CN102851373B - SSR-labeled fingerprint of shiitake mushroom Minfeng No.1 strain, and application thereof - Google Patents

Abstract

The invention relates to an SSR-labeled fingerprint of shiitake mushroom Minfeng No.1 strain, and an application thereof. The fingerprint is composed of 7 pairs of SSR-labeled specific allelic fragments developed according to a shiitake mushroom genomic sequence. The application comprises the steps that: SSR-labeled amplification is carried out upon a shiitake mushroom strain; and an obtained band type is compared with the fingerprint. If the band type is consistent with the fingerprint, the strain is a shiitake mushroom Minfeng No.1 strain. Compared with a conventional morphological detection method, an antagonistic test, and mushroom fruiting trials, the application provided by the invention has the advantages of short detection time, high accuracy, and good repeatability. In 25 collected nationally validated shiitake mushroom main cultivated strains of our nation, the fingerprint has shiitake mushroom Minfeng No.1 strain specificity.

Description

The SSR marker finger printing of a kind of mushroom Min Feng No. 1 bacterial classification and application

Technical field

The invention belongs to the detection field of mushroom strain, particularly the SSR marker finger printing of a kind of mushroom Min Feng No. 1 bacterial classification and application.

Background technology

China's mushroom production has developed 2,420,000 tons of 2005 rapidly from 1.95 ten thousand of nineteen eighty-three tons, account for more than 70% of global mushroom ultimate production, rewrite the ranking list of world's edible mushrooms output, and constantly reduce the Twospore Mushroom poor distance with seniority among brothers and sisters first, there is scholarly forecast, due to the fast development of Lentinus Edodes In China industry, in nearly 10 years, it will become the highest edible mushrooms of world wide production.Lentinus Edodes In China is with its alarming development speed, and the quality of high-quality and cheap cost are that world mushroom industry personage attractes attention, the fashionable world of Lentinus Edodes In China.

The contribution rate of good quality strain in mushroom per unit area yield and quality is held the balance, and which dictates that the critical role of mushroom strain in mushroom industry.Within 1999, China endorsed " International Plant New variety protection method "; this not only requires that we respect the kind intellecture property of other country; also want the kind intellecture property of our country oneself of more protection simultaneously; the kind property right of China is really protected in order to set up edible mushrooms new variety resignation system; first ripe cultivar identification technology must be set up, for new variety registration lays the foundation.Especially Japan to come into effect " seedling method amendment " on April 1st, 2004, the great threat of the export mixes to China edible mushrooms especially mushroom.With regard to domestic, the phenomenon of cultivating champignon bacterial classification " homonymus or synonymum, xenogenesis is of the same name ", brings great loss not only to mushroom agriculture, have impact on their cultivation enthusiasm, also greatly have impact on the fast development of Lentinus Edodes In China; And, along with the appearance of large-scale factory culture mode, more and more higher to the requirement of cultivating champignon bacterial strain quality, need that development is more easy, identification of strains technology fast and accurately, with ensure every batch with kind all accurate.

In the face of this situation, just need us to accelerate the research of strain identification technology further, in the research of mushroom, introduce more efficiently strain identification system.

Summary of the invention

Technical problem to be solved by this invention is to provide the SSR marker finger printing of a kind of mushroom Min Feng No. 1 bacterial classification and construction process thereof and application, this finger printing detects with routine morphological, compared with antagonistic effect, fruiting experiment, have detection time short, accuracy is high, reproducible advantage.

The SSR marker finger printing of a kind of mushroom Min Feng of the present invention No. 1 bacterial classification, this finger printing is made up of 7 pairs of SSR marker, is based on mushroom genome simple repeated sequence fragment SSR primers development, and amplification banding pattern is good, the SSR primer that repeatability is high, mark details are as table 1.

