CN102851295B

CN102851295B - Toll-like receptor regulatory oligonucleotide and application thereof

Info

Publication number: CN102851295B
Application number: CN201210275214.0A
Authority: CN
Inventors: 王丽颖; 胡大利; 于永利
Original assignee: Changchun Huapu Biotechnology Co Ltd
Current assignee: Huapu Biotechnology Hebei Co ltd
Priority date: 2006-08-28
Filing date: 2007-02-07
Publication date: 2015-01-07
Anticipated expiration: 2027-02-07
Also published as: CN101240271B; CN102851295A; CN101240271A

Abstract

The invention relates to a Toll-like receptor regulatory oligonucleotide and a functional analog thereof, and application of the oligonucleotide and the functional analog thereof in prevention and treatment of immune-mediated diseases. The oligonucleotide provided by the invention contains a CT repeated sequence [(CT)n] or a CCT repeated sequence [(CCT)n] or a TC repeated sequence [(TC)n], or is an oligonucleotide which is rich in CT or CCT or TC. The immune-mediated diseases include autoimmune diseases, graft rejection, hypersensitivity, diseases caused by microbial over-strong stimulation on the immune system of a host and TOLL-like receptor activation-related diseases.

Description

Toll sample receptor adjustment oligonucleotide and uses thereof

Invention field:

The invention provides containing CT tumor-necrosis factor glycoproteins [(CT) n] or CCT tumor-necrosis factor glycoproteins [(CCT) n] or TC tumor-necrosis factor glycoproteins [(TC) n], or be rich in Toll-like receptor adjustment oligonucleotide and the functional homologue thereof of CT or CCT or TC, and apply this oligonucleotide and the purposes of functional homologue in the disease immune-mediated for prevention and therapy thereof.Immune-mediated disease comprises autoimmune disorder, transplant rejection, allergy, microorganism cross disease that strong stimulation host immune system causes and Toll-like receptor (TLR) activates diseases related.

Background of invention:

Immunity system can protect body from the infection of bacterium, parasite, fungi, virus, and can remove tumour cell.In some cases, the immune response of immune system mounts is harmful, can cause immune-mediated disease.These immune-mediated diseases include but not limited to: autoimmune disorder, transplant rejection, allergy, microorganism cross disease that strong stimulation host immune system causes and toll-like receptor activates diseases related.Autoimmune disorder is by caused by acquired (specificity) immune response of endogenous antigen and innate immune reaction.Derive from bacterium, parasite, fungi, virus allogenic material can simulate oneself protein, there is the immune response for own cells and tissue in stimulating immune system, thus causes autoimmune disorder.Transplant rejection is transplant recipient (host) to the immune response of transplant organ or tissue.A receptor accepting homotransplant (as: kidney, pancreas, heart, lung, marrow, cornea and skin), can produce the immunne response for graft.Allergy is insalubrious excessively strong immunne response, can cause the cell disorganization even death of body.After some infected by microbes bodies, strong immune response can be produced by stimulating immune system, the disease causing microorganism to cross strong stimulation host immune system to cause, as under avian influenza virus H 5 N 1 or sars coronavirus infection conditions, the lethal factor of the infected may be become for the strong immune response of mistake infecting virus.This immunoreactive feature creates a large amount of cytokines at infected individuality.This phenomenon is called as excess cytokine mass formed by blood stasis (hypercytokinemia) or cytokine storm.It is the disease caused owing to activating Toll-like receptor (Toll like receptors) that toll-like receptor activates diseases related.Toll-like receptor is a receptor family identifying microbe-derived molecular structure (pathogenic agent associated molecule model).Express the immunocyte of Toll-like receptor by being activated in conjunction with this pathogenic agent associated molecule model.The mankind, Toll-like receptor family has 11 members.Toll-like receptor can identify the product that a lot of pathogenic micro-organism is originated.TLR4 can identify bacteria lipopolysaccharide (LPS); The binary of TLR2 and TLR6 can identify lipoteichoicacid and two acyl lipopeptid; The binary of TLR2 and TLR1 can identify trigalloyl lipopeptid; That TLR9 can identify synthesis or derive from bacterium and virus containing CpG ODN; TLR5 can identify bacterial flagellin; The binary of TLR2 and TLR6 can also identify zymosan; TLR4 can identification of breathing road syncystial virus F protein; TLR3 can identify Poly I:C, synthesis or derive from virus double-stranded RNA; TLR7 and TLR8 can identify strand viral RNA; TLR4 can identify protozoan products, as GPI anchorin; TLR4 can also identify the product of inflammatory tissue, as HSP60 and the former fragment of fiber (Foo Y. Liew, et al.Negative regulation of toll like receptor mediated immune responses Nature Reviews Immunology.Vol5, June 2005,446-458).Two kinds of immunoregulation druge R-837 and R-848 are the parts of TLR7 and TLR8.In recent years research shows, activation and septicemia, DCM (dilated cardiomyopathy), diabetes systemic lupus erythematous, experimental autoimmune encephalo myelitis, atherosclerosis, asthma, chronic obstructive lung disease (the Foo Y.Liew relevant to the generation of organ failure of TLRs, et al.Negative regulation of toll like receptor mediated immune responses.Nature Review Immunology, Vol5,2005,446-458).

In sum, in order to prevent or treat immune-mediated disease, be necessary that development can suppress the immunoreactive preparation of nocuity.The present invention's invention provides containing CT tumor-necrosis factor glycoproteins [(CT) n] or CCT tumor-necrosis factor glycoproteins [(CCT) n] or TC tumor-necrosis factor glycoproteins [(TC) n], or be rich in oligonucleotide and the functional homologue thereof of CT or CCT or TC, and apply the purposes of this oligonucleotide in the disease that prevention and therapy is immune-mediated.Oligonucleotide provided by the invention can suppress the immune response by TLR9 agonist agonizes.Investigator has been had to confirm, TLR9 agonist can activate innate immune reaction and the acquired immune response (Arthur M.Krieg.Therapeutic potential of Toll-like receptor 9 activation.Nature Reviews Drug Discovery, Vol5.June 2006,471-484).In the immunity system of the mankind, B cell and plasmacytoid dendritic cells (pDCs) express TLR9.Oligonucleotide (CpG ODN) containing CpG is the agonist (D.M.Klinman of TLR9, Immunotherapeutic uses of CpG oligodeoxynucleotides, 428 Nat.Rev., Immunol.4 (2004) 249-258).According to functional performance, oligonucleotide containing CpG is divided into 3 type (Tomoki Ito, et al.Specialization, kinetics, and repertoire of type 1 interferon responses by human plasmacytoid predendritic cells.Blood, 15 March 2006, Vol107, Num 6:2423-2431).A type can activate people's plasmacytoid dendritic cells containing CpG ODN and produce a large amount of I type Interferon, rabbit (IFN-a/ β), activates NK cell consumingly.Type B, containing CpG ODN primary activation B cell, stimulates B cell increment and antibody-secreting.C type has A type and the Type B function containing CpG ODN containing the oligonucleotide of CpG simultaneously.CpG2216 (5 ' gggggacgatcgtcgggggg3 ') (Dominique De Wit, et al.Blood plasmacytoid dendritic cell responses to CpG oligonucleotides are impaired in human newborns.Blood, 1 Feb, 2004, Vol 103, Num 3:1030-103), CpG2006 (5 '-tcgtcgttttgtcgttttgtcgtt-3 ') (Dominique De Wit, et al.Blood plasmacytoid dendritic cell responses to CpG oligodeoxynucleotides are impaired in human newborns.Blood, 1 Feb, 2004, Vol 103, Num 3:1030-103) and and CpG C274 (5 '-tcgtcgaacgttcgagatgat3 ') (Omar Duramad, et al.Inhibitors of TLR-9 Act on Multiple Cell Subsets in Mouse and Man In Vitro and Prevent Death In Vivo from Systemic Inflammation.The Journal of Immunology, 2005, 174:5193-5200) be typical A type respectively, the oligonucleotide containing CpG of Type B and C type.CpG 302 (5`-tcg tcg ggt gcg acg tcg cag ggg gg-3`) is also that a kind of oligonucleotide (Musheng Bao, et al.Clinical Immunology.2006.118:180-187) .TLR9 agonist such as CpG 2216, CpG 2006, CpG C274 or CpG 302 containing CpG of C type can be activated TLR9 by endocytosis to intercellular substance.In plasmacytoid dendritic cells, TLR9 activates can open beginning one innate immune reaction fast, it is characterized in that secreting a large amount of proinflammatory factors as IL-6, tumor necrosis factor-alpha (TNF α), I type Interferon, rabbit (IFN-a/ β) and interferon-induced chemokine.By Interferon, rabbit rely on and Interferon, rabbit non-dependent two paths, this plasmacytoid dendritic cells can secondary activation innate immune cells as NK cell, monocyte and neutrophilic granulocyte.By the stimulation of TLR9, B cell enhances the susceptibility to antigenic stimulation, effectively can be divided into antibody secreting cell.Therefore, the stimulation of TLR9 contributes to Acquired immune response, particularly humoral immunoresponse(HI).The plasmacytoid dendritic cells activated by TLR9 can secrete IFN α, and this IFN α can make plasmacytoid dendritic cells move and gather lymphoglandula and other peripheral lymphoid tissues.At these positions, this plasmacytoid dendritic cells can activate unsensitized T cell and memory T cell, intersects and offers soluble antigen, promote CD4 and the CD8 t cell responses of TH1 type to CD8+ cytotoxic T cell.More than analyze and clearly show, the preparation of antagonism CpG 2006, CpG C274, CpG 2216 or CpG 302 activity can carry out prevention and therapy immunologic derangement disease by suppressing the natural immunity and acquired immunity.Because, CpG2006, CpGC274, CpG 2216 or CpG 302 is the activator of Toll-like receptor (TLR), and the oligonucleotide that energy antagonism CpG2006 or CpG C274 or CpG2216 or CpG 302 provided by the invention activates TLR function is called as Toll-like receptor adjustment oligonucleotide.

