CN102803509B

CN102803509B - For the method treating, diagnose and monitoring lupus

Info

Publication number: CN102803509B
Application number: CN201080055282.5A
Authority: CN
Inventors: T·W·伯伦斯; R·R·格拉姆
Original assignee: F Hoffmann La Roche AG
Current assignee: F Hoffmann La Roche AG
Priority date: 2009-10-07
Filing date: 2010-10-06
Publication date: 2016-12-14
Anticipated expiration: 2030-10-06

Abstract

Provide discriminating, the method diagnosing and predicting lupus, including the sub-phenotype (subpehnotype) of some lupus, and the method providing treatment lupus, including some subgroups of patient.The method provided is based on one group of allele relevant to systemic lupus erythematosus (sle) (SLE) risk genes seat, described risk genes seat includes that BLK, TNIP1, PRDM1, JAZF1, UHRF1BP1, IL1O, IFIH1, CFB, CEC16A, IL12B and SH2B3, described risk genes seat have effect to SLE risk.Additionally provide the method differentiating effective lupus therapeutic agent, and the method that prediction is to the response of lupus therapeutic agent.

Description

For the method treating, diagnose and monitoring lupus

Cross-Reference to Related Applications

This application claims that, in the priority of U.S. Provisional Application No. 61/278,510 that on October 7th, 2009 submits to, it leads to Cross incorporated to be incorporated into herein.

Sequence table

The application contains the sequence table submitted to by EFS-Web by ASCII fromat, is all incorporated into herein by quoting In.Described ASCII copy is created in JIUYUE in 2010 20, and entitled P4325R1W.txt, size is 57,896 bytes.

Field

Provide discriminating, the method diagnosing, predict and assessing the risk that lupus occurs, and the method for the treatment of lupus.Also Provide for differentiating effective lupus therapeutic agent and the prediction method to the response of lupus therapeutic agent.

Background

Lupus is autoimmune disease, it is estimated that its almost affect 1,000,000 Americans, mainly age 20-40 year it Between women.Lupus relates to the antibody attacking connective tissue.The principal mode of lupus is systemic lupus (systemic red yabbi Skin ulcer；SLE).SLE is that the chronic autoimmune disease with strong heredity and environment composition is (see such as Hochberg MC, Dubois ' Lupus Erythematosus. the 5th edition., Wallace DJ, Hahn BH, edits Baltimore:Williams and Wilkins (1997)；Wakeland EK etc., Immunity 2001；15 (3): 397-408；Nath SK etc., Curr.Opin.Immunol.2004；16 (6): 794-800；D ' Cruz etc., Lancet (2007), 369:587-596).Known The lupus of other forms multiple, includes but not limited to lupus erythematosus,cutaneous (CLE), lupus nephritis and neonatal period lupus.

Along with it advances to attack internal organs, including lung, heart and kidney (being primarily upon nephropathy), not from attack skin and joint The lupus for the treatment of can be lethal, so that suffer from the risk of lupus especially with Accurate Diagnosis lupus and/or assessment in early days Crucial.Lupus mainly shows as a series of outbreak (flare-up), has a small amount of disease phenomenon or the interval without disease phenomenon. By the injury of kidney of albuminuretic measurement in urine it is and one of the most sharp-pointed pathogenic relevant damage field in SLE, and Explain this disease at least 50% mortality rate and sickness rate.

Clinically, SLE is the heterogeneous obstacle being characterized as high-affinity autoantibody (autoAb) (heterogeneous disorder).Autoantibody plays a significant role in the pathogeny of SLE, and this disease is various Clinical picture is to be deposited in the blood vessel by the immune complex comprising antibody to cause the inflammation in kidney, brain and skin to cause.From Body antibody also has promotion hemolytic anemia and thrombocytopenic direct pathogenic effects.SLE and antinuclear antibody, circulation immunity are multiple The generation of compound is relevant with the activation of complement system.SLE has the sickness rate of about 1/700 in the women between 20 to 60 years old. SLE can affect any tract, it is possible to causes serious tissue injury.SLE exists there is not homospecificity in a large number Autoantibody.SLE patient generally produces has anti-DNA, anti-Ro and antiplatelet specificity, and can initiate facing of this disease Bed feature, such as self of glomerulonephritis, arthritis, oromeningitis, neonate CHB and hematological abnormality Antibody.These autoantibodys are also possible to relevant to central nervous system disorder.Arbuckle etc. describe autoantibody SLE's Appearance (Arbuckle etc. N.Engl.J.Med.349 (16): 1526-1533 (2003)) before clinical episodes.Lupus (includes SLE) it is not easy to make a definite diagnosis, causes doctor to take multiple-factor sign and sorting technique (Gill et al., American of based on symptom Family Physician 68 (11): 2179-2186 (2003)).

