CN102841200A - Use of pIgR as molecular marker of early recurrence and/or metastasis of tumor and intervening target spot of anti-tumor metastasizing medicine - Google Patents
Use of pIgR as molecular marker of early recurrence and/or metastasis of tumor and intervening target spot of anti-tumor metastasizing medicine Download PDFInfo
- Publication number
- CN102841200A CN102841200A CN2011101740368A CN201110174036A CN102841200A CN 102841200 A CN102841200 A CN 102841200A CN 2011101740368 A CN2011101740368 A CN 2011101740368A CN 201110174036 A CN201110174036 A CN 201110174036A CN 102841200 A CN102841200 A CN 102841200A
- Authority
- CN
- China
- Prior art keywords
- pigr
- cancer
- interference fragment
- rna interference
- section
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/56—Staging of a disease; Further complications associated with the disease
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Hematology (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Oncology (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biotechnology (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to a use of pIgR as a molecular marker for diagnosing or predicting early recurrence and/or metastasis of tumor and an intervening target spot of an anti-tumor metastasizing medicine. Specifically, aiming at a pIgR protein, the invention provides a use of an antibody in preparation of a diagnostic agent for diagnosing or predicting recurrence and/or metastasis of tumor. In addition, the invention further provides a use of a material which reduces pIgR protein expression in preparation of a medicine for preventing and/or treating recurrence and/or metastasis of tumor. Furthermore, the invention further provides an antisense oligodeoxynucleotide or an RNA (Ribonucleic Acid) interference fragment or an expression carrier which stably generates the RNA interference fragment.
Description
Technical field
The present invention relates to biomedicine field, in particular to the purposes of diagnosticum that is used for diagnosing or predicts recurrence and/or the transfer of tumour to the antibody of pIgR albumen in preparation; And the material that makes pIgR albumen or its 662-735 section or the downward modulation of 680-735 section protein expression is used for preventing and/or treating the purposes of medicine of recurrence and/or the transfer of tumour in preparation; And a kind of antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment.
Background technology
Malignant tumour is one of principal disease of serious threat human life, and the transfer of tumour then is to cause cancer patient's main causes of death.There is data to show that 90% malignant tumor patient dies from the transfer and the recurrence of tumour.The research, the particularly research of tumor recurrence transfer of molecules mark of at present relevant tumour metastasis and recurrence progress are the focuses of tumor recurrence transfer research always.Therefore; Find new biomarker that is used for early diagnosis, prediction transfer and the new target molecule that is used for therapeutic intervention; Be the effective means that improve tumor patient cure rate and survival rate; Diagnosis and treatment for tumour have great importance, and have become to be rich in challenge and far reaching field in current life science and the medical research.
In the research of metastases, (epithelial-mesenchymal transition EMT) receives increasing concern recently in the matter conversion between epithelium.EMT be meant the cell of epithelial character with polarity convert to have mobility, can between cellular matrix, move freely have a process of matter characteristic cell.Epithelial cell phenotype conversion process is by meticulous intracellular signal transduction mechanism regulating, and is closely related with multiple chronic disease (the particularly generation of tumour, infiltration and transfer), therefore becomes the focus in forward position in the tumor research.The cell self character is not only depended in the generation of EMT, receives the adjusting of cell micro-environment (microenvironment) simultaneously.Increasing research shows; Inflammatory microenvironment (especially chronic inflammation microenvironment); As the important physiological incident of body immune system to infection or stimuli responsive; In the incidence and development process of EMT, have important facilitation, become the total pathological characters that great pathologic process such as organ fibrosis, tumour transforms.
Polymeric immunoglobulin receptor (pIgR) belongs to I type transmembrane glycoprotein; Be divided into intracellular region (being the terminal 662-764 amino acid of C), extracellular region (being the terminal 19-638 amino acid of N) and stride three parts in film district (639-661 amino acid) (P01833, UniProtKB/Swiss-Prot database).PIgR has all brought into play important effect through the polarity transhipment of poly-ig dIgA/pIgM in the mediated cell in congenital and acquired immunity.PIgR is positioned on the basolateral membrane of glandular epithelium and liver cell (some species), experiences the inflammatory environment usually and raises, and resists virus or pathogenic infection.In fact, as far back as the research that just has pIgR in tumour, to express decades ago, but expression just differs, and it is especially important that the clinical prognosis of this expression difference and tumour patient does not appear in the newspapers as yet.
Summary of the invention
To the problem that exists in the prior art, the inventor has carried out extensive research, finally accomplishes the present invention.
An object of the present invention is to provide the purposes of polymeric immunoglobulin receptor (pIgR) as the pharmaceutical intervention target spot of diagnosis or the early stage recurrence of prediction tumour and/or molecular marker that shifts and/or anti metastasis.
To achieve these goals, the invention provides the method for diagnosing or predict the recurrence and/or the transfer of tumour through the expression that detects pIgR albumen; And the invention provides through utilization and make the material of pIgR albumen or its 662-735 section or the downward modulation of 680-735 section protein expression prevent and/or treat the method for the recurrence and/or the transfer of tumour.
According to an aspect of the present invention, the invention provides the purposes of diagnosticum that is used for diagnosing or predicts recurrence and/or the transfer of tumour to the antibody of pIgR albumen in preparation.
Used term " diagnosticum " both can be used to early stage recurrence of diagnosing tumour and/or transfer among the present invention, can be used to predict the risk of tumor recurrence and/or transfer again.
Among the present invention, preferably, said antibody to pIgR albumen is selected from antibody to the pIgR full-length proteins, to the antibody of pIgR intracellular region with in the antibody of pIgR extracellular region, but be not limited thereto.More preferably, said antibody to pIgR albumen can be the antibody to the pIgR intracellular region.Most preferably, said antibody to pIgR albumen is the antibody of going up 662-735 section or 680-735 section albumen to pIgR.
Among the present invention; Diagnose or predict that the recurrence of tumour and/or the method for transfer may further comprise the steps through the expression that detects pIgR albumen: get tumor tissues; Utilize the antibody of pIgR, adopt SABC method described in the embodiment or immune marking method to detect the expression of pIgR albumen.
Simultaneously, the invention provides a kind of kit that is used to diagnose or predict the recurrence and/or the transfer of tumour, it is characterized in that, said kit comprises the antibody to pIgR albumen.
According to another aspect of the present invention, the invention provides the material that makes pIgR protein expression downward modulation is used for preventing and treats recurrence and/or the transfer of tumour in preparation the purposes of medicine.