Summary of the invention:

1, the invention provides containing CT tumor-necrosis factor glycoproteins [(CT) n] or CCT tumor-necrosis factor glycoproteins [(CCT) n] or TC tumor-necrosis factor glycoproteins [(TC) n]; or be rich in the Toll-like receptor adjustment oligonucleotide of CT or CCT or TC; this oligonucleotide can be modified by sulphation; this modification includes but not limited to that phosphate backbones is modified, as partly or wholly phosphorothioate or phosphorodithioate are modified.Through chemically modified is the functional homologue of corresponding oligonucleotide by oligonucleotide provided by the invention.

2, the invention provides this oligonucleotide of application or its functional homologue in prevention or the purposes for the treatment of in immune-mediated disease.The individuality for the treatment of includes but not limited to the mankind.Immune-mediated disease comprises autoimmune disorder, transplant rejection, allergy, microorganism cross disease that strong stimulation host immune system causes and toll-like receptor activates diseases related.

3, the invention provides application this oligonucleotide or its functional homologue reacted by Immunosuppression and then prevent or treat the using method of immune-mediated disease.

4, when applying oligonucleotide provided by the invention or the immune-mediated disease of its functional homologue prevention and therapy, can by application after this oligonucleotide or the carrying of its functional homologue Drug carrier.Oligonucleotide provided by the invention or its functional homologue can through enteron aisle, non-bowel (as subcutaneous injection, intramuscular injection and intravenous injection etc.), local and the application of respiratory tract approach.

5, oligonucleotide provided by the invention or its functional homologue can form various pharmaceutical composition or formulation as main component.These pharmaceutical compositions of this class oligonucleotide or its functional homologue of comprising dose therapeutically effective can be used to prevention or treat immune-mediated disease.

6, when the disease that prevention and therapy is immune-mediated, the oligonucleotide of dose therapeutically effective provided by the invention or its functional homologue can be applied separately or grouped by itself is applied or and other one or more active compound combined application.

7, when the disease that prevention and therapy is immune-mediated, this class oligonucleotide of dose therapeutically effective provided by the invention or its functional homologue can carry application by delivery vector.

8, when the disease that prevention and therapy is immune-mediated, this class oligonucleotide of dose therapeutically effective provided by the invention or its functional homologue can be used to the immunocyte processing self, then this cell are done the application of autologous feedback.

Accompanying drawing illustrates:

Fig. 1 describe human peripheral blood single nucleus cell CpG2006 and CpG274 stimulate under breed time, oligonucleotide SAT05 show restraining effect.

Under the condition that there is various dosage SAT05, A151 and control oligonucleotide, application CpG 2006 (1 μ g/ml) or CpG C274 (1 μ g/ml) stimulation human peripheral blood mononuclearcell 48 hours, afterwards and [ ³h] thymus pyrimidine hatches 16 hours altogether.The degree of cell proliferation represents with cpm ± SD.Experimental result shows, compares with control oligonucleotide, and SAT05 can suppress the human peripheral blood single nucleus cell stimulated by CpG 2006 or CpG C274 to be bred.This experiment repeats 4 times and all obtains similar result.

Here is the oligonucleotide sequence of application in some experiments:

CpG 2006(5’-tcg tcg ttt tgt cgt tttg tcg tt-3’)

CpG C274(5’-tcgtcgaacgttcgagatgat 3’)

SAT05 (5 '-ctctctctctctctctctct-3 '), is also named as SEQ ID NO:1

A151(5′-ttagggttagggttagggttaggg-3’)

Control ODN (control oligonucleotide): (5 '-gttagagattaggca-3 ')

Fig. 2 describe human peripheral blood single nucleus cell CpG2006 and CpG274 stimulate under breed time, oligonucleotide SAT05f show restraining effect.

Under the condition that there is various dosage SAT05f, A151 and control oligonucleotide, application CpG 2006 (1 μ g/ml) or CpG C274 (1 μ g/ml) stimulation human peripheral blood mononuclearcell 48 hours, afterwards and [ ³h] thymus pyrimidine hatches 16 hours altogether.The degree of cell proliferation represents with cpm ± SD.Experimental result shows, compares with control oligonucleotide, and SAT05f can suppress to be bred by the human peripheral blood single nucleus cell under CpG 2006 or CpG C274 stimulation.This experiment repeats 4 times and all obtains similar result.

Here is the oligonucleotide sequence of application in some experiments:

CpG2006(5’-tcg tcg ttt tgt cgt tttg tcg tt-3’)

CpG C274(5’-tcgtcgaacgttcgagatgat 3’)

SAT05f (5 '-cctcctcctcctcctcctcctcct-3 '), be named as SEQ ID NO:2

A151(5′-ttagggttagggttagggttaggg-3’)

Control ODN (control oligonucleotide): (5 '-gttagagattaggca-3 ')

Fig. 3 depicts the generation that SAT05 effectively can suppress human peripheral blood single nucleus cell antiviral substance under CpG 2216 stimulates.

Under the condition that there is various dosage SAT05, A151 and control oligonucleotide, obtain culture supernatant with CpG2216 stimulation human peripheral blood mononuclearcell, observe the effect that this supernatant protection Vero E6 resists 10 × TICD50 VSV virus attack.Various symbologies in figure OD value ± SD.Result shows, SAT05 can suppress the generation of human peripheral blood single nucleus cell antiviral substance under CpG 2216 stimulates.

Here is the oligonucleotide sequence of application in experiment:

CpG2216(5’-gggggacgatcgtcgggggg-3’)

SAT05 (5 '-ctctctctctctctctctct-3 '), is named as SEQ ID NO:1

A151(5′-ttagggttagggttagggttaggg-3’)

Control ODN (control oligonucleotide): (5 '-gttagagattaggca-3 ')

Fig. 4 depicts the generation that SAT05f effectively can suppress human peripheral blood single nucleus cell antiviral substance under CpG 274 stimulates.

Under the condition that there is various dosage SAT05f, A151 and control oligonucleotide, obtain culture supernatant with CpG274 stimulation human peripheral blood mononuclearcell, observe the effect that this supernatant protection Vero E6 resists 10 × TICD50VSV virus attack.Various symbologies in figure OD value ± SD.Result shows, SAT05f can strongly inhibited generation of human peripheral blood single nucleus cell antiviral substance under CpG 274 stimulates.

Here is the oligonucleotide sequence of application in some experiments:

CpG C274(5’-tcgtcgaacgttcgagatgat-3’)

SAT05f (5 '-cctcctcctcctcctcctcctcct-3 '), be named as SEQ ID NO:2

A151(5′-ttagggttagggttagggttaggg-3’)

Control ODN：(5′-gttagagattaggca-3‘)

Fig. 5 describe human peripheral blood single nucleus cell CpG274 stimulate under breed time, be rich in the restraining effect that CT sequence or CT tumor-necrosis factor glycoproteins or CCT tumor-necrosis factor glycoproteins oligonucleotide are bred it.

Under the condition that there is various oligonucleotide (30 μ g/ml), application CpG C274 (5 μ g/ml) stimulation human peripheral blood mononuclearcell 48 hours, afterwards and [ ³h] thymus pyrimidine hatches 16 hours altogether.The degree of cell proliferation represents with cpm ± SD.The human peripheral blood single nucleus cell group that " cell " representative stimulates without CpG274." PBS " representative is application CpG C274 (5 μ g/ml) stimulation human peripheral blood mononuclearcell group separately.This experiment repeats 4 times, all obtains similar result.