In the clinical management of complicated autoimmune disease (such as lupus), a maximum difficult problem is the most accurately Early Identification disease.In recent years, have been carried out the research of many strains and candidate gene, authenticated and SLE susceptibility is had effect Genetic factor.Carry the haplotype of II class HLA allele D RB1*0301 and DRB1*1501 substantially with disease and core oneself The antibody of body antigen exists relevant.See for example, Goldberg MA et al., Arthritis Rheum.19 (2): 129-32 (1976)；Graham RR et al., Am J Hum Genet.71 (3): 543-53 (2002)；With Graham RR et al., Eur J HumGenet.15 (8): 823-30 (2007).Recently, it was found that as the interferon regulatory factor 5 of the notable risks and assumptions of SLE And the signal transducer transcribed and activate the variant of son 4 (STAT) (IRF5).See for example, Sigurdsson S et al., Am J Hum Genet.76 (3): 528-37 (2005)；Graham RR et al., Nat Genet.38 (5): 550-55 (2006)； Graham RR et al., Proc Natl Acad SciUSA 104 (16): 6758-63 (2007)；With Remmers EF et al., N Engl J Med.357 (10): 977-86 (2007).Differentiate that IRF5 and STAT4 is that such concept carries as SLE risk genes Supplied support, i.e. in some cases, I type interferon (IFN) path SLE disease pathogenic in play important angle Color.I type IFN is present in the serum of SLE case, and producing of IFN is relevant to the existence of the immune complex comprising Ab and nucleic acid (summary is in Ronnblom et al., J Exp Med 194:F59 (2001)；Referring further to Baechler EC et al., Curr Opin Immunol.16 (6): 801-07 (2004)；Banchereau J et al., Immunity25 (3): 383-92 (2006)；Miyagi Et al., J Exp Med 204 (10): 2383-96 (2007)).Most SLE case all shows significantly in hemocyte I type IFN gene expression " is signed " (Baechler et al., Proc Natl Acad Sci USA 100:2610 (2003)； Bennett et al., J Exp Med 197:711 (2003)), and there is the IFN inducible cell factor and the chemotactic factor of rising Serum levels (Bauer et al., PLoSMed 3:e491 (2006)).Immune complex containing n DNA and RNA stimulates tree Toll-sample receptor (TLR) 7 and 9 that Dendritic Cells and B cell are expressed, produces I type interferon, and the further immune stimulatory of the latter is multiple Compound forms (summary is in Marshak-Rothstein et al., Annu Rev Immunol 25,419 (2007)).

Additionally, had been carried out multinomial research, differentiate the reliable biomarker for diagnosis and omen purpose.But, Not yet identify any clinical diagnostic marker (such as, biomarker) confirmed, enable doctor or other people accurately The definition pathophysiology aspect of SLE, clinical activity, treatment responds or occurs the risk of disease, although authenticated many Individual it is considered candidate gene contributive to SLE susceptibility and allele (variant).Such as, it has been reported at least 13 commonly Allele the SLE risk that European descent is individual is had effect (Kyogoku et al., Am J Hum Genet75 (3): 504-7 (2004)；Sigurdsson et al., Am J Hum Genet 76 (3): 528-37 (2005)；Graham et al., Nat Genet 38 (5): 550-55 (2006)；Graham et al., Proc Natl Acad Sci U S A 104 (16): 6758-63 (2007)； Remmers et al., N Engl J Med357 (10): 977-86 (2007)；Cunninghame Graham et al., Nat Genet 40 (1): 83-89 (2008)；Harley et al., Nat Genet 40 (2): 204-10 (2008)；Hom et al., N Engl J Med358 (9): 900-9 (2008)；Kozyrev et al., Nat Genet 40 (2): 211-6 (2008)；Nath et al., Nat Genet 40 (2): 152-4 (2008)；Sawalha et al., PLoS ONE 3 (3): e1727 (2008)).It is inferred as cause effect relation Allele known have HLA-DR3, HLA-DR2, FCGR2A, PTPN22, ITGAM and BANK1 (Kyogoku et al., Am J Hum Genet 75 (3): 504-7 (2004)；Kozyrev et al., Nat Genet 40 (2): 211-6 (2008)；Nath et al., Nat Genet40 (2): 152-4 (2008)), and the risk unit type of IRF5, TNFSF4 and BLK may by affect mRNA and Protein expression level and (Sigurdsson et al., Am J Hum Genet 76 (3): 528-37 that SLE is worked (2005)；Graham et al., Nat Genet 38 (5): 550-55 (2006)；Graham et al., Proc Natl Acad Sci U S A 104 (16): 6758-63 (2007)；Cunninghame Graham et al., Nat Genet 40 (1): 83-89 (2008)；Hom et al., N EnglJ Med 358 (9): 900-9 (2008)).STAT4, KIAA1542, IRAK1, PXK and other The cause and effect allele of gene (such as BLK) not yet determines (Remmers et al., N Engl J Med357 (10): 977-86 (2007)；Harley et al., Nat Genet 40 (2): 204-10 (2008)；Hom et al., N Engl J Med 358 (9): 900-9(2008)；Sawalha et al., PLoS ONE 3 (3): e1727 (2008)).The something lost that these and other is relevant to lupus The change of disease is different to be also described in international patent application no PCT/US2008/064430 (international publication number WO 2008/144761).Though So these hereditary variatioies have significant contribution, but still needs to SLE risk and the various aspects of disease described up to now Determine about the hereditary variation more information to the effect of the notable Clinical heterogeneity of such as SLE.

Therefore, it is very favorable for having other diagnostic methods based on molecule, and described diagnostic method can be used for objectively Differentiate the existence of disease in patient and/or classification disease, the definition pathophysiology aspect of lupus, clinical activity, to treatment Response, prognosis, and/or the risk of lupus occurs.Additionally, that there are the various clinics with disease and/or pathophysiology and/ Or the diagnostic marker based on molecule that other biological indicant is correlated with is favourable.Thus, to differentiate with lupus and its There is lasting demand in novel risk locus and polymorphism that his autoimmune disease is relevant.This type of dependency is conducive to greatly Differentiate the existence of lupus in patient or determine the susceptibility that disease occurs.This type of dependency also helps and differentiates that the pathology of lupus is raw Aspect of science, clinical activity, response to treatment, or prognosis.Additionally, the statistics relevant to this type of dependency and biology show Work property and repeatably information can be used as the ingredient differentiating in the work of particular patient subgroup, and the expection of described patient subgroups will Significantly benefit from the treatment of particular therapeutic agent, such as treat in this type of specific lupus patient subgroup benefited therapeutic agent or Show the therapeutic agent that treatment is benefited in clinical studies.