According to also aspect of the present invention, the material that the invention provides the 662-735 section that makes pIgR albumen or the downward modulation of 680-735 section protein expression is used for preventing and/or treating the purposes of medicine of recurrence and/or the transfer of tumour in preparation.
Among the present invention; Preferably; The material of said its 662-735 section of the pIgR of making albumen person or the downward modulation of 680-735 section protein expression is the expression vector of antisense oligonucleotide or RNA interference fragment or the stable RNA of generation interference fragment; The expression vector of said antisense oligonucleotide or RNA interference fragment or the stable RNA of generation interference fragment is to be directed against pIgR to go up the strand of 662-735 section or the design of 680-735 section albumen or the double-stranded nucleotide fragments with the expression of this section of target sequence, maybe can stablize the expression vector that produces the nucleotide fragments with above-mentioned characteristic.More preferably, said antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment comprise the sequence of target continuous 13～24 nucleotide sequences in 5 '-AGAGCCCGGCACAGGAAGAACGUCGACCGAGUUUCAAUCAGAAGCUACAGGACAGA CAUUAGCAUGUCAGACUUCGAGAACUCCAGGGAAUUUGGAGCCAAUGACAACAUGG GAGCCUCUUCGAUCACUCAGGAGACAUCCCUCGGAGGAAAAGAAGAGUUUGUUGCC ACCACUGAGAGCACCACAGAGACCAAAGAACCCAAGAAGGCAAAAAGGUCAUCC-3 '.
Among the present invention, preferably, said antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment, the template sequence that target is directed against is following:
Template sequence 2,5 '-ACGUCGACCGAGUUUCAAUCAG-3 '; Or
Template sequence 3,5 '-AGAAGAGUUUGUUGCCACCACU-3 '.
Among the present invention; Preferably, said tumour is selected from liver cancer, colorectal cancer, prostate cancer, cancer of the stomach, lung cancer, breast cancer, cancer of pancreas, cervical carcinoma, kidney, carcinoma of urinary bladder, oophoroma, glioma, melanoma, incidence cancer, cholangiocarcinoma, nasopharyngeal carcinoma and the thyroid cancer.More preferably, said tumour is liver cancer, colorectal cancer, prostate cancer, cancer of the stomach or lung cancer.
Among the present invention; Utilization makes the material of its 662-735 section of pIgR albumen person or the downward modulation of 680-735 section protein expression prevent and/or treat the recurrence of tumour and/or the method for transfer may further comprise the steps: with the medicament transport system, carry antisense oligonucleotide (like little RNA) interference fragment to target organ.
According to a further aspect of the invention; The invention provides the expression vector of a kind of antisense oligonucleotide or RNA interference fragment or the stable RNA of generation interference fragment; The expression vector of said antisense oligonucleotide or RNA interference fragment or the stable RNA of generation interference fragment is to be directed against pIgR to go up the strand of 662-735 section or the design of 680-735 section albumen or the double-stranded nucleotide fragments with the expression of this section of target sequence; Maybe can stablize the expression vector that produces nucleotide fragments with above-mentioned characteristic; Preferably, said antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment comprise the sequence of target continuous 13～24 nucleotide sequences in 5 '-AGAGCCCGGCACAGGAAGAACGUCGACCGAGUUUCAAUCAGAAGCUACAGGACAGA CAUUAGCAUGUCAGACUUCGAGAACUCCAGGGAAUUUGGAGCCAAUGACAACAUGG GAGCCUCUUCGAUCACUCAGGAGACAUCCCUCGGAGGAAAAGAAGAGUUUGUUGCC ACCACUGAGAGCACCACAGAGACCAAAGAACCCAAGAAGGCAAAAAGGUCAUCC-3 '.
Among the present invention, preferably, said antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment, the template sequence that target is directed against is following:
Template sequence 2,5 '-ACGUCGACCGAGUUUCAAUCAG-3 '; Or
Template sequence 3,5 '-AGAAGAGUUUGUUGCCACCACU-3 '.
Description of drawings
Fig. 1 is the expression of explanation pIgR albumen and the figure that the liver cancer patient postoperative recurs correlativity in two years.
The early stage figure that especially has remarkable meaning that Fig. 2 takes place in liver cancer the indication of 2 years relapse and metastasis rates of liver cancer patient postoperative for the high expressed of explanation pIgR albumen; Wherein, Fig. 2 A figure of the indication of 2 years relapse and metastasis rates of liver cancer patient postoperative especially being had remarkable meaning for the high expressed that shows pIgR albumen in the liver cancer patient of no cancer embolus; Fig. 2 B especially has remarkable meaning for the high expressed that shows pIgR albumen in the liver cancer patient of tumour single-shot to the indication of 2 years relapse and metastasis rates of liver cancer patient postoperative figure; The figure that Fig. 2 C especially has remarkable meaning in tumour knurl footpath in less than the liver cancer patient of 5cm to the indication of 2 years relapse and metastasis rates of liver cancer patient postoperative for the high expressed that shows pIgR albumen; Fig. 2 D is the figure that in the liver cancer patient of I phase especially have remarkable meaning to the indication of 2 years relapse and metastasis rates of liver cancer patient postoperative at TNM for the high expressed that shows pIgR albumen.
Fig. 3 can obviously promote the figure of EMT vicious transformation (cellular morphology, EMT marker protein, locomitivity) for the high expressed of explanation pIgR; Wherein, Fig. 3 A is the figure of the influence of the expression pair cell form of demonstration pIgR; Fig. 3 B shows the figure of the expression of pIgR to the influence of EMT correlating markings albumen; Fig. 3 C and Fig. 3 D are the figure of the influence of the expression pair cell locomitivity of demonstration pIgR.
Fig. 4 and Fig. 5 are explanation pIgR high expressed can obviously promote the figure that SCID mouse experiment property lung shifts.
Fig. 6 A and 6B are the figure that pIgR induces two critical function zones of EMT vicious transformation for 662-735 section and the 680-735 section albumen territory of explanation pIgR.
Fig. 7 all can promote the figure of EMT vicious transformation for explanation high expressed pIgR in the primary cell of different genera, different tissue sources and cell line; Wherein, Fig. 7 A is presented at the figure that high expressed pIgR among HCC BEL-7402, the liver cell LO2 can promote the EMT vicious transformation; Fig. 7 B is presented at the figure that high expressed pIgR among the lung carcinoma cell H1650 can promote the EMT vicious transformation; Fig. 7 C is presented at the figure that high expressed pIgR among the Human umbilical vein endothelial cells HUVEC can promote the EMT vicious transformation; Fig. 7 D is presented at the figure that high expressed pIgR among the MEC MEF can promote the EMT vicious transformation.