Table 1SSR marks details list

The application of the SSR marker finger printing of a kind of mushroom Min Feng of the present invention No. 1 bacterial classification, the 7 pairs of SSR primers utilizing mushroom genome simple repeated sequence fragment to develop, by examining the SSR primer banding pattern amplification of cultivating champignon kind to 25 parts of states of collecting, the present invention determines the quantity of the allele that 7 pairs of SSR primers amplify in mushroom Min Feng No. 1 bacterial classification and numbers (table 2), effectively can identify Min Feng No. 1 bacterial classification (Fig. 2-8) by the numbering combination of different SSR allele.The relative molecular weight of the allele of each SSR primer amplification can be determined by contrast 50bp DNAladder, there is the bacterial classification of the special SSR allele combination of Min Feng No. 1 bacterial classification, namely be mushroom Min Feng No. 1 bacterial classification, the numbering of this bacterial classification is combined as: (1+2) (1+4) (1+2) 2122.

The allele information summary sheet of table 2SSR primer amplification

beneficial effect

The present invention detects with routine morphological, compared with antagonistic effect, fruiting experiment, have detection time short, accuracy is high, reproducible advantage.Detect required time and only need 3 ~ 4 days, and the antagonistic effect required time of routine at least needs two time-of-weeks, fruiting experiment then needs the time of at least 3 months; The method has the specificity of Min Feng No. 1 bacterial classification in the collected main cultivation bacterial classification of China's 25 mushrooms examined by state, has a good application prospect.

Accompanying drawing explanation

Fig. 1 is mushroom Min Feng No. 1 bacterial classification SSR marker finger printing, and wherein M is 50bp DNA ladder, digitized representation be 7 pairs of SSR primers used, NC is blank, arrow refer to mushroom Min Feng No. 1 bacterial classification specificity SSR allele combination;

Fig. 2 is that primer Le_fp0001 examines the AFLP system in cultivating champignon material in selected state;

Fig. 3 is that primer Le_fp0002 examines the AFLP system in cultivating champignon material in selected state;

Fig. 4 is that primer Le_fp0003 examines the AFLP system in cultivating champignon material in selected state;

Fig. 5 is that primer Le_fp0004 examines the AFLP system in cultivating champignon material in selected state;

Fig. 6 is that primer Le_fp0005 examines the AFLP system in cultivating champignon material in selected state;

Fig. 7 is that primer Le_fp0006 examines the AFLP system in cultivating champignon material in selected state;

Fig. 8 is that primer Le_fp0007 examines the AFLP system in cultivating champignon material in selected state.

Embodiment

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.In addition should be understood that those skilled in the art can make various changes or modifications the present invention, and these equivalent form of values fall within the application's appended claims limited range equally after the content of having read the present invention's instruction.

Embodiment 1

(1) mycelium culture: mushroom strain is transferred in potato dextrose medium, lucifuge shake-flask culture at 23 DEG C ~ 25 DEG C, collects mycelia after 3d ~ 4d;

(2) extraction of genomic dna: use CTAB(cetyl trimethylammonium bromide) method extracts the genomic dna of above-mentioned mycelia, and ultraviolet spectrophotometry detects total genomic dna concentration and purity, and the concentration of adjustment sample DNA is consistent;

The genomic dna technique that CTAB method extracts mycelia comprises:

1. by the mushroom mycelium grind into powder of liquid-nitrogen freeze drying, add 2 × CTAB extract of 65 DEG C of preheatings, in 65 DEG C insulation 45 ~ 60min, or jog mixing;

2. 12000rpm, 4 DEG C of centrifugal 20min, get supernatant liquor;

3. in above-mentioned supernatant liquor, add the mixed solution of phenol, chloroform and the primary isoamyl alcohol that volume ratio is 25:24:1, mix 10min gently, 12000rpm, 4 DEG C of centrifugal 10min, get supernatant liquor and move in centrifuge tube;

4. in above-mentioned centrifuge tube, add the chloroform that volume ratio is 24:1 and primary isoamyl alcohol mixed solution, mix 10min gently, 12000rpm, 4 DEG C of centrifugal 10min, get supernatant liquor and move in another centrifuge tube;

5. in above-mentioned centrifuge tube, add the Virahol of-20 DEG C of precoolings of 2/3 volume (supernatant liquor relative in step (4)), shake 5min gently, 8000rpm, 4 DEG C of centrifugal 10min, remove supernatant;

6. the precipitation 75vol% ethanol obtained and 10mmol/L Potassium ethanoate are washed 2 ~ 3 times, each 8000rpm, the centrifugal 5min of room temperature;

7. add the 95vol% ethanol of precooling, turn upside down gently, the centrifugal 10min of 8000rpm room temperature, abandons ethanol, and vacuum is drained or naturally dried;