Invention described herein meets above-mentioned requirements, and provides other benefits.

All references cited herein is including patent application and publication, all the most complete by quoting Literary composition is incorporated into herein.

General introduction

Method provided herein is at least part of to be found based on this point, and i.e. one group relevant to SLE and cause disease risks Novel gene seat (SLE risk genes seat).Further it is provided that the one group allele relevant to these SLE risk genes seats. Further comprises the cause and effect allele in the BLK locus relevant to the biological effect increasing SLE risk.Further it is provided that The risk genes seat relevant to the SLE risk of other autoimmune diseases and increase.

In one aspect, it is provided that the method differentiating lupus in object, method is included in and is derived from the biology of object and imitates Detecting the existence of variation in SLE risk genes seat in product, wherein SLE risk genes seat is BLK, wherein the change in BLK locus Different generation is on the nucleotide position corresponding with the position of single nucleotide polymorphism (SNP), and wherein SNP is rs922483 (SEQ ID NO:13), wherein variation is the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes people, and wherein object is suspected Suffers from lupus.In one embodiment, detection includes carrying out measuring selected from primer extension；Allele-specific primers extends Measure；Allele-specific nucleotide mixes and measures；Allele specific oligonucleotide hybridization assays；5 ' nucleases are surveyed Fixed；The mensuration of application molecular beacon；The method in measuring is connected with oligonucleotide.

In yet another aspect, it is provided that the method differentiating lupus in object, method is included in the biology being derived from object The existence of variation in detection at least one SLE risk genes seat described in table 4 in sample, wherein at least one locus Variation occurs on the nucleotide position corresponding with the position of the SNP of at least one locus described in table 4, and wherein object Suspect suffer from lupus.In certain embodiments, at least two locus or at least three locus or at least four base Because seat or at least five locus or at least ten locus or at least 13 locus or 26 locus detect Variation.In one embodiment, at least one locus is selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.One In individual embodiment, the variation of at least one locus includes the SNP described in table 4.In certain embodiments, detect at table (wherein, the variation at least one locus occurs in the existence of variation at least one the SLE risk genes seat described in 4 On the nucleotide position corresponding with the SNP position of at least one locus described in table 4) become in BLK SLE risk genes seat (wherein the variation in BLK locus occurs on the nucleotide position corresponding with the position of SNP, and wherein SNP is in different existence Rs922483 (SEQ ID NO:13), wherein variation is the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes people) Combination.In one embodiment, detection includes carrying out measuring selected from primer extension；Allele-specific primers extends to be surveyed Fixed；Allele-specific nucleotide mixes and measures；Allele specific oligonucleotide hybridization assays；5 ' nucleases measure； The mensuration of application molecular beacon；The method in measuring is connected with oligonucleotide.

In still another embodiment, it is provided that the method differentiating lupus in object, method be included in be derived from right The existence of variation in detection at least one SLE risk genes seat described in table 6 in the biological sample of elephant, wherein at least one Variation in locus occurs on the nucleotide position corresponding with the position of the SNP of at least one locus described in table 6, and And wherein object suspects suffer from lupus.In certain embodiments, at least two locus or at least three locus or At least four locus or five locus detect variation.In one embodiment, at least one locus is selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.In one embodiment, the variation at least one locus includes table 6 Described SNP.In certain embodiments, the existence of variation at least one the SLE risk genes seat described in table 6 is detected (wherein the variation at least one locus occurs at the core corresponding with the SNP position of at least one locus described in table 6 On thuja acid position) with BLK SLE risk genes seat in variation existence (wherein in BLK locus variation occur with SNP's On the nucleotide position that position is corresponding, wherein SNP is rs922483 (SEQ ID NO:13), and wherein variation is No. 8 dyes people The thymus pyrimidine of the chromosome of colour solid 11389322) combination.In one embodiment, detection includes carrying out prolonging selected from primer Stretch mensuration；Allele-specific primers extends mensuration；Allele-specific nucleotide mixes and measures；Allele-specific Oligonucleotide hybridization measures；5 ' nucleases measure；The mensuration of application molecular beacon；The method in measuring is connected with oligonucleotide.

At still another aspect, it is provided that the method differentiating lupus in object, method is included in the life being derived from object Thing imitates in product at least one described in the existence of variation at least one the SLE risk genes seat described in detection table 4 and table 6 The existence of the variation in SLE risk genes seat, wherein the variation in each locus be respectively occurring at described in table 4 and table 6 Nucleotide position corresponding to the SNP position of each locus on, and wherein object suspects suffer from lupus.In some embodiment In, at least three locus or at least four locus or at least five locus or at least 7 locus or at least 10 Individual locus detects variation.In one embodiment, at least one locus described in table 4 selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10, and at least one locus described in table 6 selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.In one embodiment, the variation at least one locus described in table 4 and at least one gene described in table 6 Variation in Zuo includes the SNP described in table 4 and table 6 respectively.In certain embodiments, at least one described in table 4 is detected In SLE risk genes seat variation existence (wherein at least one locus variation occur with at least described in table 4 On the nucleotide position that the SNP position of individual locus is corresponding), and variation at least one the SLE risk genes seat described in table 6 (wherein the variation at least one locus occurs corresponding with the SNP position of at least one locus described in table 6 in existence Nucleotide position on), with BLK SLE risk genes seat in variation existence combination (wherein, the variation in BLK locus is sent out Raw on the nucleotide position corresponding with SNP position, wherein SNP is rs922483 (SEQ ID NO:13), wherein variation be The thymus pyrimidine of the chromosome of No. 8 chromosomes of people 11389322).In one embodiment, detection includes being selected from Primer extension measures；Allele-specific primers extends mensuration；Allele-specific nucleotide mixes and measures；Allele Specific oligonucleotide hybridization assays；5 ' nucleases measure；The mensuration of application molecular beacon；Connect with oligonucleotide in measuring Method.