Here is the oligonucleotide sequence of application in this experiment:

CT151h(5′-ctctctttagggttagggctctct-3’)，SEQ ID NO：3；

CT151g(5′-ttagggctctctctctctttaggg-3’)，SEQ ID NO：4；

CT151f(5′-ctctctttagggttagggttaggg-3′)，SEQ ID NO：5；

CT151e(5′-ttagggttagggttagggctctct-3′)，SEQ ID NO：6；

CT151d(5′-ctctctctctctttagggttaggg-3′)，SEQ ID NO：7；

CT151c(5′-ttagggttagggctctctctctct-3’)，SEQ ID NO：8；

CT151b(5′-ctctctttagggctctctttaggg-3’)，SEQ ID NO：9；

CT151a(5′-ttagggctctctttagggctctct-3’)，SEQ ID NO：10；

1612A4 (5 '-gttagagattaggca-3 '), contrast CpG;

SAT05f(5′-cctcctcctcctcctcctcctcct-3’)，SEQ ID NO：2；

SAT05e(5′-cttcttcttcttcttcttcttctt-3’)，SEQ ID NO：11；

SAT05d(5′-ctctctctctctctctctctctctct-3’)，SEQ ID NO：12；

SAT05c(5′-ctctctctctctctctct-3’)，SEQ ID NO：13；

SAT05b(5′-ctctctctctct-3’)，SEQ ID NO：14；

SAT05a(5′-ctctct-3’)，SEQ ID NO：15；

SAT05(5′-ctctctctctctctctctct-3’)，SEQ ID NO：1；

A151(5′-ttagggttagggttagggttaggg-3’)。

Fig. 6 describes human peripheral blood single nucleus cell when breeding under CpG 2006 or CpG C274 or CpG 684 stimulate, and is rich in the restraining effect that TC sequence MS08 oligonucleotide is bred it.

Exist MS08 (5 '-TCTCTCTCTCTCTCTCTCTCTCTC-3 ', see SEQ ID NO:16) and control oligonucleotide MS19 (5 '-AAAGAAAGAAAGAAAGAAAGAAAG-3 ') condition under, application CpG 2006 or CpGC274 or CpG 684 stimulation human peripheral blood mononuclearcell 48 hours, afterwards and [3H] thymus pyrimidine hatch 16 hours altogether.The degree of cell proliferation represents with cpm ± SD.Experimental result shows, compares with control oligonucleotide, and MS08 can suppress the human peripheral blood single nucleus cell propagation stimulated by CpG 2006 or CpG C274 or CpG 684.

Fig. 7 depicts the generation that MS08 effectively can suppress human peripheral blood single nucleus cell antiviral substance under CpG 2216 or CpG C274 or CpG 302 stimulates.

Exist MS08 (5 '-TCTCTCTCTCTCTCTCTCTCTCTC-3 '; SEQ ID NO:16) and control oligonucleotide MS19 (5 '-AAAGAAAGAAAGAAAGAAAGAAAG-3 ') condition under; obtain culture supernatant with CpG 2216 or CpG C274 or CpG 302 (5`-tcg tcg ggt gcg acg tcg cag ggg gg-3`) stimulation human peripheral blood mononuclearcell, observe the effect that this supernatant protection Vero E6 resists 10 × TICD50VSV virus attack.Various symbologies in figure OD value ± SD.Result shows, MS08 can suppress the generation of human peripheral blood single nucleus cell antiviral substance under CpG 2216 or CpG C274 or CpG 302 stimulates.

Detailed description of the present invention

Unless lay special stress on, the term in the present invention have can the ordinary meaning understood by technician in field belonging to the present invention.If there is the conflict in implication, the explanation of this detailed description should be deferred to, define or illustrate.

" oligonucleotide ": oligonucleotide is polynucleotide, by sugar (as ribodesose), the molecule of phosphate group and based composition, wherein glycan molecule and base connect into nucleosides (nucleoside), nucleosides is connected to form Nucleotide (nucleotide) by phosphate group, the base forming nucleosides has pyrimidine and purine, pyrimidine has thymus pyrimidine (thymine, be abbreviated as T or t) and cytosine(Cyt) (cytosine, be abbreviated as C or c), purine have VITAMIN B4 (adenine, be abbreviated as A or a) and guanine (guanine is abbreviated as G or g).In the present invention, oligonucleotide refers to oligodeoxynucleotide.Oligonucleotide provided by the invention is also referred to as Toll-like receptor adjustment oligonucleotide.Oligonucleotide by synthetic, also can obtain from cell, bacterium and virus.Oligonucleotide in the present invention is synthesized by automatic nucleic acid synthesizer device, and therefore these oligonucleotide are oligonucleotide of synthetic.This invents the oligonucleotide that provides is containing CT tumor-necrosis factor glycoproteins [(CT) n] or CCT tumor-necrosis factor glycoproteins [(CCT) n] or TC tumor-necrosis factor glycoproteins [(TC) n], or the oligonucleotide being rich in CT or CCT or TC is few, C is wherein cytosine(Cyt) or derivatives thereof, T is thymus pyrimidine or derivatives thereof, n is the integer of 2-50, what represent is the number of repeating unit, in [(CT) n] oligonucleotide, CT is a repeating unit, in [(CCT) n] oligonucleotide, CCT is a repeating unit, in [(TC) n] oligonucleotide, TC is a repeating unit.Oligonucleotide provided by the invention includes but not limited to that sequence is the oligonucleotide (SEQ ID NO:1) of 5 '-ctctctctctctctctctct-3 ', sequence is 5 '-cctcctcctcctcctcctcctcct-3 ' oligonucleotide (SEQ ID NO:2) and sequence are the oligonucleotide (SEQ ID NO:16) of 5 '-TCTCTCTCTCTCTCTCTCTCTCTC-3 '.5 '-ctctctctctctctctctct-3 ' is the oligonucleotide containing CT tumor-necrosis factor glycoproteins [(CT) n], and CT is a repeating unit here, n=10.5 '-cctcctcctcctcctcctcctcct-3 ' is the oligonucleotide containing CCT tumor-necrosis factor glycoproteins [(CCT) n], and CCT is a repeating unit here, n=8.5 '-TCTCTCTCTCTCTCTCTCTCTCTC-3 ', be the oligonucleotide containing TC tumor-necrosis factor glycoproteins [(TC) n], TC is a repeating unit here, n=12.

Oligonucleotide provided by the invention comprises and meets (XsubaCTYsubb) _nor (XsubaTCYsubb) _nthe oligonucleotide of formula sequence.C in formula is cytosine(Cyt) or derivatives thereof, and T is thymus pyrimidine or derivatives thereof, and n is the integer of 2-50, expression be the number of repeating unit.Xsub. or Ysub. represent one of A, T, C, G 4 kinds of bases, a or b represents the number of Xsub or Ysub, and scope is the integer from 0 to 1.Such as, in oligonucleotide of the present invention, 5 '-ctctctctctctctctctct-3 ' (SEQ ID NO:1) coincidence formula (XsubaCTYsubb) _ncondition be: a=0, b=0, n=10; The condition of 5 '-cctcctcctcctcctcctcctcct-3 ' (SEQ ID NO:2) coincidence formula (XsubaCTYsubb) n is a=1, b=0, Xsub is C, n=8.5 '-cttcttcttcttcttcttcttctt-3 ' (SEQ ID NO:11) coincidence formula (XsubaCTYsubb) _ncondition be a=0, b=1, Ysub be T, n=8.The condition of 5 '-TCTCTCTCTCTCTCTCTCTCTCTC-3 ' (SEQ ID NO:16) coincidence formula (XsubaTCYsubb) n is a=0, b=0, n=12.

Oligonucleotide provided by the invention can comprise the oligonucleotide of the structure meeting (XsubaCTYsubb) or (XsubaTCYsubb) formula containing more than 3, this oligonucleotide is known as the oligonucleotide being rich in CT or TC, as SEQ ID NO:1 (5 '-ctctctctctctctctctct-3 ') includes 10 CT; SEQ ID NO:2:(5 '-cctcctcctcctcctcctcctcct-3 ') include 8 CT; SEQ ID NO:3:(5 '-ctctctttagggttagggctctct-3 ') includes 6 CT; SEQ ID NO:4:(5 '-ttagggctctctctctctttaggg-3 ') includes 6 CT; SEQ ID NO:5:(5 '-ctctctttagggttagggttaggg-3 ') include 5 CT; SEQ ID NO:6:(5 '-ttagggttagggttagggctctct-3 ') include 3 CT; SEQ ID NO:7:(5 '-ctctctctctctttaggtgttaggg-3 ') include 6 CT; SEQ ID NO:8:(5 '-ttagggttagggctctctctctct-3 ') includes 6 CT; SEQ ID NO:9:(5 '-ctctctttagggctctctttaggg-3 ') includes 6 CT; SEQ ID NO:10:(5 '-ttagggctctctttagggctctct-3 ') includes 6 CT." be rich in the oligonucleotide of CT or TC " and also refer to " oligonucleotide containing (XsubaCTYsubb) or (XsubaTCYsubb) " simultaneously.