8. 100 μ L 10 × TE(Tris/EDTA are added) damping fluid, beats gently and makes resolution of precipitate;

9. add the RNaseA of 1 μ L 10mg/mL in 37 DEG C of water-bath 1h, remove RNA;

10. by for subsequent use in-20 DEG C of refrigerator storages for the DNA extraction thing obtained;

(3) detection of SSR molecular marker: the pcr amplification DNA of said extracted being carried out to gene SSR marker;

PCR amplification system is: cumulative volume 20 μ L, comprising: 10 × PCR buffer 2 μ L, 25mmol/L MgCl ₂2 μ L, 10mmol/LdNTP 0.4 μ L, 5U/ μ L Taq DNA enzymatic 0.2 μ L, the template DNA 2 μ L that 10 μm of ol/L SSR marker forward primers and reverse primer cumulative volume each 1.5 μ L, concentration 20ng ~ 30ng/ μ L extract, ddH ₂o 10.4 μ L;

PCR reaction conditions: 94 DEG C of 5min; 94 DEG C of 30second, 55 DEG C of 30second, 72 DEG C of 30second, 30 circulations; 72 DEG C of 5min

(4) electrophoresis detection: the product obtain above-mentioned pcr amplification and 2 μ L sample loading buffers mix, in 95 DEG C of sex change 5min, terminates to be placed in mixture of ice and water to cool 3min, point sample 3 μ L electrophoresis on denaturing polyacrylamide gel, the concentration of volume percent of denaturing polyacrylamide gel is 6%, and electrophoretic buffer is 1 × TBE, voltage 1000v, electric current 200mA, power 200W, electrophoresis 45min, silver dye, colour developing, takes pictures, analytical results.

The concrete technology of silver dye is unload after electrophoresis completes and take sheet glass apart, after offset plate unloads, 5-8 second is washed with deionized water, after draining away the water, lucifuge silver dye 8 minutes in silver-colored dye liquor (1.5 grams of Silver Nitrates and 1500ml water), after silver dye, 5-8 second is washed with deionized water, drain away the water, put into developing solution (16 grams of sodium hydroxide, 1000ml water and 8ml formaldehyde), be readable to rear taking-up washing of developing.

7 pairs of SSR primer pair Xianggu mushroom strains are adopted to carry out pcr amplification, quantity and the relative molecular weight of the allele of each SSR primer amplification can be determined by contrast 50bp DNAladder, find and meet numbering and be combined as: the bacterial classification of (1+2) (1+4) (1+2) 2122, can determine that this bacterial classification is mushroom Min Feng No. 1 bacterial classification, as shown in arrow mark in Fig. 1.For ensureing the accuracy of qualification, suggestion is carried out repeating experiment for three times.

Claims (1)

1. an authentication method for the SSR marker finger printing of mushroom Min Feng No. 1 bacterial classification, its concrete steps are as follows:

(1) mycelium culture: mushroom strain is transferred in potato dextrose medium, lucifuge shake-flask culture at 23 DEG C ~ 25 DEG C, collects mycelia after 3d ~ 4d;

(2) extraction of genomic dna: the genomic dna extracting above-mentioned mycelia by CTAB method, ultraviolet spectrophotometry detects total genomic dna concentration and purity, and the concentration of adjustment sample DNA is consistent;

The genomic dna technique that CTAB method extracts mycelia comprises:

1. by the mushroom mycelium grind into powder of liquid-nitrogen freeze drying, add 2 × CTAB extract of 65 DEG C of preheatings, in 65 DEG C insulation 45 ~ 60min, or jog mixing;

2. 12000rpm, 4 DEG C of centrifugal 20min, get supernatant liquor;

3. in above-mentioned supernatant liquor, add the mixed solution of phenol, chloroform and the primary isoamyl alcohol that volume ratio is 25:24:1, mix 10min gently, 12000rpm, 4 DEG C of centrifugal 10min, get supernatant liquor and move in centrifuge tube;

4. in above-mentioned centrifuge tube, add the chloroform that volume ratio is 24:1 and primary isoamyl alcohol mixed solution, mix 10min gently, 12000rpm, 4 DEG C of centrifugal 10min, get supernatant liquor and move in another centrifuge tube;