In one aspect, it is provided that the object of the lupus method to the response of lupus therapeutic agent is suffered from prediction, and method includes Determining whether object includes variation at SLE risk genes seat, wherein SLE risk genes seat is BLK, wherein in BLK locus Variation occur on the nucleotide position corresponding with SNP position, wherein SNP is rs922483 (SEQ ID NO:13), wherein Variation is the thymus pyrimidine of the chromosome 11389322 of No. 82 chromosomes people, wherein becomes in BLK SLE risk genes seat Different existence represents the object response to therapeutic agent.

In yet another aspect, it is provided that the object of the lupus method to the response of lupus therapeutic agent, method bag are suffered from prediction Include and determine whether object includes variation at least one the SLE risk genes seat described in table 4, wherein at least one locus In variation occur on the nucleotide position corresponding with the SNP position of at least one locus described in table 4, wherein at least In one locus, variation exists and represents the object response to therapeutic agent.In certain embodiments, object is at least two Locus or at least three locus or at least four locus or at least five locus or at least ten locus or At least 13 locus or 26 locus include variation.In one embodiment, at least one locus is selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.In one embodiment, the variation at least one locus includes SNP described in table 4.In certain embodiments, method includes determining whether object is included at least one SLE described in table 4 Variation in risk genes seat (wherein the variation at least one locus occur with at least one gene described in table 4 On the nucleotide position corresponding to SNP position of seat), with the variation in BLK SLE risk genes seat (wherein in BLK locus Variation occurs on the nucleotide position corresponding with SNP position, and wherein SNP is rs922483 (SEQ ID NO:13), Qi Zhongbian The thymus pyrimidine of the different chromosome 11389322 being No. 8 chromosomes people) combination, wherein at least one base described in table 4 Because in the existence made a variation in seat and BLK locus, the existence of variation represents the object response to therapeutic agent.

At still another aspect, it is provided that the object of the lupus method to the response of lupus therapeutic agent, side are suffered from prediction Method includes determining whether object includes variation at least one the SLE risk genes seat described in table 6, wherein at least one base Because the variation in seat occurs on the nucleotide position corresponding with the SNP position of at least one locus described in table 6, Qi Zhong In at least one locus, the existence of variation represents the object response to therapeutic agent.In certain embodiments, object is extremely Lack two locus or at least three locus or at least four locus or five locus include variation.A reality Executing in scheme, at least one locus is selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.In one embodiment, extremely Variation in a few locus includes the SNP described in table 6.In certain embodiments, method includes determining whether object wraps (wherein the variation at least one locus occurs to include the variation at least one the SLE risk genes seat described in table 6 On the nucleotide position corresponding with the SNP position of at least one locus described in table 6), and in BLK SLE risk genes seat (wherein the variation in BLK locus occurs on the nucleotide position corresponding with SNP position, and wherein SNP is rs922483 in variation (SEQ ID NO:13), wherein variation is the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes people) combination, its In the existence made a variation at least one locus described in middle table 6 and BLK locus, the existence of variation represents that object is to therapeutic agent Response.

In other respects, it is provided that the object of the lupus method to the response of lupus therapeutic agent is suffered from prediction, and method includes Determine at least one the SLE risk genes seat described in table 4, whether object includes that variation is (wherein at least one locus Variation occur on the nucleotide position corresponding with the SNP position of at least one locus described in table 4), and in table 6 institute At least one the SLE risk genes seat stated include variation (wherein the variation at least one locus occur with table 6 institute On the nucleotide position that the SNP position of at least one locus stated is corresponding), wherein at least one locus described in table 4 Existence and the existence made a variation at least one locus described in table 6 of middle variation represent the object response to therapeutic agent. In certain embodiments, object is at least three locus or at least four locus or at least five locus or extremely Few 7 locus or at least ten locus include variation.In one embodiment, at least one gene described in table 4 Seat selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10, at least one locus described in table 6 selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.In one embodiment, the variation at least one locus described in table 4 and table 6 institute Variation at least one locus stated includes the SNP described in table 4 and table 6 respectively.In certain embodiments, method includes Determine whether object is included in the variation at least one the SLE risk genes seat described in table 4 (wherein at least one locus In variation occur on the nucleotide position corresponding with the SNP position of at least one locus described in table 4), with in table 6 institute Variation at least one the SLE risk genes seat stated (wherein the variation at least one locus occur with described in table 6 Nucleotide position corresponding to the SNP position of at least one locus on), and variation (its in BLK SLE risk genes seat Variation in middle BLK locus occurs on the nucleotide position corresponding with SNP position, and wherein SNP is rs922483 (SEQ ID NO:13), wherein variation is the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes people) combination, wherein described in table 4 At least one locus in variation existence and table 6 described at least one locus in variation existence and BLK gene In Zuo, the existence of variation represents the object response to therapeutic agent.

At still another aspect, it is provided that the method diagnosing in object or predicting lupus, method be included in be derived from right Detecting the existence of variation in SLE risk genes seat in the biological sample of elephant, wherein SLE risk genes seat is BLK, wherein BLK In locus variation occur on the nucleotide position corresponding with SNP position, wherein SNP be rs922483 (SEQ ID NO: 13), wherein variation is the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes people, and makes a variation in BLK locus Existence be the diagnosis of lupus or the prediction of object.