Embodiment
The inventor utilizes immunohistochemistry technique; Detected the expression of pIgR albumen in the 254 routine liver cancer paraffin sections; Result of study shows that 2 years relapse and metastasis rates of pIgR high expressed and liver cancer postoperative are closely related, and the pIgR high expressed is the independent hazard factor of 2 years relapse and metastasis of liver cancer patient.Then the inventor has analyzed the relation between the different clinical pathologic characteristics with liver cancer of pIgR expression, and the result shows, the pIgR high expressed especially has significant meaning to the indication of 2 years relapse and metastasis rates of liver cancer patient what liver cancer took place in early days.Further investigation shows that high expressed pIgR all can significantly induce the generation of EMT in cell, utilizes shRNA to disturb the expression of pIgR, and EMT takes place obviously to reverse; In vivo studies shows that the strain of pIgR high expressing cell is inoculated in severe combined immunodeficiency (SCID) mouse, can obviously promote lung to shift.Further investigation finds that the 662-735 section of pIgR and 680-735 section albumen territory all are two critical function zones that pIgR induces the EMT vicious transformation.In addition, inventor high expressed pIgR in the primary cell of different genera, different tissue sources and cell line all can cause the generation of EMT, shows that it is a general character phenomenon that pIgR induces EMT to transform.Inventor's research has disclosed a brand-new EMT inducible factor pIgR first; Find that pIgR is the important biomolecule mark and intervention target of metastases and the early stage recurrence of tumour; Above-mentioned research is that early diagnosis of tumor and early treatment provide important experimental basis, for the medicine for anti transfer of tumor research and development new target drone is provided simultaneously.
The following example is clear inventor's standard laboratory practice for example, the pattern of the present invention that is used to demonstrate, and should the present invention be interpreted as the scope that is defined in these embodiment.
Relation between embodiment 1:pIgR and the clinical tumor characteristic and pIgR and malignancy of tumor transform the correlativity between the marker molecule
1, experimental technique
Tissue specimen
Among the present invention employed liver cancer tissue sample derive from Fudan University's liver cancer research in the patients with hepatocellular carcinoma that confirms through surgical resection and pathological examination of mountain hospital.When making a collection of specimens, get the flesh tissue sample that excises in the operation, sample is drawn materials after downcutting immediately, places liquid nitrogen rapidly, puts-70 ℃ of refrigerators then and preserves subsequent use.Every routine patient all gets liver cancer primary tumor and adjacent no knurl hepatic tissue thereof, and wherein, adjacent no knurl hepatic tissue is got the main knurl of the distance tissue of (beyond the 2cm) far away as far as possible.
The donor of employed liver cancer tissue sample all has following characteristics among the present invention: it is hepatocellular carcinoma that (1) pathology confirms; (2) operation is radical excision, and standard is: complete tumor resection, and the histological examination incisxal edge is negative; (3) patients clinical case data and to follow up a case by regular visits to complete data reliable.All patient specimens obtain all through in mountain Ethics Committee of hospital agree, obtain patient's agreement and signature Informed Consent Form.
Clinical and pathological data and follow up a case by regular visits to data
All cases all have complete postoperative to follow up a case by regular visits to data; Follow up a case by regular visits to 20, on April of closing time to 2010; Follow up a case by regular visits to the physical data of content except the patient; Comprise age, sex, hepatitis situation etc., also have the characteristic of tumour comprise alpha-fetoprotein (alpha-fetoprotein, AFP), glutamic-pyruvic transaminase (ALT; Alanine aminotransferase), degree of cirrhosis, tumour size, have or not coating, number, Edmondson classification, existence, recurrence situation etc., some cases to carry out CT, MRI and angiography inspection and therapeutic process etc.; The tissue specimen of each case is classified as differentiation well through high age and service seniority pathologist diagnosis and further consultation with Edmondson I-II level in this research, and the III-IV level is classified as poor differentiation; The liver cancer recurrence standard: according to iconography, serology and histological examination result, as occur that AFP increases, typical case's recurrence signs such as liver occupy-place and DISTANT METASTASES IN, combining clinical manifestation and treatment, the situation of following up a case by regular visits to determine whether is to recur.
In no knurl existence (disease-free survival) was analyzed, we carried out analytic statistics to the early stage recurrent events of tumour.Tumor recurrence is divided into early stage recurrence (early recurrence) and recurrence in late period (late recurrence), 2 years is the boundary with postoperative, and recurrence in two years is early stage recurrence, and recurrence is the recurrence in late period after 2 years.
The preparation of organization chip and immunohistochemical staining
Organization chip makes up:
1) sample is selected: the excision sample pathological number according to selected case is taken out its corresponding FFPE sample, comprises liver neoplasm tissue and corresponding cancer beside organism;
The scope of 2) HE stained pathological diagnosis, and mark pathological tissues.Each case is all checked through the too high age and service seniority doctor of pathology department;
3) according to the types of organization and the arrangement mode of experiment purpose design organization chip array;
4) prepare suitable blank acceptor wax block with tissue embedding machine;
5) organize core and clocklike be arranged on the blank acceptor wax block according to array design extracting pathology wax stone with the tissue array appearance;
6) the tissue array piece heats fusion in 52 ℃ of constant temperature roasters, makes and organizes core closely to link to each other with acceptor wax block;
7) with the feed velocity of 20 microns/commentaries on classics the tissue array piece is repaired wax stone with full-automatic histotome, the core of organizing until 80% exposes to the open air fully;
8) the tissue array piece is cut into slices with the feed velocity of 4 microns/commentaries on classics with full-automatic histotome, section is mounted on the import microslide that is attached to anti-flake processing;
9) array slice places 60 ℃ of constant temperature roasters to bake sheet 16h;
10) organization chip whenever extracts one at a distance from 10 by numbering and does HE dyeing;
11) pathologist is carried out the further consultation quality inspection to each tissue samples in the sampling observation organization chip, and the result is by information portion input organization chip database;
12) organization chip is tested white sheet and is kept in the section box, places 4 ℃ of reefers of refrigerator to preserve.