" chemically modified ": compared with natural DNA, the oligonucleotide in the present invention can have various chemically modified, and the position of modification can occur in the phosphodiester bond between nucleosides, and ribose units is or/and organic base (A, T, C, G).Can modify between the synthesis phase of oligonucleotide or after synthesis.Chemically modified between synthesis phase can be modified in the inside of oligonucleotide or 5` end.Oligonucleotide after synthesis can be, but not limited to carry out chemically modified at active group (phosphoric acid or hydroxyl as 5` or 3` end).Professional can know the concrete mode of these chemically modifieds.Oligonucleotide in the present invention can have one or more chemically modified.Compare with the oligonucleotide of the natural form of identical sequence, the chemically modified of the oligonucleotide in the present invention can be positioned at the phosphodiester bond of local or/and the ribose units of local is or/and the nucleoside base of local.Chemically modified in the present invention comprises the backbone modification of oligonucleotide.Here, the backbone modification of oligonucleotide includes but not limited to that phosphate backbones is modified.It can be that the non-bridge phosphate oxygen forms wherein at least one internucleotide linkage is replaced by sulphur atom in one of nucleic acid molecule stable phosphate backbones that phosphate backbones is modified.In oligonucleotide in the present invention, the non-bridge phosphate oxygen forms in internucleotide linkage can partly or entirely be replaced by sulphur atom.Also non-ionic DNA analogs can be there is in the skeleton of the oligonucleotide in the present invention, as alkyl, fragrance-phosphonate (charged phosphonate Sauerstoffatom is replaced by alkyl, aromatic base) are modified, the Sauerstoffatom part for another example in phosphodiester and alkyl phosphotriester is partially alkylated or alkylated modification.Oligonucleotide of the present invention can be the mosaic of phosphorothioate and phosphodiester.In oligonucleotide of the present invention, chemically modified also comprises base and substitutes, as C-5 propine pyrimidine and 7-deaza-7 substitute purine.The purine substituted and pyrimidine include but not limited to: VITAMIN B4, guanine, cytosine(Cyt), thymus pyrimidine, other naturally and the base that occurs of non-natural.In oligonucleotide of the present invention, chemically modified also comprises base modification.The base of modifying chemically is being different from the base in typical nature (as A, T, C, G.), but there is their basic chemical structures.Oligonucleotide in the present invention can also with cytosine derivative or thymidine Derivatives Modified.Here cytosine derivative refers to cytosine(Cyt) sample nucleosides (except cytosine(Cyt)).Thymidine derivative refers to the phonetic sample nucleosides (not comprising thymus pyrimidine) of thymus gland.In addition, the modification of the oligonucleotide in the present invention can be two or end connection connection dibasic alcohol at oligonucleotide, as TEG or six ethylene glycol.Oligonucleotide in the present invention can produce the functional homologue of corresponding oligonucleotide through chemically modified.

" immune-mediated disease ": immune-mediated disease is the disease caused by the immune response be harmful to, comprises autoimmune disorder, transplant rejection, allergy, microorganism crosses disease that strong stimulation host immune system causes and toll-like receptor activates diseases related.In the present invention, oligonucleotide can be used for the immune-mediated disease of prevention and therapy.

" immune response ": immunne response and immune response have similar meaning.Immune response is that immunocyte such as B cell, T cell, NK cell, dendritic cell and scavenger cell etc. stimulate to antigen or other reaction made.Immunne response comprises innate immunity and acquired (specificity) immunne response.Acquired immune response draws together cellullar immunologic response and humoral immunoresponse(HI).

" prevent or treat immune-mediated disease ": prevention here refers to the immune-mediated disease preventing individual upper generation serious; Here treatment refers to takes therapeutic measures to individuality, is used for alleviating the symptom of immune-mediated disease, stops the progress of immune-mediated disease or eliminates the pathological conditions of immune-mediated disease.

" individuality ": individuality refers to the human individual and non-human vertebrate's individuality that apply oligonucleotide of the present invention.Non-human vertebrate comprises non-human primate, farming animals and pet animals.Oligonucleotide provided by the invention can prevent or treat immune-mediated disease after being applied to individuality.

" autoimmune disorder ": autoimmune disorder refers to the disease caused because autoimmune tolerance is broken.The destruction of autologous tissue and cell can be caused for the innate immunity of autoantigen and Acquired immune response.The characteristics determined of autoimmune disorder organ, cell, tissue and organ involved by it.Autoimmune disorder also refers to " collagen ", " collagen-blood vessel ", " reticular tissue " disease.The invention mechanism of autoimmune disorder is relevant with allergy.Oligonucleotide of the present invention can be used for preventing or treatment autoimmune disorder.These autoimmune disorders include but not limited to systemic lupus erythematous, insulin-dependent diabetes mellitus, inflammatory arthritis, rheumatoid arthritis, multiple sclerosis, autoimmune hepatitis, chronic progressive hepatitis, autoimmune hemolytic anemia, AT, autoimmune atrophic gastritis, autoimmunity pernicious anemia, Autoimmune Encephalomyelitis, autoimmunity orchitis, acquired Hemophilia, ankylosing spondylitis, chronic inflammation demyelinating polyneuropathy, scarring pemphigoid, anti-phospholipid syndrome, myocardosis, cold agglutinin disease, cold agglutinin disease, discoid lupus, sympathetic ophthalmia, essential mixed cryoglobulinemia, IgA nephropathy, juvenile arthritis, Systemic sclerosis, tubercle polyarteritis, polychondritis, dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, high immunoglobulinlg E disease, progressivity systemic sclerosis, psoriasis, dish Te Er syndrome, sarcoidosis, stiff man syndrome, uveitis, vasculitis, vitiligo, this (family name) thyroiditis of bridge, Goopasture is sick, pernicious anemia, addison's disease, Si Yegelun (family name) syndrome, myasthenia gravis, Grave is sick, allergic encephalitis, glomerulonephritis etc. (N Engl J Med, Vol.345, No.5, August 2,2001, p340-350).Go out the stimulation of DNA or RNA at the Microbiological release including DNA or RNA under, the specific autoantibody for including self DNA or RNA mixture can being produced, causing autoimmune disorder as the generation of systemic lupus erythematous.

" allergy ": allergy refer to due to cause for the cellular immunization of interior exogenous antigen or humoral immunoresponse(HI) disease, be divided into four types.I type allergy (allergy also claiming anaphylaxis type, atopic IgE to mediate or transformation reactions) usually results from the basophil of IgE sensitization and contacts release of pharmacologically active substance after specific exogenous antigen with mastocyte, as histamine, anaphylactoid slow reacting substance (SRS-A) and chemotactic factor for eosinophils etc.The allergy of I type includes but not limited to extrinsic asthma, pollinosis and systemic anaphylaxis.The antigen of the condition that II type allergy (also claiming cell toxicant type, cytolytic, complement dependant or cell stimulatory allergy) the occurs cell or tissue of self that has been antibody recognition, or identify and with the antigen of cell or tissue coupling or haptens.The allergy of II type includes but not limited to autoimmune hemolytic anemia, granulocytopenia, EBF, glomerulonephritis spitting of blood syndrome.Type III allergy (also claiming toxic-complex, soluble complex or immune complex type allergy) the soluble antigen antibody complex resulted from circulation is deposited in the inflammatory reaction excited in blood vessel or tissue.Type III allergy includes but not limited to Arthurs reaction, serum sickness, systemic lupus erythematous and glomerulonephritis.IV allergy (being also called cell, cell-mediated, tardy or tuberculin type allergy) contacts specific antigens by the T cell of sensitization and causes.IV allergy includes but not limited to (the Richard A.Goldsby such as contact dermatitis and allograft rejection, Thomas J.Kindt, Barbara A.Osborne.Janis Kuby.Immunology, Fifth Edition, 2003, W.H.FREEMAN AND COMPANY).

