal-rna gene, and detection of ps. alcaligenes kb2 strain by using dna sequence in the gene |
| CN101475987A (en) * | 2009-01-13 | 2009-07-08 | 南京大学 | Rapid molecule detecting method for microflora composition in waste water biological treatment reactor |
Non-Patent Citations (8)
| Title |
|---|
| Bacterial genotyping by 16S rRNA mass cataloging;George W Jackson等;《BMC Bioinformatics》;20060623;第7卷(第321期);摘要，第2页右栏，第3页坐栏，第5页右栏-第6页，图3-图6 * |
| George W Jackson等.Bacterial genotyping by 16S rRNA mass cataloging.《BMC Bioinformatics》.2006,第7卷(第321期),摘要，第2页右栏，第3页坐栏，第5页右栏-第6页，图3-图6. |
| Microbial identification by mass cataloging;Zhengdong Zhang等;《BMC Bioinformatics》;20060308;第7卷(第117期);摘要，第2页右栏-第4页左栏，表1 * |
| Zhengdong Zhang等.Microbial identification by mass cataloging.《BMC Bioinformatics》.2006,第7卷(第117期),摘要，第2页右栏-第4页左栏，表1. |
| 基于质谱的核酸指纹识别技术;李军;《现代仪器》;20091031(第5期);30-33 * |
| 基质辅助激光解吸电离飞行时间质谱技术作为常见益生菌菌种鉴定辅助工具的研究;范铁男等;《Chinese Journal of Microecology》;20101130;第22卷(第11期);970-973 * |
| 李军.基于质谱的核酸指纹识别技术.《现代仪器》.2009,(第5期),30-33. |
| 范铁男等.基质辅助激光解吸电离飞行时间质谱技术作为常见益生菌菌种鉴定辅助工具的研究.《Chinese Journal of Microecology》.2010,第22卷(第11期),970-973. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102851747A (en) | 2013-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| de Bok et al. | Volatile compound fingerprinting of mixed-culture fermentations | |
| Chen et al. | Evaluation of the matrix-assisted laser desorption/ionization time-of-flight mass spectrometry Bruker Biotyper for identification of Penicillium marneffei, Paecilomyces species, Fusarium solani, Rhizopus species, and Pseudallescheria boydii | |
| Suzuki et al. | Bacterial flora analysis of coliforms in sewage, river water, and ground water using MALDI-TOF mass spectrometry | |
| CN101831493A (en) | Loop-mediated isothermal amplification (LAMP) primer pair of bacillus cereus and detection method | |
| Guo et al. | Phytophthora infestans isolates from Northern China show high virulence diversity but low genotypic diversity | |
| Febbraro et al. | MALDI-TOF MS Versus VITEK® 2: Comparison of systems for the identification of microorganisms responsible for bacteremia | |
| Kim et al. | Rapid identification of Staphylococcus species isolated from food samples by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry | |
| CN102851362B (en) | Method for quickly identifying Brucella based on mass spectrum technology and application thereof | |
| CN103352257B (en) | Method for preparing bacterial nucleic acid fingerprint characteristic spectrum library | |
| CN103361418B (en) | Nucleic acid fingerprint characteristic spectrum kit | |
| CN111154900A (en) | Pseudomonas aeruginosa specific new molecular target and rapid detection method thereof | |
| CN103060431A (en) | 16S rDNA based preparation method of bacteria nucleic acid fingerprint characteristic spectrums and application thereof | |
| Séjalon-Delmas et al. | Molecular tools for the identification of Tuber melanosporum in agroindustry | |
| Maquelin et al. | Raman spectroscopic typing reveals the presence of carotenoids in Mycoplasma pneumoniae | |
| CN102851747B (en) | Method of preparing bacterium nucleic acid fingerprinting database | |
| CN103060926A (en) | Enzyme digestion based preparation method of bacteria nucleic acid fingerprint characteristic spectrums and application thereof | |
| Kieu et al. | Clostridium culturomicium sp. nov. and Clostridium jeddahitimonense sp. nov., novel members of the Clostridium genus isolated from the stool of an obese Saudi Arabian | |
| Kong et al. | Safety and technological characterization of Staphylococcus xylosus and Staphylococcus pseudoxylosus isolates from fermented soybean foods of Korea | |
| CN102827930B (en) | Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof | |
| CN102808223B (en) | Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database | |
| CN103060925A (en) | Method for preparing bacteria nucleic acid fingerprint characteristic spectrum library | |
| CN113930543A (en) | Real-time fluorescent PCR (polymerase chain reaction) kit for detecting fusarium graminearum toxigenic fungi in food | |
| He et al. | Application of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry for the rapid identification of yeast species from polar regions | |
| CN106884036A (en) | The authentication method of animal provenance, the method for building up for identifying model and its application | |
| Lin et al. | Phylogenetic and spectroscopic analysis of Alicyclobacillus isolates by 16S rDNA sequencing and mid-infrared spectroscopy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: BEIJING YIXIN BOCHUANG BIOTECHNOLOGY CO., LTD. Free format text: FORMER OWNER: XIANG HUA Effective date: 20140307 |
|
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Xueji Inventor after: Ma Qingwei Inventor after: Zhang Haiyan Inventor before: Ma Qingwei Inventor before: Zhao Hongbin Inventor before: Zhang Haiyan |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: MA QINGWEI ZHAO HONGBIN ZHANG HAIYAN TO: ZHANG XUEJI MA QINGWEI ZHANG HAIYAN Free format text: CORRECT: ADDRESS; FROM: 410128 CHANGSHA, HUNAN PROVINCE TO: 100023 DAXING, BEIJING |
|
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20140307 Address after: 100023 Beijing City, Beijing economic and Technological Development Zone East Road No. 1 1 Chuang Sheng B201 Applicant after: BEIJING YIXIN BOCHUANG BIOTECHNOLOGY CO., LTD. Address before: 405 room 410128, Xing Xiang building, 1 Nongda Road, Furong district, Hunan, Changsha Applicant before: Xiang Hua |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Yang Juan Inventor after: Zhang Xueji Inventor after: Ma Qingwei Inventor after: Zhang Haiyan Inventor before: Zhang Xueji Inventor before: Ma Qingwei Inventor before: Zhang Haiyan |
|
| COR | Change of bibliographic data | ||
| CP02 | Change in the address of a patent holder |
Address after: Xinyi Road Xiufeng District, Guilin city 541001 No. 93 the Guangxi Zhuang Autonomous Region Patentee after: BEIJING YIXIN BOCHUANG BIOTECHNOLOGY CO., LTD. Address before: 100023 Beijing City, Beijing economic and Technological Development Zone East Road No. 1 1 Chuang Sheng B201 Patentee before: BEIJING YIXIN BOCHUANG BIOTECHNOLOGY CO., LTD. |