The SABC method, experimental procedure is following:
1) 92 ℃ of baking oven bakings of organization chip 30min; Wet box is temperature in advance;
2) insert two cylinders, 100% xylene dewaxing (temperature in advance), 37 ℃ of each 20min successively;
3) each 10min of rinsing in 100%, 95%, 80%, 70% alcohol, PBS rinsing 5min;
4) join 3%H at present
2O
2Incubated at room 10min in the-methanol solution, PBS rinsing 5min * 3 times;
5) heating/microwave antigen retrieval 5min * 2 time: with chip insert boiling antigen retrieval liquid (the 0.01M sodium citrate buffer solution, pH=6.0) in, put into micro-wave oven again and heat, keeping antigen retrieval liquid is about 90 ℃, can not seethe with excitement; Naturally cool to room temperature, distillation washing, PBS rinsing 5min;
6) inhale coring sheet surrounding liquid, (10% sheep serum-PBS) sealing places 37 ℃ of wet boxes to hatch 25min to drip confining liquid; Inhale deblocking liquid, do not wash;
7) add pIgR antibody (Santa Cruz) 4 ℃ of incubated overnight (1: 300); PBS rinsing 3min * 3 times;
8) add two of horseradish peroxidase-labeled and resist (instants), 37 ℃ of wet boxes are hatched 1h, PBS rinsing 3min * 3 times;
9) add DAB normal temperature colour developing (brown) 1-3min, mirror is the control developing time down, distilled water rinsing, PBS rinsing 5min;
10) haematoxylin is redyed 2min, and mirror is the control dyeing time down; The distillation washing, PBS rinsing 5min, air-dry, the neutral gum mounting, microscopically is observed;
All chip dyeing are all carried out under the same conditions, and positive control, blank are all established in every batch of dyeing; Positive control carries out with the liver cancer tissue of known stained positive, and the result is positive; Blank resists with the serum replacement one that is equivalent to an anti-concentration hatches histotomy, and the result is negative.
The result observes: do not know that by 2 the doctor of pathology department of patient's clinical setting observes the organization chip of HE dyeing and immunohistochemical staining, adopts double-blind study respectively to same chip interpretation.Mark according to endochylema staining power and area.
Data analysis:
Use SPSS16.0 software analysis gained data, one-way analysis of variance comparative group differences; The difference of positive rate is relatively used Chi-square Test or the accurate probabilistic method of Fisher, and survival rate adopts the Kaplan-Meier method to calculate, relatively the checking with Log-rank of difference life cycle.Influence each variable of postoperative prognosis with the assessment of Cox proportional hazard model.P＜0.05, difference has conspicuousness.
2, experimental result
The inventor utilizes immunohistochemistry technique in earlier stage; Detected the expression of pIgR albumen in the 254 routine liver cancer paraffin sections; The result shows; 2 years relapse and metastasis rates of pIgR high expressed group postoperative are significantly higher than the low expression group (Fig. 1) of pIgR, and the pIgR high expressed is the independent hazard factor (seeing the following form 1) of 2 years relapse and metastasis of liver cancer patient.Then we have analyzed the relation between the different clinical pathologic characteristics with HCC of pIgR expression; The result shows, the pIgR high expressed especially has significant meaning (Fig. 2) to the indication of 2 years relapse and metastasis rates of liver cancer patient in early stage (no cancer embolus, tumour single-shot, the tumour knurl directly less than 5cm or TNM=I time) that liver cancer takes place.
Table 1.pIgR high expressed is the independent hazard factor of 2 years relapse and metastasis of liver cancer patient
Embodiment 2:pIgR expresses the influence that the epithelium mesenchyma is transformed
1, experimental technique
The structure of various pIgR expression cell lines:
With pcDNA3.1 empty carrier plasmid (Invitrogen) and pcDNA3.1-pIgR plasmid (Finn-Eirik doctor Johansen present) difference transfection dog renal epithelial cell mdck cell (ATCC); After the transfection 48 hours; Add neomycin G418 screening, obtain positive cell strain---MDCK-mock and MDCK-pIgR with resistance.
The inventor is according to the sequence of interference fragment principle of design and pIgR, and design is also got rid of the sequence that has homology with other genes of genome through Blast software, obtains three desirable interference fragment template target sequences:
Template sequence 2,5 '-ACGUCGACCGAGUUUCAAUCAG-3 ';
Template sequence 3,5 '-AGAAGAGUUUGUUGCCACCACU-3 '.
To above-mentioned template target sequence, according to the instructions of Ambion, generation has the shRNA interference fragment of hairpin structure, and is cloned in the pSilencer2.1-U6 carrier.
With MDCK-pIgR cell difference three interference plasmids of transfection and negative control plasmid, called after shRNA1, shRNA2, shRNA3 and con.shRNA.Transfection adds puromycin puro after 48 hours screens, positive cell strain---the MDCK-pIgR that acquisition has resistance, MDCK-pIgR-shRNA1, MDCK-pIgR-shRNA2, MDCK-pIgR-shRNA3, MDCK-pIgR-con.shRNA.
With pBABE-puro empty carrier plasmid (Addgene) and pBABE-puro-pIgR plasmid (molecular biology conventional method clone makes up and obtains) transfection HCC SMMC-7721 cell (biochemical cell institute cell bank) respectively; After the transfection 48 hours; Add puromycin puro screening, obtain positive cell strain---SMMC-7721 and SMMC-7721-pIgR with resistance.
(1) influence of pIgR pair cell form
Above-mentioned dog renal epithelial cell MDCK and HCC SMMC-7721 series engineering make up pIgR expression cell line [MDCK series: empty carrier control group (MDCK-mock), pIgR high expressed group (MDCK-pIgR), interference control group (MDCK-pIgR-con.shRNA), pIgR interference group (MDCK-pIgR-shRNA1, MDCK-pIgR-shRNA2, MDCK-pIgR-shRNA3); SMMC-7721 series: empty carrier control group (SMMC-7721-mock), pIgR high expressed group (SMMC-7721-pIgR)], be inoculated in 12 orifice plates, spend the night, after cell attachment stretches, the observation by light microscope cellular morphology.