At still another aspect, it is provided that the method diagnosing in object or predicting lupus, method be included in be derived from right The biological sample of elephant detects the existence of variation at least one the SLE risk genes seat described in table 4, wherein: biology Sample is known or suspects the nucleic acid including variation at least one the SLE risk genes seat comprised described in table 4；At least one Variation in individual locus includes SNP described in table 4 or is positioned on the nucleotide position corresponding for SNP with described in table 4；And at least In one locus, the existence of variation is diagnosis or the prediction of the lupus of object.In certain embodiments, at least two base Because of seat or at least three locus or at least four locus or at least five locus or at least ten locus or extremely Few 13 locus or 26 locus detect variation.In one embodiment, at least one SLE risk genes seat Selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.In certain embodiments, method includes that detection is described in table 4 The existence of variation at least one SLE risk genes seat, and combine with the existence of variation in BLKSLE risk genes seat, its In: biological sample is known or suspection includes the variation at least one the SLE risk genes seat comprised described in table 4 and BLK The nucleic acid of the variation in locus, the variation at least one locus described in table 4 include SNP described in table 4 or be positioned at On the nucleotide position that SNP described in table 4 is corresponding, and the variation in BLK locus occurs at the nucleotide corresponding with SNP position On position, wherein SNP is rs922483 (SEQ ID NO:13), and wherein variation is the chromosome of No. 8 chromosomes people The thymus pyrimidine of 11389322, and at least one locus described in table 4 variation existence and in BLK locus The existence of variation is diagnosis or the prediction of lupus in object.

At still another aspect, it is provided that the method diagnosing in object or predicting lupus, method be included in be derived from right The biological sample of elephant detects the existence of variation at least one the SLE risk genes seat described in table 6, wherein: biology Sample is known or suspects the nucleic acid including variation at least one the SLE risk genes seat comprised described in table 6；At least one Variation in individual locus includes SNP described in table 6 or is positioned on the nucleotide position corresponding for SNP with described in table 6；And at least In one locus, the existence of variation is diagnosis or the prediction of the lupus of object.In certain embodiments, at least two base Because seat or at least three locus or at least four locus or five locus detect variation.An embodiment party In case, at least one SLE risk genes seat is selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.In some embodiment In, method include detection at least one the SLE risk genes seat described in table 6 variation existence, and with BLK SLE risk The existence combination of variation in locus, wherein: biological sample is known or suspection includes at least one comprised described in table 6 Variation in SLE risk genes seat and the nucleic acid of the variation in BLK locus, at least one locus described in table 6 Variation includes SNP described in table 6 or is positioned on the nucleotide position corresponding for SNP with described in table 6, and the variation in BLK locus Occurring on the nucleotide position corresponding with SNP position, wherein SNP is rs922483 (SEQ ID NO:13), and wherein variation is At the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes of people, and become at least one locus described in table 6 Different existence and the existence made a variation in BLK locus are diagnosis or the predictions of the lupus of object.

At still another aspect, it is provided that the method diagnosing in object or predicting lupus, method be included in be derived from right The biological sample of elephant detects the existence of variation at least one the SLE risk genes seat described in table 4 and described in table 6 The existence of variation at least one SLE risk genes seat, wherein: biological sample is known or suspection includes: comprise described in table 4 At least one SLE risk genes seat in variation and the core of variation at least one SLE risk genes seat described in table 6 Acid；Variation at least one locus includes table 4 and SNP described in table 6 respectively or is positioned at corresponding with SNP described in table 4 and table 6 Nucleotide position on；And at least one locus described in table 4 variation existence and at least one described in table 6 In locus, the existence of variation is diagnosis or the prediction of the lupus of object.In certain embodiments, at least three locus, Or at least four locus or at least five locus or at least seven locus or at least ten locus detect change Different.In one embodiment, at least one the SLE risk genes seat described in table 4 selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10, at least one the SLE risk genes seat described in table 6 selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.In certain embodiments, method include detection at least one the SLE risk genes seat described in table 4 variation deposit , and the existence of variation at least one the SLE risk genes seat described in table 6, and become in BLKSLE risk genes seat Different existence combination, wherein: biological sample is known or suspection includes: comprise at least one the SLE risk genes described in table 4 Variation in variation in Zuo and at least one the SLE risk genes seat described in table 6 and the nucleic acid of the variation in BLK locus, Variation at least one locus described in table 4 includes SNP described in table 4 or is positioned at the nucleotide corresponding for SNP with described in table 4 On position, and the variation at least one locus described in table 6 includes SNP described in table 6 or is positioned at and SNP described in table 6 On corresponding nucleotide position, and the variation in BLK locus occurs on the nucleotide position corresponding with SNP position, Wherein SNP is rs922483 (SEQ ID NO:13), and wherein variation is the chromosome 11389322 of No. 8 chromosomes people Thymus pyrimidine, and at least one locus described in table 4 variation existence and at least one locus described in table 6 The existence of middle variation, and the existence of variation is diagnosis or the prediction of the lupus of object in BLK locus.

In yet another aspect, it is provided that in object assisted diagnosis or prediction lupus method, method be included in be derived from right Detecting the existence of variation in SLE risk genes seat in the biological sample of elephant, wherein SLE risk genes seat is BLK, wherein BLK In locus variation occur on the nucleotide position corresponding with SNP position, wherein SNP be rs922483 (SEQ ID NO: 13), wherein variation is the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes people, and makes a variation in BLK locus Existence be the diagnosis of lupus or the prediction of object.