5. in above-mentioned centrifuge tube, add the Virahol of-20 DEG C of precoolings of 2/3 volume, shake 5min gently, 8000rpm, 4 DEG C of centrifugal 10min, remove supernatant;

6. the precipitation 75vol% ethanol obtained and 10mmol/L Potassium ethanoate are washed 2 ~ 3 times, each 8000rpm, the centrifugal 5min of room temperature;

7. add the 95vol% ethanol of precooling, turn upside down gently, the centrifugal 10min of 8000rpm room temperature, abandons ethanol, and vacuum is drained or naturally dried;

8. add 100 μ L 10 × TE damping fluids, beat gently and make resolution of precipitate;

9. add the RNaseA of 1 μ L 10mg/mL in 37 DEG C of water-bath 1h, remove RNA;

10. by for subsequent use in-20 DEG C of refrigerator storages for the DNA extraction thing obtained;

(3) detection of SSR molecular marker: the pcr amplification DNA of said extracted being carried out to gene SSR marker;

PCR amplification system is: cumulative volume 20 μ L, comprising: 10 × PCR buffer 2 μ L, 25mmol/L MgCl ₂2 μ L, 10mmol/L dNTP 0.4 μ L, 5U/ μ L Taq DNA enzymatic 0.2 μ L, the template DNA 2 μ L that 10 μm of ol/L SSR marker forward primers and reverse primer cumulative volume each 1.5 μ L, concentration 20ng ~ 30ng/ μ L extract, ddH ₂o 10.4 μ L;

PCR reaction conditions: 94 DEG C of 5min; 94 DEG C of 30 second, 55 DEG C of 30 second, 72 DEG C of 30 second, 30 circulations; 72 DEG C of 5min;

(4) electrophoresis detection: the product obtain above-mentioned pcr amplification and 2 μ L sample loading buffers mix, in 95 DEG C of sex change 5min, terminates to be placed in mixture of ice and water to cool 3min, point sample 3 μ L electrophoresis on denaturing polyacrylamide gel, the concentration of volume percent of denaturing polyacrylamide gel is 6%, and electrophoretic buffer is 1 × TBE, voltage 1000v, electric current 200mA, power 200W, electrophoresis 45min, silver dye, colour developing, takes pictures, analytical results;

The concrete technology of silver dye is unload after electrophoresis completes and take sheet glass apart, after offset plate unloads, 5-8 second is washed with deionized water, after draining away the water, lucifuge silver dye 8 minutes in silver-colored dye liquor, after silver dye, 5-8 second is washed with deionized water, drain away the water, put into developing solution, be readable to rear taking-up washing of developing;

7 pairs of SSR primer pair Xianggu mushroom strains are adopted to carry out pcr amplification, quantity and the relative molecular weight of the allele of each SSR primer amplification can be determined by contrast 50bp DNA ladder, find and meet numbering and be combined as: the bacterial classification of (1+2) (1+4) (1+2) 2122, can determine that this bacterial classification is mushroom Min Feng No. 1 bacterial classification; Wherein, 7 pairs of SSR primer sequences are as follows:

The positive/negative of Le_fp0001 is respectively to primer:

ACGCGTATCCTCCCCTAAGT/AAGCGATATGGATTTGACGC；

The positive/negative of Le_fp0002 is respectively to primer:

GGGCGAAACAATTTCAGGTA/ATGCCATCGTAAGGAACTCG；

The positive/negative of Le_fp0003 is respectively to primer:

ATTGTGACTCGACCACCTCC/TCATAATGCATCCCGTGAGA；

The positive/negative of Le_fp0004 is respectively to primer:

CCCAAAAAGGATTTCAGCAA/AACCGGAGTGGTGTAAGTGC；

The positive/negative of Le_fp0005 is respectively to primer:

CATCAACCAAACCAAGATTCAA/TTCCAATTTCCTCCGAGTCA；

The positive/negative of Le_fp0006 is respectively to primer:

CATGGGAGAGATTCGGAAAA/CGAGACCGACGACTTTGACT；

The positive/negative of Le_fp0007 is respectively to primer:

CATTGCTCGGATCCTTCATT/TACCTCGTGCGGACTTTGAT。