(2) pIgR is to the influence (immune marking method, western blot) of epithelial cell mesenchyma marker molecule
Above-mentioned dog renal epithelial cell MDCK and HCC SMMC-7721 series engineering make up pIgR expression cell line [MDCK series: empty carrier control group (MDCK-mock), pIgR high expressed group (MDCK-pIgR), interference control group (MDCK-pIgR-con.shRNA), pIgR interference group (MDCK-pIgR-shRNA1, MDCK-pIgR-shRNA2, MDCK-pIgR-shRNA3); SMMC-7721 series: empty carrier control group (SMMC-7721-mock), pIgR high expressed group (SMMC-7721-pIgR)], be inoculated in 12 orifice plates, after degrees of fusion reaches 80%; Collecting cell is washed once with cold PBS (containing the 1mM sodium vanadate), adds 1 * sds gel sample-loading buffer (50mMTris-HCl (pH 6.8); 100mM DTT, 2%SDS, 10% glycerine; The 1mM sodium vanadate, 0.1% bromophenol blue) cell lysis.Cell lysate heats 10 minutes in boiling water bath after, in centrifugal 10 minutes of 4 ℃ of 12000rpm.
Get supernatant and carry out the SDS-PAGE electrophoresis; After electrophoresis finishes; With half-dried electrotransfer system albumen is transferred to nitrocellulose filter (Amersham Life Sciences; Arlington Heights; IL USA), places confining liquid (5% skimmed milk power is diluted in the TBS/T that contains the 1mM sodium vanadate) room temperature sealing 1 hour with nitrocellulose filter; Place in anti-pIgR antibody (Santa Cruz, article No.: sc-51694, sc-20487, sc-20485 or sc-20656) or anti-E-cadherin antibody (BD) or anti-Pan-cytokeratin antibody (Sigma) or anti-Vimentin antibody (Abcam) or anti-Fibronectin antibody (Abcam) or the anti-GAPDH antibody (kangchen) 4 ℃ of sealings to spend the night film then.With the TBS/T washing that contains the 1mM sodium vanadate three times, each 15 minutes.Film was placed two anti-(1: 2000) solution room temperature reactions 1-2 hour.The same wash film three times after, with ECL reagent color development, compressing tablet develops.
(3) influence of pIgR pair cell locomitivity
Above-mentioned dog renal epithelial cell MDCK and HCC SMMC-7721 series engineering make up pIgR expression cell line [MDCK series: empty carrier control group (MDCK-mock), pIgR high expressed group (MDCK-pIgR), interference control group (MDCK-pIgR con.shRNA), pIgR interference group (MDCK-pIgR shRNA1, MDCK-pIgR shRNA2, MDCK-pIgR shRNA3); SMMC-7721 series: empty carrier control group (SMMC-7721-mock), pIgR high expressed group (SMMC-7721-pIgR)], be inoculated in 24 orifice plates.When treating that cell grows to the monolayer of one deck densification, get one 200 μ L rifle heads, in every hole, mark one cut, and change nutrient solution into fresh serum-free RPMI-1640 nutrient solution (Invitrogen).Take pictures respectively at 0,3,6,9 hour, compare.Use Zeiss LSM Image Browser software statistics, every figure gets 3 minimum distances, average, and the computation migration distance.Do histogram and do t check computational statistics difference.##p＜0.01, ###p＜0.001, mock group vs.pIgR group; * p＜0.05, * * p＜0.01, * * * p＜0.001, interference group vs.NC group.
2, experimental result
Experimental result is as shown in Figure 3; High expressed pIgR can promote cell by the transformation of epithelium form to the mesenchyma form in dog renal epithelial cell MDCK and HCC SMMC-7721, and cell is dispersed in growth, follows the change of the significant molecule of corresponding EMT simultaneously; Be epithelium marker molecule E-cadherin, Pan-cytokeratin down-regulated expression; And mesenchyma marker molecule Vimentin and Fibronectin up-regulated, in addition, the locomitivity of cell significantly strengthens behind the high expressed pIgR.Especially after it should be noted that in the MDCK-pIgR cell expression with the stable pIgR of interference of shRNA, comparatively obvious variation takes place in cellular morphology, reverts to the paving stone appearance epithelium form of rule, and cell is grown in flakes; Follow the reverse of the significant molecule of corresponding EMT and weakening of locomitivity simultaneously.The above results shows that the expression of pIgR and EMT vicious transformation are closely related, and the pIgR high expressed promotes the cell movement ability to strengthen through inducing EMT to transform.
Embodiment 3:pIgR expresses the influence to experimental lung metastasis
1, experimental technique
SPF level severe combined immunodeficiency (SCID) mouse, in 4～6 ages in week, body weight 16～20 grams are provided by Chinese Academy of Sciences's Shanghai Experimental Animal Center.Nude mouse is raised under no special pathogen condition, and illumination substituted once in per 12 hours, and feed and water can use after sterilization.All experiments all strictly observe animal feeding and use ethical standard.
MDCK series pIgR expression cell line experimental lung metastasis ability is relatively: animal is divided into 4 groups at random, empty carrier control group (MDCK-mock), pIgR high expressed group (MDCK-pIgR), disturbs every group each 5 of control group (MDCK-pIgR con.shRNA), pIgR interference groups (MDCK-pIgR shRNA3).After will digesting according to the cell (MDCK-mock, MDCK-pIgR, MDCK-pIgR con.shRNA, MDCK-pIgR shRNA3) of the preparation of the method among the embodiment 2 respectively, be diluted to concentration 2.5 * 10 with PBS
6Individual/200 μ L, get 200 μ L cell suspensions and go into respectively to organize in the SCID mouse body through tail vein injection.Mouse are put to death in 10 week backs, get lung, and lung tissue was fixed in 4% paraformaldehyde more than 24 hours, and the total metastatic nodules under dissecting microscope on 5 lobes of the lung of each lung of observational record is done histogram and done t check computational statistics difference.#p＜0.05, ##p＜0.01, mock group vs.pIgR group; * p＜0.05, interference group vs. disturbs control group.
SMMC-7721 series pIgR expression cell line experimental lung metastasis ability compares: animal is divided into 2 groups at random, every group each 5 of empty carrier control group (SMMC-7721-mock), pIgR high expressed groups (SMMC-7721-pIgR).After will digesting according to the cell (SMMC-7721-mock, SMMC-7721-pIgR) of the preparation of the method among the embodiment 2, be diluted to concentration 1 * 10 with PBS
6Individual/200 μ L, get 200 μ L cell suspensions and go into respectively to organize in the SCID mouse body through tail vein injection.Mouse are put to death in 10 week backs, get lung, and lung tissue was fixed in 4% paraformaldehyde more than 24 hours, and the total metastatic nodules under dissecting microscope on 5 lobes of the lung of each lung of observational record is done histogram and done t check computational statistics difference.#p＜0.05, mock group vs.pIgR group.