At still another aspect, it is provided that assisted diagnosis or the method for prediction lupus in object, method is included in source The existence of variation at least one the SLE risk genes seat described in table 4 is detected, wherein: raw in the biological sample of object The thing product that imitate are known or suspect the nucleic acid including variation at least one the SLE risk genes seat comprised described in table 4；Extremely Variation in a few locus includes SNP described in table 4 or is positioned on the nucleotide position corresponding for SNP with described in table 4；And In at least one locus, the existence of variation is diagnosis or the prediction of the lupus of object.In certain embodiments, at least two Individual locus or at least three locus or at least four locus or at least five locus or at least ten locus, Or at least 13 locus or 26 locus detect variation.In one embodiment, at least one SLE risk base Because seat is selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.In certain embodiments, method includes that detection is in table 4 institute In at least one the SLE risk genes seat stated variation existence, and with BLK SLE risk genes seat in variation existence group Close, wherein: biological sample is known or suspection includes the variation at least one the SLE risk genes seat comprised described in table 4 With the nucleic acid of the variation in BLK locus, the variation at least one locus described in table 4 includes SNP or position described in table 4 On the nucleotide position corresponding for SNP with described in table 4, and the variation in BLK locus occurs at the core corresponding with SNP position On thuja acid position, wherein SNP is rs922483 (SEQ ID NO:13), and wherein variation is the chromosome of No. 8 chromosomes people The thymus pyrimidine of 11389322, and at least one locus described in table 4 variation existence and in BLK locus The existence of variation is diagnosis or the prediction of lupus in object.

At still another aspect, it is provided that assisted diagnosis or the method for prediction lupus in object, method is included in source The existence of variation at least one the SLE risk genes seat described in table 6 is detected, wherein: raw in the biological sample of object The thing product that imitate are known or suspect the nucleic acid including variation at least one the SLE risk genes seat comprised described in table 6；Extremely Variation in a few locus includes SNP described in table 6 or is positioned on the nucleotide position corresponding for SNP with described in table 6；And In at least one locus, the existence of variation is diagnosis or the prediction of the lupus of object.In certain embodiments, at least two Individual locus or at least three locus or at least four locus or five locus detect variation.A reality Executing in scheme, at least one SLE risk genes seat is selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.Some embodiment party In case, method include detection at least one the SLE risk genes seat described in table 6 variation existence, and with BLK SLE wind The existence combination of variation in the locus of danger, wherein: biological sample is known or suspection includes at least one comprised described in table 6 Variation in SLE risk genes seat and the nucleic acid of the variation in BLK locus, at least one locus described in table 6 Variation includes SNP described in table 6 or is positioned on the nucleotide position corresponding for SNP with described in table 6, and the variation in BLK locus Occurring on the nucleotide position corresponding with SNP position, wherein SNP is rs922483 (SEQ ID NO:13), and wherein variation is At the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes of people, and become at least one locus described in table 6 Different existence and the existence made a variation in BLK locus are diagnosis or the predictions of the lupus of object.

At still another aspect, it is provided that assisted diagnosis or the method for prediction lupus in object, method is included in source The existence of variation at least one the SLE risk genes seat described in table 4 is detected and in table 6 institute in the biological sample of object The existence of variation at least one the SLE risk genes seat stated, wherein: biological sample is known or suspection includes: comprise table 4 Variation in the described variation at least one SLE risk genes seat and at least one the SLE risk genes seat described in table 6 Nucleic acid；Variation at least one locus includes SNP described in table 4 and table 6 respectively or is positioned at and described in table 4 and table 6 SNP pair On the nucleotide position answered；And at least one locus described in table 4 variation existence and at least described in table 6 In individual locus, the existence of variation is diagnosis or the prediction of the lupus of object.In certain embodiments, at least three gene Seat or at least four locus or at least five locus or at least seven locus or at least ten locus detect To variation.In one embodiment, at least one the SLE risk genes seat described in table 4 selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10, at least one the SLE risk genes seat described in table 6 selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.In certain embodiments, method include detection at least one the SLE risk genes seat described in table 4 variation deposit , and the existence of variation at least one the SLE risk genes seat described in table 6, and become in BLKSLE risk genes seat Different existence combination, wherein: biological sample is known or suspection includes: comprise at least one the SLE risk genes described in table 4 Variation in variation in Zuo and at least one the SLE risk genes seat described in table 6 and the nucleic acid of the variation in BLK locus, Variation at least one locus described in table 4 includes SNP described in table 4 or is positioned at the nucleotide corresponding for SNP with described in table 4 On position, and the variation at least one locus described in table 6 includes SNP described in table 6 or is positioned at and SNP described in table 6 On corresponding nucleotide position, and the variation in BLK locus occurs on the nucleotide position corresponding with SNP position, Wherein SNP is rs922483 (SEQ ID NO:13), and wherein variation is the chromosome 11389322 of No. 8 chromosomes people Thymus pyrimidine, and at least one locus described in table 4 variation existence and at least one locus described in table 6 The existence of middle variation, and the existence of variation is diagnosis or the prediction of the lupus of object in BLK locus.

In one aspect, it is provided that the method for the lupus disease for the treatment of target, it is known that hereditary variation be present in On nucleotide position corresponding for SNP in SLE risk genes seat, wherein SNP is rs922483 (SEQ ID NO:13), and SLE Risk genes seat is BLK, and wherein variation is the thymus pyrimidine of chromosome 11389322 of No. 8 chromosomes people, method bag Include and use effective sanatory therapeutic agent to object.

In yet another aspect, it is provided that the method for the lupus disease for the treatment of target, it is known that the hereditary variation in described object Exist on the nucleotide position corresponding for SNP with described in table 4 at least one the SLE risk genes seat described in table 4, method bag Include to the object effective therapeutic agent of administering therapeutic disease.In one embodiment, at least one SLE risk genes seat is selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.