" microorganism crosses the disease that strong stimulation host immune system causes ": if microorganism invasion is very serious, can cause systemic inflammatory reaction at body one by one sometimes, the disease causing microorganism to cross strong stimulation host immune system causing.High-caliber following material can be there is: TNF-α, IL-1, IL-6, IL-12, IFN-α, IFN-β, IFN-γ chemokines interferon inducible protein 10, MCP 1, IL-8, IL-1-β in blood as the individuality of influenza virus infection A (H5N1) or SARS virus.This Blood Cytokines level caused due to infected by microbes significantly raises, and is called as cytokine mass formed by blood stasis or cytokine storm.Research shows, infects the patient of avian influenza virus or SARS virus, except needs antiviral drug, also needs the medicine that Immunosuppression reacts.Microorganism crosses the disease that strong stimulation host immune system causes can show as sepsis syndrome (sepsis), adult respiratory distress syndrome (ARDS) and multiple organ failure (The Writing Committee of the World Health Organization (WHO) Consultation on Human Influenza A/H5.Avian Influenza A (H5N1) Infection in Humans.N Engl J Med 2005; 353:1374-85).Oligonucleotide in the present invention just can be used for prevention and therapy microorganism and cross the disease that strong stimulation host immune system causes.The microorganism of this kind of disease is caused to comprise virus, bacterium, parasite and fungi and spongiform encephalopathy is caused a disease former.The virus causing microorganism to cross the disease that strong stimulation host immune system causes comprises: SARS virus, influenza virus, avian influenza virus, HTV-1, poliovirus, hepatitis A virus, enterovirus, human coxsackievirus, Rhinovirus, Echo virus, equine encephalitis virus, rubella virus, dengue fever virus, encephalitis, yellow fever virus, coronavirus, stomatitis herpesvirus, rabies virus, Ebola virus, parainfluenza virus, mumps virus, Measles virus, respiratory syncytial virus, Hantaan virus, bunga virus, Phlebovirus, Nairo virus, hemorrhagic fever virus, reovirus, orbiviurses, rotavirus, hepatitis B virus, parvovirus group, papilloma virus, polyomavirus, adenovirus, I herpes simplex virus type, II herpes simplex virus type, varicella zoster virus, cytomegalovirus, simplexvirus, alastrim virus, vaccinia virus, poxvirus, african swine fever virus, spongiform encephalopathy is caused a disease former, hepatitis D virus, hepatitis C virus, foot and mouth disease virus.The bacterium causing microorganism to cross the disease that strong stimulation host immune system causes comprises: Hp, Borelia burgdorferi, legionella pneumophilia, mycobacterium, streptococcus aureus, gonorrhea diplococcus, meningococcus, monocytosis Lee department is (family name) bacterium too, group A streptococcus, B group B streptococcus B belongs to, streptococcus, streptococcus faecium, streptococcus bovis, streptococcus (suis of anaerobism), streptococcus pneumoniae, pathogenic Carnpylobacter suis, enterococcus bacteria, influenza (bloodthirsty) bacillus, antracis bacillus, diphtheria corynebacterium, corynebacterium, erysipelothrix rhusiopathiae, perfringens Clostridium, tetanus bacillus, intestinal bacteria (genus) aerogeytes, pneumobacillus, Pasturella multocida, Bacteroides, Fusobacterium nucleatum, Streptobacillus moniliformis, treponema, treponenma pertenue, leptospira and actinomyces.The fungi causing microorganism to cross the disease that strong stimulation host immune system causes includes but not limited to: genera cryptococcus neoformans, histoplasma capsulatum, posadasis spheriforme, Blastomyces dermatitidis, chlamydia trachomatis, Candida albicans.The fungi causing microorganism to cross the disease that strong stimulation host immune system causes includes but not limited to plasmodium falciparum, toxoplasma gondii.

" transplant rejection ": the immune-mediated disease caused due to tissue or organ transplantation.Transplanting is that graft is from donor to the transfer of acceptor.The graft shifted from donor to acceptor is cell, tissue or the organ of living.Autotransplantation is that the tissue of self is transferred to another position from a position.It is the transplanting carried out between the twin children of enzygotic twins that syngeneic is transplanted.Homotransplantation is in same species, have the transplanting carried out between Different Individual that genetics is distinguished.Xenotransplantation is transplanted between the individuality of different plant species.After body receives homotransplantation or xenotransplantation as acceptor one by one, body can produce immunne response to the histocyte of donor.In this case, need Immunosuppression to reply and avoid transplant rejection (Richard A.Goldsby, Thomas J.Kindt, Barbara A.Osborne.Janis Kuby.Immunology, Fifth Edition, 2003, W.H.FREEMAN AND COMPANY).Oligonucleotide in the present invention can be used for preventing transplant rejection.Graft can be: heart, kidney, liver, marrow, skin, cornea, lung, pancreas, small intestine, limbs, muscle, nerve, duodenum and islet cells etc.

Toll-like receptor activates diseases related: toll-like receptor activation is diseases related refers to the immune-mediated disease relevant with the activation of toll-like receptor (TLR) family member.These diseases include but not limited to: activate the relevant pyemia of TLR4 to LPS, with TLR2, 3, 4, 9 activate relevant dilated cardiomyopathy, with TLR2, 3, 4, 9 activate relevant diabetes, relevant experimental autoimmune encephalomyelitis is activated to TLR3, relevant systemic lupus erythematous is activated to TLR9, relevant atherosclerosis is activated to TLR4, the relevant asthma of TLR4 is activated to LPS, relevant chronic obstructive pulmonary disease is activated to TLR4, relevant EAE is activated to TLR4, (the Foo Y et al.Negative regulation of toll like receptor mediated immune responses.Nature Review Immunology such as relevant organ failure are activated to TLR4, Vol 5, 2005, 446-458) .CpG-containing DNA (a TLR9 agonist).Verified, in the serum of Patients with SLE, there is the DNA material containing CpG derived from containing nucleic acid infectant, these materials can cause the immunne response of secreting based on IFN-α, the progress of accelerating system lupus erythematosus.The oligonucleotide provided in the present invention can be used for prevention or/and treatment toll-like receptor activates diseases related.

" on pharmacology acceptable carrier ": on pharmacology, acceptable carrier refers to the weighting agent of one or more solids or liquid, thinner or encapsulating substance, and this carrier is applicable to the oligonucleotide in the present invention to be applied to individuality.This carrier can be organic, inorganic, natural or synthesis.This carrier comprises the carrier of the oligonucleotide application in various solution, thinner, solvent, dispersion agent, liposome, emulsion, sugar-coat, antiseptic-germicide, anti-mycotic agent, reagent that is isotonic and delayed absorption and other applicable the present invention.On pharmacology, the selection of acceptable carrier is decided by oligonucleotide application mode in the present invention.The carrier of injectable comprises water, physiological saline, balanced salt solution, glucose solution, glycerine etc.For solid mixture (as powder, ball, tablet, capsule form), conventional non-toxic solid carriers comprises: have the N.F,USP MANNITOL of pharmacology purity, lactose, starch and Magnesium Stearate etc.In addition, as biologically neutral carrier, can atoxic auxiliary substance be contained in the pharmacology component of application, comprise humidifying or emulsifying agent, sanitas, PH buffer reagent, sodium-acetate and mono-laurate etc.

" treatment effective dose ": in order to prevent or treat immune-mediated disease is treatment effective dose to the dosage of the oligonucleotide in individual applications the present invention.This treatment effective dose refers in prevention or treats in immune-mediated disease, can produce the dosage of the oligonucleotide of desirable prevention or result for the treatment of after giving individuality.Oligonucleotide in the present invention directly or can be put on pharmacology and apply in acceptable carrier.This " dosage " number be decided by the standard technique that those skilled in the art should be known, also will with reference to other factors, comprise and be not limited to individual size and the severity of health condition and disease.Oligonucleotide in the present invention can be used as single therapy or repeatedly treat.Oligonucleotide in the present invention is applied to individual dosage range from 1 μ g to 100mg at every turn.In order to reach desirable result for the treatment of, those skilled in the art can adjust the dosage of application, and if attending doctor is on the basis of reliable medical judgment, the dose titration made, its dosage range can be 10 times of aforementioned range to 1000 times.

" route of administration ": when applying, the oligonucleotide in the present invention can be applied separately or be made into pharmaceutical composition application by formula, reaches desirable result for the treatment of via various suitable approach.The therapy approach of the oligonucleotide in the present invention can be in intestines, intestines are outer, external application or inhalation route.The intestines internal therapy approach of the oligonucleotide in the present invention comprises per os, stomach, colon or rectal administration.The intestines externally applied agent approach of the oligonucleotide in the present invention comprises in vein, peritonaeum, sheath, muscle, subcutaneous, local injection, transvaginal, external application, nasal mucosa and lung suction etc.The external curing approach of the oligonucleotide in the present invention comprises through skin, oral cavity, eyes, ear and nose.