2, experimental result
PIgR high expressed SMMC-7721 cell and mdck cell are inoculated in severe combined immunodeficiency (SCID) mouse; Can cause that the high obvious lung that changes cell shifts; (Fig. 4 Fig. 5), shows that pIgR has in vivo promoted the transfer of tumour cell and pIgR interference group mouse lung MET digital display work descends.
Embodiment 4:pIgR induces EMT vicious transformation functional section to confirm
1, experimental technique
The inventor is a template with pcDNA3.1-pIgR plasmid (Finn-Eirik doctor Johansen present); According to the molecular biology conventional method, pIgR (662-735) expression plasmid and pIgR (680-735) expression plasmid [pcDNA3.1-pIgR (662-735) and pcDNA3.1-pIgR (680-735)] have been made up.
In 12 orifice plates, degrees of fusion reaches at 80% o'clock with MDCK or SMMC-7721 cell inoculation, adopts liposome method; Difference transfection pcDNA3.1 empty carrier plasmid, pcDNA3.1-pIgR expression plasmid, pcDNA3.1-pIgR (662-735) expression plasmid and pcDNA3.1-pIgR (680-735) expression plasmid, after 48 hours, collecting cell; Wash once with cold PBS (containing the 1mM sodium vanadate), add 1 * sds gel sample-loading buffer (50mM Tris-HCl (pH 6.8), 100mM DTT; 2%SDS; 10% glycerine, 1mM sodium vanadate, 0.1% bromophenol blue) cell lysis.Cell lysate heats 10 minutes in boiling water bath after, in centrifugal 10 minutes of 4 ℃ of 12000rpm.
Get supernatant and carry out the SDS-PAGE electrophoresis; After electrophoresis finishes; With half-dried electrotransfer system albumen is transferred to nitrocellulose filter (Amersham Life Sciences; Arlington Heights, IL, USA); Nitrocellulose filter is placed confining liquid (5% skimmed milk power is diluted in the TBS/T that contains the 1mM sodium vanadate) room temperature sealing 1 hour, place anti-E-cadherin antibody (BD) or anti-Pan-cytokeratin antibody (Sigma) or anti-Vimentin antibody (Abcam) or anti-Fibronectin antibody (Abcam) or 4 ℃ of sealings of anti-GAPDH antibody (kangchen) to spend the night film then.With the TBS/T washing that contains the 1mM sodium vanadate three times, each 15 minutes.Film was placed two anti-(1: 2000) solution room temperature reactions 1-2 hour.The same wash film three times after, with ECL reagent color development, compressing tablet develops.
2, experimental result
The result is as shown in Figure 6; The expression of last 662-735 section of pIgR or 680-735 section protein sequence just can promote epithelium marker molecule E-cadherin, Pan-cytokeratin downward modulation; And mesenchyma marker molecule Vimentin and Fibronectin up-regulated; Similar with total length pIgR expression effect, show that pIgR goes up the 662-735 section or 680-735 section albumen territory plays a significant role in the EMT vicious transformation that pIgR induces.
Embodiment 5: high expressed pIgR is to the influence of EMT vicious transformation in the primary cell of different genera, different tissue sources and cell line
1, experimental technique
HCC BEL-7402 (biochemical cell institute cell bank), liver cell LO2 (biochemical cell institute cell bank), lung carcinoma cell H1650 (ATCC), Human umbilical vein endothelial cells HUVEC (ATCC) and MEC MEF (ATCC) are inoculated in 12 orifice plates respectively, and degrees of fusion reaches at 80% o'clock, adopts liposome method; Difference transfection pcDNA3.1 empty carrier plasmid (Invitrogen), pcDNA3.1-pIgR expression plasmid (Finn-Eirik doctor Johansen present); After 48 hours, collecting cell is washed once with cold PBS (containing the 1mM sodium vanadate); Add 1 * sds gel sample-loading buffer (50mM Tris-HCl (pH 6.8); 100mM DTT, 2%SDS, 10% glycerine; The 1mM sodium vanadate, 0.1% bromophenol blue) cell lysis.Cell lysate heats 10 minutes in boiling water bath after, in centrifugal 10 minutes of 4 ℃ of 12000rpm.
Get supernatant and carry out the SDS-PAGE electrophoresis; After electrophoresis finishes; With half-dried electrotransfer system albumen is transferred to nitrocellulose filter (Amersham Life Sciences; Arlington Heights; IL USA), places confining liquid (5% skimmed milk power is diluted in the TBS/T that contains the 1mM sodium vanadate) room temperature sealing 1 hour with nitrocellulose filter; Place in anti-pIgR antibody (Santa Cruz, article No.: sc-51694, sc-20487, sc-20485 or sc-20656) or anti-E-cadherin antibody (BD) or anti-Pan-cytokeratin antibody (Sigma) or anti-Vimentin antibody (Abcam) or the anti-GAPDH antibody (kangchen) 4 ℃ of sealings to spend the night film then.With the TBS/T washing that contains the 1mM sodium vanadate three times, each 15 minutes.Film was placed two anti-(1: 2000) solution room temperature reactions 1-2 hour.The same wash film three times after, with ECL reagent color development, compressing tablet develops.
2, experimental result
The result is as shown in Figure 7; High expressed pIgR all can cause the generation of EMT in HCC BEL-7402, liver cell LO2, lung carcinoma cell H1650, Human umbilical vein endothelial cells HUVEC and MEC MEF, shows that it is a general character phenomenon that pIgR induces EMT to transform.
Claims (13)
1. be used for diagnosing or predict the purposes of diagnosticum of recurrence and/or the transfer of tumour in preparation to the antibody of polymeric immunoglobulin receptor (pIgR) albumen.
2. purposes according to claim 1, wherein, said to the white antibody of antibody choosing of pIgR albumen, to the antibody of pIgR intracellular region with in the antibody of pIgR extracellular region to the pIgR full-length proteins.
3. purposes according to claim 2, wherein, said antibody to pIgR albumen is the antibody to the pIgR intracellular region.
4. purposes according to claim 2, wherein, said antibody to pIgR albumen is the antibody of going up 662-735 section or 680-735 section albumen to pIgR.
5. purposes according to claim 1; Wherein, Said tumour is selected from liver cancer, colorectal cancer, prostate cancer, cancer of the stomach, lung cancer, breast cancer, cancer of pancreas, cervical carcinoma, kidney, carcinoma of urinary bladder, oophoroma, glioma, melanoma, incidence cancer, cholangiocarcinoma, nasopharyngeal carcinoma and the thyroid cancer; Preferably, said tumour is liver cancer, colorectal cancer, prostate cancer, cancer of the stomach or lung cancer.