In yet another aspect, it is provided that the method for the lupus disease for the treatment of target, it is known that the hereditary variation in described object Exist on the nucleotide position corresponding for SNP with described in table 6 at least one the SLE risk genes seat described in table 6, method bag Include to the object effective therapeutic agent of administering therapeutic disease.In one embodiment, at least one SLE risk genes seat is selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.

In yet another aspect, it is provided that treatment has the method for object of lupus disease, method include being applied in object right As the middle effective therapeutic agent for the treatment of disease, described object is having on corresponding for the SNP nucleotide position in SLE risk genes seat Having hereditary variation, wherein SNP is rs922483 (SEQ ID NO:13), and SLE risk genes seat is BLK, wherein variation be The thymus pyrimidine of the chromosome of No. 8 chromosomes of people 11389322.

In yet another aspect, it is provided that treatment has the method for object of lupus disease, method include being applied in object right As the middle effective therapeutic agent for the treatment of disease, described object at least one the SLE risk genes seat described in table 4 with table 4 institute State, on nucleotide position corresponding to SNP, there is hereditary variation.In one embodiment, at least one SLE risk genes seat choosing From TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.

In yet another aspect, it is provided that treatment has the method for object of lupus disease, method include being applied in object right As the middle effective therapeutic agent for the treatment of disease, described object at least one the SLE risk genes seat described in table 6 with table 6 institute State, on nucleotide position corresponding to SNP, there is hereditary variation.In one embodiment, at least one SLE risk genes seat choosing From IFIH1, CFB, CLEC16A, IL12B and SH2B3.

At still another aspect, it is provided that treatment has the method for the object of lupus disease, and method includes using to object The therapeutic agent effectively treating described disease, therapeutic agent quilt described in wherein said research is shown at least one clinical research Be administered at least 5 human subjects, each leisure of described object with on corresponding for the SNP nucleotide position in SLE risk genes seat Having hereditary variation, wherein SNP is rs922483 (SEQ ID NO:13), and SLE risk genes seat is BLK, and wherein variation is The thymus pyrimidine of chromosome 11389322 at No. 8 chromosomes of people.

At still another aspect, it is provided that treatment has the method for the object of lupus disease, and method includes using to object The therapeutic agent effectively treating described disease, therapeutic agent quilt described in wherein said research is shown at least one clinical research It is administered at least 5 human subjects, each leisure of described object and table 4 institute at least one the SLE risk genes seat described in table 4 State, on nucleotide position corresponding to SNP, there is hereditary variation.In one embodiment, at least one SLE risk genes seat choosing From TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.

At still another aspect, it is provided that treatment has the method for the object of lupus disease, and method includes using to object The therapeutic agent effectively treating described disease, therapeutic agent quilt described in wherein said research is shown at least one clinical research It is administered at least 5 human subjects, each leisure of described object and table 6 institute at least one the SLE risk genes seat described in table 6 State, on nucleotide position corresponding to SNP, there is hereditary variation.In one embodiment, at least one SLE risk genes seat choosing From IFIH1, CFB, CLEC16A, IL12B and SH2B3.

In yet another aspect, it is provided that the method including preparing lupus therapeutic agent, execute with to object including packaging therapeutic agent By the description of therapeutic agent, described object suffers from or is thought suffering from lupus, and corresponding with the SNP in SLE risk genes seat Position there is hereditary variation, wherein SNP is rs922483 (SEQ ID NO:13), and SLE risk genes seat is BLK, Qi Zhongbian The thymus pyrimidine of the different chromosome 11389322 being No. 8 chromosomes people.

At still another aspect, it is provided that include prepare lupus therapeutic agent method, including packaging therapeutic agent with to right As the description of administering therapeutic agent, described object suffers from or is thought suffering from lupus, and with at least one SLE described in table 4 Position corresponding for SNP described in table 4 in risk genes seat has hereditary variation.

At still another aspect, it is provided that include prepare lupus therapeutic agent method, including packaging therapeutic agent with to right As the description of administering therapeutic agent, described object suffers from or is thought suffering from lupus, and with at least one SLE described in table 6 Position corresponding for SNP described in table 6 in risk genes seat has hereditary variation.

In one aspect, it is provided that select for the method with the patient suffering from lupus of lupus therapeutic agent treats, method Including detection in the existence with corresponding for the SNP nucleotide position hereditary variation in SLE risk genes seat, wherein SNP is Rs922483 (SEQ ID NO:13), and SLE risk genes seat is BLK, wherein variation is the chromosome of No. 8 chromosomes people The thymus pyrimidine of 11389322.In one embodiment, detection includes carrying out measuring selected from primer extension；Allele is special Specific primer extends mensuration；Allele-specific nucleotide mixes and measures；Allele specific oligonucleotide hybridization assays； 5 ' nucleases measure；The mensuration of application molecular beacon；Method for measuring is connected with oligonucleotide.

In other respects, it is provided that select for the method with the patient suffering from lupus of lupus therapeutic agent treats, method Lose at the nucleotide position corresponding for SNP with described in the table 4 at least one the SLE risk genes seat described in table 4 including detection The existence that the change of disease is different.In certain embodiments, at least two locus or at least three locus or at least four base Because seat or at least five locus or at least ten locus or at least 13 locus or 26 locus detect Variation.In one embodiment, at least one SLE risk genes seat selected from TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.In one embodiment, the variation at least one locus includes the SNP described in table 4.An embodiment In, detection includes carrying out measuring selected from primer extension；Allele-specific primers extends mensuration；Allele-specific nucleoside Acid mixes and measures；Allele specific oligonucleotide hybridization assays；5 ' nucleases measure；The mensuration of application molecular beacon；With Oligonucleotide connects method for measuring.