" pharmaceutical composition ": pharmaceutical composition refer in the present invention treat effective dose oligonucleotide or itself and pharmacology on the mixture that forms of acceptable carrier.Pharmaceutical composition divides the oligonucleotide that can comprise in one or more the present invention.Pharmaceutical composition can be, but not limited to be the aqueous solution, salts solution, particle, aerosol, tablet, pulvis, sugar coated tablet, capsule, suppository, syrup, emulsion, suspension, emulsifiable paste, drops and other suitable material.The application mode of pharmaceutical composition can be:, per os, per rectum, transvaginal outer through intestines, through intraperitoneal, through local (pulvis, ointment, gelifying agent, drops, penetrating patch), containing clothes or oral cavity and nasal spray etc.In all cases, pharmaceutical composition must be aseptic and stable.Injection medicine composition of the present invention comprises the pharmaceutically acceptable aqueous solution, non-aqueous solution, dispersion agent, clouding agent, emulsion or pulvis, dissolves before injection with aseptic water for injection or dispersion agent.Oligonucleotide in the present invention can dissolve by aqueous phase carriers, and such as with the isotonic damping fluid of pH 3.0 to pH8.0, pH value range also can be pH3.5-pH 7.4, pH 3.5-pH 6.0, pH 3.5-pH 5.0.Damping fluid comprises: citrate buffer, phosphate buffered saline buffer, acetate buffer.Oral pharmaceutical composition can make pulvis, tablet, pill, dragee, capsule, liquid, gel, syrup, paste or clouding agent etc. with edible carrier by formula.Conventional non-toxic solid carriers can be the N.F,USP MANNITOL of pharmacology rank, lactose, starch and Magnesium Stearate etc. as solid ingredient.The pharmaceutical drug composition of buccal administration can be tablet and the lozenge of traditional way.Pharmaceutical drug composition as inhalation is sprays, and related-art technology skilled person can choice for use pressure bladder, atomizer or dry powder.In some cases, in order to extend the action effect of oligonucleotide in the present invention, pharmaceutical composition is applied after can being processed over suitable sustained release system.Oligonucleotide in invention or pharmaceutical composition can be processed into the suspension of crystallization or the less amorphous substance of moisture, stably delay release.In the present invention of injection, the release that delays of oligonucleotide can by dissolving oligonucleotide to realize with hydrophobic substance (e.g., acceptable oiliness carrier).For the pharmaceutical composition of injection form, can be the oligonucleotide of liposome or newborn grain, or biodegradable semipermeable polymers, as polylactide, polyorthoesters or polyanhydride.

" active substance ": the oligonucleotide in the present invention can be applied separately, or several oligonucleotide combined utilization, or drug application acceptable carrier, or and one or more other active compound combined application.Oligonucleotide in the present invention and other active compound combined application, the while of can being in time also can be in succession.Active substance comprises nonsteroidal anti-inflammatory agents, steroid, nonspecific immunosuppressive agent, biological response modifier, compound, small molecules, nucleic acid molecule, TLR antagonist etc.Active substance also refers to the reagent of Immunosuppression activity in the following way: antagonize chemokine, induction produces regulatory T-cell (CD4+CD25+T cell), suppress complement system, suppress matrix metalloproteinase, suppress NO synthetic enzyme, block costimulatory molecules, the signal transduction of Immunosuppression cell.Including but not limited to of nonsteroidal anti-inflammatory agents: diclofenac, Diflonid, etodolac, U-27182, Ibuprofen BP/EP, indomethacin, Ketoprofen BP 93, KETOROLAC TROMETHAMINE SALT, Maxicom, naprosine, piroxicam, sulindac, tohnetin, celecoxib, rofecoxib.Steroid includes but not limited to corticoid, dexamethasone, hydrocortisone, medrat, dehydrohydro-cortisone, prednisone and hydrogen hydroxyl Ultracortene-H.Nonspecific immunosuppressive agent refers to the reagent of the disease for Immunosuppression mediation, includes but not limited to: endoxan, Ciclosporin A, methotrexate, steroid, FK506, tacrolimus, mycophenolic acid and sirolimus.Biological response modifier comprises: restructuring IL-1 receptor antagonist (Kineret or anakima), solubility p75, TNF-a acceptor gG1 fusion rotein (etanercept or Enbrel), anti-TNF-a monoclonal antibody (infliximab or RemicadeX), also comprise interferon beta-1a, interleukin 10 and TGF β.

" delivery vector ": the oligonucleotide in the present invention can use delivery vector delivery applications.Delivery vector includes but not limited to: steroid (as cholesterol), network and thing, emulsification, immunostimulating complex (ISCOMs), lipid (as cation lipid and negatively charged ion lipid), liposome, the bacteria carrier of living is (as Salmonellas, intestinal bacteria, mycobacterium will congratulates (family name) bacillus, lactobacillus) and live virus vector (as Smallpox Vaccine, adenovirus, hsv), virosomes, virus-like particle, microballoon, nucleic acid vaccine, macromolecular material is (as carboxymethyl cellulose, chitosan), cyclic polymer.Delivery vector also can by the targeting ligand molecule of specific receptors identification target cell.

" extracorporeal treatment immunocyte ": the oligonucleotide can applied in the present invention processes the immunocyte of this individuality in vitro, cell defeated time this individuality then will processed, reaches the object of preventing or treating immune-mediated disease.Processed cell can be the cell mass that the immunocytes such as dendritic cell, scavenger cell, T cell, B cell and natural killer cell are made up of one or several immunocytes.Treated immunocyte can feed back separately and to feed back together with the oligonucleotide in the present invention and/or other active substances feed back together.The feedback approach of immunocyte can be general also can be locality.

Embodiment

Person skilled in the art can recognize that oligonucleotide provided by the invention may be used for the immune-mediated disease of prevention and therapy.The embodiment of indefiniteness below will make illustrations to the present invention.

In these embodiments, 4 oligonucleotide (CpG2216, CpG2006, CpG C274, CpG302) are used as stimulant.CpG2216 is typical A type CpGODN, can activate people's plasmacytoid dendritic cells, produces a large amount of I type Interferon, rabbit (IFN-a/ β), activates NK cell consumingly.The plasmacytoid dendritic cells activated can secrete IFN α, the latter can make plasmacytoid dendritic cells move and gather lymphoglandula and other peripheral lymphoid tissues, this plasmacytoid dendritic cells can activate unsensitized T cell and memory T cell there, help soluble antigen to intersect submission to CD8+ cytotoxic T cell, promote CD4 and the cd8 t cell reaction of TH1 type.The reagent of antagonism CpG2216 activity can suppress to secrete IFN and activate NK cell for the innate immunity of feature and indirectly suppress Acquired immune response, therefore can be used for the prevention and therapy immune-mediated disease relevant to the natural immunity and acquired immunity.Type B, containing CpG ODN primary activation B cell, stimulates B cell increment and antibody-secreting.CpG2006 is typical Type B CpG ODN, can activate B cell, cause B cell proliferation and antibody-secreting.There is inhibiting reagent can suppress Acquired immune response particularly humoral immunoresponse(HI) to CpG2006, therefore can be used for the prevention and therapy immune-mediated disease relevant with humoral immunoresponse(HI).C type has A type and the Type B function containing CpG ODN containing the oligonucleotide of CpG simultaneously.CpG C274 and CpG 302 is C type ODN, has the character of A type and Type B.Suppress the reagent of CpG274 activity can be used for the prevention and therapy immune-mediated disease relevant to the natural immunity and acquired immunity.In addition, as TLR agonist, CpG2006, CpG274, CpG2216, CpG302 can cause innate immunity, so, antagonism CpG2006, CpG274, CpG2216, CpG 302 the reagent of activity can be used for treatment and activate relevant immune-mediated disease to TLR.

In an embodiment, be separated the source of human peripheral blood single nucleus cell as immunocyte using human peripheral, immunocyte wherein has T cell, B cell, natural killer cell, dendritic cell, granulocyte and monocyte etc.

Oligonucleotide in embodiment is synthesized by Shanghai Sheng Gong Bioisystech Co., Ltd.Oligonucleotide used in embodiment is all through without thermal source process.Intracellular toxin application king crab amoebocyte dissolution method in oligonucleotide detects (Associates of Cape Cod, Inc).What below show is sequence and the title of the oligonucleotide applied in an embodiment:

CpG2216(5’-gggggacgatcgtcgggggg-3’)

CpG2006(5’-tcgtcgttttgtcgttttgtcgtt-3’)

CpG C274(5’-tcgtcgaacgttcgagatgat 3’)

CpG 302(5`-tcg tcg ggt gcg acg tcg cag ggg gg-3`)

A151(5′-ttagggttagggttagggttaggg-3’)(Hidekazu Shirota，et al.Suppressive Oligodeoxynucleotides Protect Mice from Lethal Endotoxic Shock.The Journal of Immunology，2005，174：4579-4583)

SAT05(5′-ctctctctctctctctctct-3’)，SEQ ID NO：1

SAT05f(5′-cctcctcctcctcctcctcctcct-3’)，SEQ ID NO：2

CT 151h(5′-ctctctttagggttagggctctct-3’)，SEQ ID NO：3

CT151g(5′-ttagggctctctctctctttaggg-3’)，SEQ ID NO：4

CT151f(5′-ctctttagggttagggttaggg-3′)，SEQ ID NO：5

CT151e(5′-ttagggttagggttagggctctct-3′)，SEQ ID NO：6

CT151d(5′-ctctctctctctttagggttaggg-3′)，SEQ ID NO：7

CT151c(5′-ttagggttagggctctctctctct-3’)，SEQ ID NO：8

CT151b(5′-ctctctttagggctctctttaggg-3’)，SEQ ID NO：9

CT151a(5′-ttagggctctctttagggctctct-3’)，SEQ ID NO：10

1612A4 (5 '-gttagagattaggca-3 '), Control CpG (control oligonucleotide)