6. the material that makes polymeric immunoglobulin receptor (pIgR) protein expression downward modulation is used for preventing and/or treating the purposes of medicine of recurrence and/or the transfer of tumour in preparation.
7. make the material of 662-735 section or the 680-735 section protein expression downward modulation of polymeric immunoglobulin receptor (pIgR) albumen be used for preventing and/or treating the purposes of medicine of recurrence and/or the transfer of tumour in preparation.
8. according to claim 6 or 7 described purposes; Wherein, The material of the said pIgR of making albumen or its 662-735 section or the downward modulation of 680-735 section protein expression is the expression vector of antisense oligonucleotide or RNA interference fragment or the stable RNA of generation interference fragment; The expression vector of said antisense oligonucleotide or RNA interference fragment or the stable RNA of generation interference fragment is to be directed against pIgR to go up the strand of 662-735 section or the design of 680-735 section albumen or the double-stranded nucleotide fragments with the expression of this section of target sequence; Maybe can stablize the expression vector that produces nucleotide fragments with above-mentioned characteristic; Preferably, said antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment comprise the sequence of target continuous 13～24 nucleotide sequences in 5 '-AGAGCCCGGCACAGGAAGAACGUCGACCGAGUUUCAAUCAGAAGCUACAGGACAGA CAUUAGCAUGUCAGACUUCGAGAACUCCAGGGAAUUUGGAGCCAAUGACAACAUGG GAGCCUCUUCGAUCACUCAGGAGACAUCCCUCGGAGGAAAAGAAGAGUUUGUUGCC ACCACUGAGAGCACCACAGAGACCAAAGAACCCAAGAAGGCAAAAAGGUCAUCC-3 '.
9. purposes according to claim 8, wherein, said antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment, the template sequence that target is directed against is following:
Template sequence 1,5 '-AGAACGUCGACCGAGUUUCAAU-3 ';
Template sequence 2,5 '-ACGUCGACCGAGUUUCAAUCAG-3 '; Or
Template sequence 3,5 '-AGAAGAGUUUGUUGCCACCACU-3 '.
10. according to claim 6 or 7 described purposes; Wherein, Said tumour is selected from liver cancer, colorectal cancer, prostate cancer, cancer of the stomach, lung cancer, breast cancer, cancer of pancreas, cervical carcinoma, kidney, carcinoma of urinary bladder, oophoroma, glioma, melanoma, incidence cancer, cholangiocarcinoma, nasopharyngeal carcinoma, the thyroid cancer; Preferably, said tumour is liver cancer, colorectal cancer, prostate cancer, cancer of the stomach or lung cancer.
11. polymeric immunoglobulin receptor (pIgR) is as the purposes of the pharmaceutical intervention target spot of diagnosis or the early stage recurrence of prediction tumour and/or molecular marker that shifts and/or anti metastasis.
12. antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment; The expression vector of said antisense oligonucleotide or RNA interference fragment or the stable RNA of generation interference fragment is to be directed against pIgR to go up the strand of 662-735 section or the design of 680-735 section albumen or the double-stranded nucleotide fragments with the expression of this section of target sequence; Maybe can stablize the expression vector that produces nucleotide fragments with above-mentioned characteristic; Preferably, said antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment comprise the sequence of target continuous 13～24 nucleotide sequences in 5 '-AGAGCCCGGCACAGGAAGAACGUCGACCGAGUUUCAAUCAGAAGCUACAGGACAGA CAUUAGCAUGUCAGACUUCGAGAACUCCAGGGAAUUUGGAGCCAAUGACAACAUGG GAGCCUCUUCGAUCACUCAGGAGACAUCCCUCGGAGGAAAAGAAGAGUUUGUUGCC ACCACUGAGAGCACCACAGAGACCAAAGAACCCAAGAAGGCAAAAAGGUCAUCC-3 '.
13. antisense oligonucleotide according to claim 12 or RNA interference fragment or the stable expression vector that produces the RNA interference fragment; Wherein, Said antisense oligonucleotide or RNA interference fragment or the stable expression vector that produces the RNA interference fragment, the template sequence that target is directed against is following:
Template sequence 1,5 '-AGAACGUCGACCGAGUUUCAAU-3 ';
Template sequence 2,5 '-ACGUCGACCGAGUUUCAAUCAG-3 '; Or
Template sequence 3,5 '-AGAAGAGUUUGUUGCCACCACU-3 '.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101740368A CN102841200A (en) | 2011-06-24 | 2011-06-24 | Use of pIgR as molecular marker of early recurrence and/or metastasis of tumor and intervening target spot of anti-tumor metastasizing medicine |
| PCT/CN2012/076031 WO2012174970A1 (en) | 2011-06-24 | 2012-05-25 | Use of pigr as molecular marker in early recurrence and/or metastasis of tumours and intervention target for anti-metastatic drugs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101740368A CN102841200A (en) | 2011-06-24 | 2011-06-24 | Use of pIgR as molecular marker of early recurrence and/or metastasis of tumor and intervening target spot of anti-tumor metastasizing medicine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102841200A true CN102841200A (en) | 2012-12-26 |
Family
ID=47368751
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011101740368A Pending CN102841200A (en) | 2011-06-24 | 2011-06-24 | Use of pIgR as molecular marker of early recurrence and/or metastasis of tumor and intervening target spot of anti-tumor metastasizing medicine |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN102841200A (en) |
| WO (1) | WO2012174970A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811531A (en) * | 2017-02-28 | 2017-06-09 | 北京泱深生物信息技术有限公司 | Dendritic cell diagnosis and treatment mark |
| CN114088939A (en) * | 2021-11-19 | 2022-02-25 | 中国人民解放军陆军军医大学第一附属医院 | Molecular marker for diagnosis of primary biliary cholangitis and application thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9213029B2 (en) * | 2013-06-25 | 2015-12-15 | Samsung Electronics Co., Ltd. | Method for diagnosing breast cancer by detection of polymeric immunoglobulin receptor in vesicles isolated from patients |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006039678A2 (en) * | 2004-09-29 | 2006-04-13 | Central Institue For Experimental Animals | Establishment of highly metastatic cell lines using nog mice |
| CN1968716A (en) * | 2003-01-09 | 2007-05-23 | 阿里泽克药品公司 | Methods of treating lung diseases |
| US20070172857A1 (en) * | 2005-12-28 | 2007-07-26 | Sysmex Corporation | Primer and method for detecting lymph node metastasis |
-
2011
- 2011-06-24 CN CN2011101740368A patent/CN102841200A/en active Pending
-
2012
- 2012-05-25 WO PCT/CN2012/076031 patent/WO2012174970A1/en active Application Filing
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1968716A (en) * | 2003-01-09 | 2007-05-23 | 阿里泽克药品公司 | Methods of treating lung diseases |
| WO2006039678A2 (en) * | 2004-09-29 | 2006-04-13 | Central Institue For Experimental Animals | Establishment of highly metastatic cell lines using nog mice |
| WO2006039671A2 (en) * | 2004-09-29 | 2006-04-13 | Central Institute For Experimental Animals | Gene markers of tumor metastasis |
| US20070172857A1 (en) * | 2005-12-28 | 2007-07-26 | Sysmex Corporation | Primer and method for detecting lymph node metastasis |
Non-Patent Citations (6)
| Title |
|---|
| FRANK BRUYERE,M.D.,ET AL: "Snail expression is an independent predictor of tumor recurrence in superficial bladder cancers", 《UROLOGIC ONCOLOGY:SEMINARS AND ORIGINAL INVESTIGATIONS》, vol. 28, 31 December 2010 (2010-12-31) * |
| MORRIS SHERMAN,ET AL: "Recurrence of Heptocellular Carcinoma", 《THE NEW ENGLAND JOURNAL OF MEDICINE》, vol. 359, no. 19, 6 November 2008 (2008-11-06) * |
| SUSAN E. MOODY,ET AL: "The transcriptional repressor Snail promotes mammary tumor recurrence", 《CANCER CELL》, vol. 8, 30 September 2005 (2005-09-30) * |
| 唐庆娟等: "多聚免疫球蛋白受体(pIgR)在粘膜免疫中的重要功能", 《中国生物化学与分子生物学报》, vol. 23, no. 09, 20 September 2007 (2007-09-20), pages 724 - 729 * |
| 徐思云: "人多聚免疫球蛋白受体pIgR介导EMT的作用研究及机制初探", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》, no. 02, 15 February 2009 (2009-02-15) * |
| 李敏等: "肺泡灌洗液中多聚免疫球蛋白受体分泌片段测定的临床意义", 《癌变.畸变.突变》, vol. 20, no. 05, 30 September 2008 (2008-09-30) * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811531A (en) * | 2017-02-28 | 2017-06-09 | 北京泱深生物信息技术有限公司 | Dendritic cell diagnosis and treatment mark |
| CN106811531B (en) * | 2017-02-28 | 2020-03-31 | 青岛泱深生物医药有限公司 | Tongue squamous carcinoma diagnosis and treatment marker |
| CN114088939A (en) * | 2021-11-19 | 2022-02-25 | 中国人民解放军陆军军医大学第一附属医院 | Molecular marker for diagnosis of primary biliary cholangitis and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2012174970A1 (en) | 2012-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Han et al. | Fibronectin regulates anoikis resistance via cell aggregate formation | |
| Dong et al. | FOXO1 inhibits the invasion and metastasis of hepatocellular carcinoma by reversing ZEB2-induced epithelial-mesenchymal transition | |
| Salnikov et al. | Hypoxia induces EMT in low and highly aggressive pancreatic tumor cells but only cells with cancer stem cell characteristics acquire pronounced migratory potential | |
| Zhong et al. | TIPE regulates VEGFR2 expression and promotes angiogenesis in colorectal cancer | |
| Mihic-Probst et al. | Tumor cell plasticity and angiogenesis in human melanomas | |
| Wu et al. | The role of XBP1s in the metastasis and prognosis of hepatocellular carcinoma | |
| orević et al. | Hypoxia inducible factor-1α correlates with vascular endothelial growth factor A and C indicating worse prognosis in clear cell renal cell carcinoma | |
| Li et al. | CD105 promotes hepatocarcinoma cell invasion and metastasis through VEGF | |
| Fei et al. | Formation of polyploid giant cancer cells involves in the prognostic value of neoadjuvant chemoradiation in locally advanced rectal cancer | |
| Ueno et al. | Chloride intracellular channel protein 2 in cancer and non-cancer human tissues: relationship with tight junctions | |
| Li et al. | PBX3 is associated with proliferation and poor prognosis in patients with cervical cancer | |
| CN105368853A (en) | Marker related to auxiliary diagnosis of non-small cell lung cancer and application thereof | |
| Oltedal et al. | Expression profiling and intracellular localization studies of the novel Proline-, Histidine-, and Glycine-rich protein 1 suggest an essential role in gastro-intestinal epithelium and a potential clinical application in colorectal cancer diagnostics | |
| Yoshida et al. | Spheroid cultures of primary urothelial cancer cells: cancer tissue-originated spheroid (CTOS) method | |
| Kong et al. | miR-431-5p alters the epithelial-to-mesenchymal transition markers by targeting UROC28 in hepatoma cells | |
| Gamba et al. | The relationship between E-cadherin and its transcriptional repressors in spontaneously arising canine invasive micropapillary mammary carcinoma | |
| Roy et al. | ARID3B increases ovarian tumor burden and is associated with a cancer stem cell gene signature | |
| Lv et al. | Silencing of Prrx2 inhibits the invasion and metastasis of breast cancer both in vitro and in vivo by reversing epithelial-mesenchymal transition | |
| Bai et al. | RNF128 promotes malignant behaviors via EGFR/MEK/ERK pathway in hepatocellular carcinoma | |
| CN102841200A (en) | Use of pIgR as molecular marker of early recurrence and/or metastasis of tumor and intervening target spot of anti-tumor metastasizing medicine | |
| Pan et al. | LINC00667 promotes progression of esophageal cancer cells by regulating miR-200b-3p/SLC2A3 axis | |
| Sedassari et al. | Increased SOX2 expression in salivary gland carcinoma ex pleomorphic adenoma progression: an association with adverse outcome | |
| Dziuba et al. | Homotypic entosis as a potential novel diagnostic marker in breast cancer | |
| Liu et al. | Promoting roles of long non-coding RNA FAM83H-AS1 in bladder cancer growth, metastasis, and angiogenesis through the c-Myc-mediated ULK3 upregulation | |
| Lin et al. | Up-regulation and worse prognostic marker of cytoplasmic TARBP2 expression in obstinate breast cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20121226 |