SAT05e(5′-cttcttcttcttcttcttcttctt-3’)，SEQ ID NO：11

SAT05d(5′-ctctctctctctctctctctctct-3’)，SEQ ID NO：12

SAT05c(5′-ctctctctctctctctct-3’)，SEQ ID NO：13

SAT05b(5′-ctctctctctct-3’)，SEQ ID NO：14

SAT05a(5′-ctctct-3’)，SEQ ID NO：15

MS08(5’-TCTCTCTCTCTCTCTCTCTCTCTC-3’)，SEQ ID NO：16

MS19 (5 '-AAAGAAAGAAAGAAAGAAAGAAAG-3 '), Control CpG (control oligonucleotide)

The impact that embodiment 1, SAT05 induce human peripheral blood single nucleus cell (PBMCs) to breed on CpG ODN

Human peripheral blood single nucleus cell (purchased from Pharmacia company, blood sample is provided by Jilin Province's Blood Center Ficoll reagent) is separated from human peripheral with Ficoll-Hypaque density gradient centrifugation.Be 95%-99% by the surviving rate of platform phenol blue staining determination human peripheral blood single nucleus cell.With [ ³h] thymus pyrimidine incorporation methods detects the proliferative conditions of human peripheral blood single nucleus cell.Briefly, human peripheral blood single nucleus cell is with 5 × 10 ⁵the density in/hole is inoculated into orifice plate of the U-shaped end 96, when there is SAT05 or A151 or control oligonucleotide (ODN), 48 hours are hatched altogether with CpG 2006 (1 μ g/ml) or CpG C274 (1 μ g/ml), add afterwards [ ³h] thymus pyrimidine (New England Nuclear, Boston, MA) cultivates 16 hours.Harvested cell on glass fibre filter, uses scintillometer detected result.Cell proliferative conditions is represented with average cpm ± SD.3 multiple holes established by each sample.

As shown in the result of Fig. 1, the SAT05 be made up of CT tumor-necrosis factor glycoproteins [(CT) n] can suppress to be bred by the human peripheral blood single nucleus cell under CpG 2006 or CpGC274 stimulation.This inhibition is obviously better than the inhibition of A151 induction.The oligonucleotide of contrast does not manifest restraining effect.

The impact that embodiment 2SAT05f induces human peripheral blood single nucleus cell (PBMCs) to breed on CpG ODN

Human peripheral blood single nucleus cell (purchased from Pharmacia company, blood sample is provided by Jilin Province's Blood Center Ficoll reagent) is separated from human peripheral with Ficoll-Hypaque density gradient centrifugation.Be 95%-99% by the surviving rate of platform phenol blue staining determination human peripheral blood single nucleus cell.With [ ³h] thymus pyrimidine incorporation methods detects the proliferative conditions of human peripheral blood single nucleus cell.Briefly, human peripheral blood single nucleus cell is with 5 × 10 ⁵the density in/hole is inoculated into orifice plate of the U-shaped end 96, when there is SAT05f or A151 or control oligonucleotide (ODN), hatches 48 hours altogether with CpG2006 (1 μ g/ml) or CpG274 (1 μ g/ml), add afterwards [ ³h] thymus pyrimidine (New England Nuclear, Boston, MA) cultivates 16 hours.Harvested cell on glass fibre filter, uses scintillometer detected result.Cell proliferative conditions is represented with average cpm ± SD.3 multiple holes established by each sample.

As shown in the result of Fig. 2, the SAT05f be made up of CCT tumor-necrosis factor glycoproteins [(CCT) n] can suppress to be bred by the human peripheral blood single nucleus cell under CpG 2006 or CpG C274 stimulation.The inhibition that this inhibition is induced apparently higher than A151.The oligonucleotide of contrast does not have restraining effect.

Embodiment 3SAT05 stimulates lower human peripheral blood single nucleus cell to produce the impact of antiviral activity on CpG ODN

Human peripheral blood single nucleus cell (purchased from Pharmacia company, blood sample is provided by Jilin Province's Blood Center Ficoll reagent) is separated from human peripheral with Ficoll-Hypaque density gradient centrifugation.Be 95%-99% by the surviving rate of platform phenol blue staining determination human peripheral blood single nucleus cell.

Vero E6 cell (African green monkey kidney cell line, be derived from Type Culture Collection, the U.S.) with containing the IMDM nutrient solution of 10% (v/v) heat-inactivated foetal calf serum and microbiotic (100 IU of penicillin/ml and 100 IU of streptomycin/ml) at 37 DEG C, 5%CO ₂cell incubator in cultivate.Adopt Vero E6 cytopathy political reform detection through the antiviral activity of CpG ODN handler culture supermatant of peripheral blood mononuclear cells.Making brief of the introduction as follows: when there is SAT05 or A 151 or control oligonucleotide (ODN), by human peripheral blood single nucleus cell and CpG2216 co-cultivation 48 hours, collecting supernatant.By Vero E6 cell (3 × 10 ⁴/ hole) be inoculated into flat 96 orifice plates, cultivate 24 hours.Afterwards, and the supernatant of the above-mentioned collection of 100 μ l cultivates 18 hours, then the VSV virus (vesicular stomatitis virus) adding 10 × TCID50 (TCID50, median tissue infective dose) continues cultivation 48 hours.After cultivation terminates, with the knot product purple dyeing of 0.5%.Measure OD value (A578nm) with multi-well microtiter plate detector, represent the cytopathic effect of virus with OD value.

As shown in Figure 3, the generation of the human peripheral blood single nucleus cell antiviral substance under the SAT05 be made up of CT tumor-necrosis factor glycoproteins [(CT) n] can suppress to be stimulated by CpG 2216.Another tests proof, suppresses antiviral activity relevant with the minimizing that I type Interferon, rabbit produces.

Embodiment 4SAT05f stimulates the impact of lower human peripheral blood single nucleus cell antiviral activity to CpG ODN

Mononuclearcell (purchased from Pharmacia company, blood sample is provided by Jilin Province's Blood Center Ficoll reagent) is separated from human peripheral with Ficoll-Hypaque density gradient centrifugation.Be 95%-99% by the surviving rate of platform phenol blue staining determination human peripheral blood single nucleus cell.

Vero E6 cell (African green monkey kidney cell line, Type Culture Collection, the U.S.) with containing the IMDM nutrient solution of 10% (v/v) heat-inactivated foetal calf serum and microbiotic (100 IU of penicillin/ml and 100 IU of streptomycin/ml) at 37 DEG C, 5%CO ₂cell incubator in cultivate.Adopt Vero E6 cytopathy political reform detection through the antiviral activity of CpG ODN handler culture supermatant of peripheral blood mononuclear cells.Making brief of the introduction as follows: when there is SAT05f or A151 or control oligonucleotide (ODN), by human peripheral blood single nucleus cell and CpG274 co-cultivation 48 hours, collecting supernatant.By Vero E6 cells (3 × 10 ⁴/ hole) be inoculated into platybasic type 96 orifice plate, cultivate 24 hours.Afterwards, cultivate 18 hours with the supernatant of the above-mentioned collection of 100 μ l, then the VSV virus (vesicular stomatitis virus) adding 10 × TCID50 (TCID50, median tissue infective dose) continues cultivation 48 hours.After cultivation terminates, by the violet staining of 0.5%.Measure OD value (A578nm) with multi-well microtiter plate detector, represent the cytopathic effect of virus with OD value.

As shown in Figure 4, the generation of the human peripheral blood single nucleus cell antiviral substance under the SAT05f be made up of CT tumor-necrosis factor glycoproteins [(CCT) n] can suppress to be stimulated by CpG 274.Another tests proof, suppresses antiviral activity relevant with the minimizing that I type Interferon, rabbit produces.

The impact that embodiment 5 is bred human peripheral blood single nucleus cell containing CT tumor-necrosis factor glycoproteins, CCT tumor-necrosis factor glycoproteins, the oligonucleotide that is rich in CT sequence

Mononuclearcell (purchased from Pharmacia company, blood sample is provided by Jilin Province's Blood Center Ficoll reagent) is separated from human peripheral with Ficoll-Hypaque density gradient centrifugation.Be 95%-99% by the surviving rate of platform phenol blue staining determination human peripheral blood single nucleus cell.Human peripheral blood single nucleus cell is with 5 × 10 ⁵the density in/hole is inoculated into orifice plate of the U-shaped end 96, under the condition of oligonucleotide that there are the various concentration indicated as Fig. 5, with CpG274 (5 μ g/ml) co-cultivation 48 hours.Add afterwards [ ³h] thymus pyrimidine (New England Nuclear, Boston, MA) cultivates 16 hours.4 control groups are established in experiment: " PBS " group refer to human peripheral blood single nucleus cell only with CpG274 (5 μ g/ml) Dual culture; The human peripheral blood single nucleus cell that " cell " group refers to cultivation not with CpG274 Dual culture; " A 151 " group refers to human peripheral blood single nucleus cell CpG274 (5 μ g/ml) Dual culture, and adds A151; " 1612A4 " group refers to human peripheral blood single nucleus cell CpG274 (5 μ g/ml) Dual culture, and adds 1612A4 (Control ODN).Harvested cell on glass fibre filter, uses scintillometer detected result.Cell proliferative conditions is represented with average cpm ± SD.3 multiple holes established by each sample.

As shown in Figure 5, the human peripheral blood single nucleus cell propagation stimulated by CpG274 can be suppressed containing CT tumor-necrosis factor glycoproteins, CCT tumor-necrosis factor glycoproteins, the oligonucleotide that is rich in CT sequence.

The impact that embodiment 6, MS08 induce human peripheral blood single nucleus cell (PBMCs) to breed on CpG ODN

Human peripheral blood single nucleus cell (purchased from Pharmacia company, blood sample is provided by Jilin Province's Blood Center Ficoll reagent) is separated from human peripheral with Ficoll-Hypaque density gradient centrifugation.Be 95%-99% by the surviving rate of platform phenol blue staining determination human peripheral blood single nucleus cell.With [ ³h] thymus pyrimidine incorporation methods detects the proliferative conditions of human peripheral blood single nucleus cell.Briefly, human peripheral blood single nucleus cell is with 5 × 10 ⁵the density in/hole is inoculated into orifice plate of the U-shaped end 96, when there is MS08 (see SQE ID NO:16) or control oligonucleotide MS19 (5 '-AAAGAAAGAAAGAAAGAAAGAAAG-3 '), 48 hours are hatched altogether with CpG 2006 (1 μ g/ml) or CpG C274 (1 μ g/ml) or CpG684 (1 μ g/ml), add afterwards [ ³h] thymus pyrimidine (New England Nuclear, Boston, MA) cultivates 16 hours.Harvested cell on glass fibre filter, uses scintillometer detected result.Cell proliferative conditions is represented with average cpm ± SD.3 multiple holes established by each sample.

As shown in the result of Fig. 6, the human peripheral blood single nucleus cell propagation under the MS08 be made up of TC tumor-necrosis factor glycoproteins [(TC) n] can suppress to be stimulated by CpG 2006 or CpG C274 or CpG 684.The oligonucleotide of contrast does not manifest restraining effect.

Embodiment 7MS08 stimulates lower human peripheral blood single nucleus cell to produce the impact of antiviral activity on CpG ODN

Vero E6 cell (African green monkey kidney cell line, be derived from Type Culture Collection, the U.S.) with containing the IMDM nutrient solution of 10% (v/v) heat-inactivated foetal calf serum and microbiotic (100IU of penicillin/ml and 100 IU of streptomycin/ml) at 37 DEG C, 5%CO ₂cell incubator in cultivate.Adopt Vero E6 cytopathy political reform detection through the antiviral activity of CpG ODN handler culture supermatant of peripheral blood mononuclear cells.Make brief of the introduction as follows: exist in MS08 or control oligonucleotide MS19 (5 '-AAAGAAAGAAAGAAAGAAAGAAAG-3 ') situation, by human peripheral blood single nucleus cell and CpG2216 or CpG C274 or CpG 302 (5`-tcg tcg ggt gcg acg tcg cag ggg gg-3`) co-cultivation 48 hours, collect supernatant.By Vero E6 cell (3 × 10 ⁴/ hole) be inoculated into flat 96 orifice plates, cultivate 24 hours.Afterwards, and the supernatant of the above-mentioned collection of 100 μ l cultivates 18 hours, then the VSV virus (vesicular stomatitis virus) adding 10 × TCID50 (TCID50, median tissue infective dose) continues cultivation 48 hours.After cultivation terminates, by the violet staining of 0.5%.Measure OD value (A578nm) with multi-well microtiter plate detector, represent the cytopathic effect of virus with OD value.

As shown in Figure 7, the generation of the human peripheral blood single nucleus cell antiviral substance under the MS08 be made up of TC tumor-necrosis factor glycoproteins [(TC) n] can suppress to be stimulated by CpG 2216 or CpG C274 or CpG 302.Another tests proof, suppresses antiviral activity relevant with the minimizing that I type Interferon, rabbit produces.

Sequence table

<110> Changchun Huapu Biotechnology Co., Ltd.

<120>Toll sample receptor adjustment oligonucleotide and be used for the treatment of the purposes of immunologically mediated disease

<160>16

<210>1

<211>20

<212>DNA

<213> synthetic

<400>1

ctctctctct ctctctctct 20

<210>2

<211>24

<212>DNA

<213> synthetic

<400>2

cctcctcctc ctcctcctcc tcct 24

<210>3

<211>24

<212>DNA

<213> synthetic

<400>3

ctctctttag ggttagggct ctct 24

<210>4

<211>24

<212>DNA

<213> synthetic

<400>4

ttagggctct ctctctcttt aggg 24

<210>5

<211>24

<212>DNA

<213> synthetic

<400>5

ctctctttag ggttagggtt aggg 24

<210>6

<211>24

<212>DNA

<213> synthetic

<400>6

ttagggttag ggttagggct ctct 24

<210>7

<211>24

<212>DNA

<213> synthetic

<400>7

ctctctctct ctttagggtt aggg 24

<210>8

<211>24

<212>DNA

<213> synthetic

<400>8

ttagggttag ggctctctct ctct 24

<210>9

<211>24

<212>DNA

<213> synthetic

<400>9

ctctctttag ggctctcttt aggg 24

<210>10

<211>24

<212>DNA

<213> synthetic

<400>10

ttagggctct ctttagggct ctct 24

<210>11

<211>24

<212>DNA

<213> synthetic

<400>11

cttcttcttc ttcttcttct tctt 24

<210>12

<211>24

<212>DNA

<213> synthetic

<400>12

ctctctctct ctctctctct ctct 24

<210>13

<211>18

<212>DNA

<213> synthetic

<400>13

ctctctctct ctctctct 18

<210>14

<211>12

<212>DNA

<213> synthetic

<400>14

ctctctctct ct 12

<210>15

<211>6

<212>DNA

<213> synthetic

<400>15

ctctct 6

<210>16

<211>24

<212>DNA

<213> synthetic

<400>16

tctctctctc tctctctctc tctc 24 。

Claims

1.Toll sample receptor adjustment oligonucleotide is for the preparation of for treating by the activation of antagonism toll-like receptor TLR or the purposes of medicine of disease of epidemic prevention mediation, described disease is dilated cardiomyopathy, diabetes or systemic lupus erythematous, the feature of wherein said Toll-like receptor adjustment oligonucleotide is that this oligonucleotide is made up of the sequence of CT repeating unit (CT) n, C is wherein cytosine(Cyt), T is thymus pyrimidine, and n is the integer of 3-12, is the number of repeating unit.

2. purposes according to claim 1, wherein this oligonucleotide is one of SEQ ID NO:1, the sequence shown in SEQ ID NO:12-15.

3. purposes according to claim 1, wherein this oligonucleotide is sequence is the oligonucleotide shown in SEQ ID NO:1:5'-ctctctctctctctctctct-3 '.

4., according to the purposes described in any one of claim 1-3, oligonucleotide is wherein application separately or uses together with pharmaceutically acceptable carrier.

5. according to the purposes described in any one of claim 1-3, wherein said medicine for being suitable in intestines, outside intestines, external application and suck the form used.

6., according to the purposes described in any one of claim 1-3, the subject of wherein said medicine is vertebrates.

7., according to the purposes described in any one of claim 1-3, the subject of wherein said medicine is people.

8., according to the purposes described in any one of claim 1-3, wherein said oligonucleotide uses as the effective constituent in pharmaceutical composition.

9. according to the purposes described in any one of claim 1-3, wherein said oligonucleotide can be used alone when giving individuality, or self conbined usage, or other the active compound combined use with one or more.

10., according to the purposes described in any one of claim 1-3, wherein said oligonucleoside can be applied separately or/and delivery vector combined utilization when giving individuality.

11. according to the purposes described in any one of claim 1-3, and the cell processed by being used for processing individual immunity cell in vitro, then feeding back and uses to same individuality by wherein said oligonucleotide.

12. according to the purposes described in any one of claim 1-3, and the application dose of wherein said oligonucleotide is treatment effective dose.