In other respects, it is provided that select for the method with the patient suffering from lupus of lupus therapeutic agent treats, method Lose at the nucleotide position corresponding for SNP with described in the table 6 at least one the SLE risk genes seat described in table 6 including detection The existence that the change of disease is different.In certain embodiments, at least two locus or at least three locus or at least four base Because seat or five locus detect variation.In one embodiment, at least one SLE risk genes seat is selected from IFIH1, CFB, CLEC16A, IL12B and SH2B3.In one embodiment, the variation at least one locus includes table 6 Described SNP.In one embodiment, detection includes carrying out measuring selected from primer extension；Allele-specific primers prolongs Stretch mensuration；Allele-specific nucleotide mixes and measures；Allele specific oligonucleotide hybridization assays；5 ' nucleases are surveyed Fixed；The mensuration of application molecular beacon；Method for measuring is connected with oligonucleotide.

In yet another aspect, it is provided that whether evaluation object is in the method for risk lupus occur, method be included in from In the biological sample that object obtains, detection indicates the genetic tags (genetic signature) of risk lupus occur Existing, wherein said genetic tags includes one group of at least three SNP, and each SNP betides the SLE wind described in table 4 and/or table 6 In the locus of danger.In certain embodiments, genetic tags includes one group of at least 4 SNP or at least 5 SNP or at least 7 SNP or at least 10 SNP.In some embodiments, SLE risk genes seat selected from TNIP1, PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B and SH2B3.In certain embodiments, genetic tags also includes SNP in SLE risk genes seat, wherein SNP is rs922483 (SEQ ID NO:13), and SLE risk genes seat is BLK, its Middle variation is the thymus pyrimidine of the chromosome 11389322 of No. 8 chromosomes people.

In yet another aspect, it is provided that the method for lupus in diagnosis object, method is included in and obtains from described object The existence of the genetic tags of detection instruction lupus in biological sample, wherein said genetic tags includes one group of at least three SNP, Each SNP betides in the SLE risk genes seat described in table 4 and/or table 6.In certain embodiments, genetic tags includes one Organize at least 4 SNP or at least 5 SNP or at least 7 SNP or at least 10 SNP or at least 15 SNP or at least 20 SNP or at least 30 SNP.In one embodiment, SLE risk genes seat selected from TNIP1, PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B and SH2B3.In certain embodiments, genetic tags also includes SNP in SLE risk genes seat, wherein SNP is rs922483 (SEQ ID NO:13), and SLE risk genes seat is BLK, its Middle variation is the thymus pyrimidine of the chromosome 11389322 of No. 8 chromosomes people.

Brief description

Fig. 1 shows that the targeting of some SNP replicates the experimental design overview of research, with differentiate described in embodiment 1 other SLE risk genes seat.

Fig. 2 shows the notable association of the new full-length genome in SLE, and differentiate the TNIP1 (A) described in embodiment 1, New risk genes seat in PRDM1 (B), JAZF1 (C), UHRF1BP1 (D) and IL10 (E).(F) situation described in embodiment 1 and The P value histogram of the independent SNP of comparison repeat samples；Dotted line represents the expected results density that zero plants.

Fig. 3 shows in the original GWAS described in embodiment 1, analyzes (meta-by the meta-of P value layering Analysis) candidate (P ＜ 1x10 is reached in^-5) and checking (P ＜ 5x10^-8) the variant percentage ratio of state.

Fig. 4 shows the linkage disequilibrium block (linkage in the BLK promoter region described in embodiment 2 disequilibrium block；It is shown as r²).Fig. 4 discloses ' and C ＞ T-rs922483 ' is SEQ ID NO:13.

Fig. 5 shows as described in Example 2, has the luciferase reporter gene of the BLK promoter region of various haplotype Express the result measured.(A) in bjab cell, SNP rs922483C ＞ T (SEQ ID NO:13)；(B) at Daudi cell In, SNP rs922483C ＞ T (SEQ ID NO:13)；(C) in bjab cell, SNP rs1382568A ＞ C/G ＞ C；(D) In Daudi cell, SNP rs1382568A ＞ C/G ＞ C；(E) in bjab cell, SNP rs4840568G ＞ A；(F) exist In Daudi cell, SNP rs4840568G ＞ A；Shown data represent the meansigma methods +/-meansigma methods of three replications Standard error；Point bar shows the result being marked on the haplotype on the left of figure；Hatched bar: risk unit type 22-ACT；Empty bar: Devoid of risk haplotype 22-GAC；* p ＜ 0.05, * * p ＜ 0.01, * * * p ＜ 0.001, ns=are without significance (t inspection). Fig. 5 A-F discloses ' 22 (GT) to be repeated ' it is SEQ ID NO:15.Fig. 5 C-F also discloses that ' rs922483C ＞ T ' is SEQ ID NO:13.

Fig. 6 shows as described in Example 2, has 18 (GT) and repeats (SEQ ID NO:14) or 22 (GT) repetition (SEQ ID NO:15) and the luciferase reporting base of BLK promoter region of SNP rs1382568A ＞ C/G ＞ C in Daudi cell Because expressing the result measured.Shown data represent the standard error of the meansigma methods +/-meansigma methods of twice replication；Ns= Without significance (t inspection).It is SEQ ID NO that Fig. 6 disclose ' 18 (GT) to repeat ' be SEQ ID NO:14, ' 22 (GT) repeat ': 15, and " rs922483C ＞ T " be SEQ ID NO:13.

Fig. 7 shows the sequence of SNP, rs922483 (SEQ ID NO:13), and BLK locus as described in Example 2 The allelic SNP of cause and effect in position.Cause and effect allelic position runic bracket shows；Runic table is used in C/T variation Show.

Detailed Description Of The Invention

Unless otherwise, the present invention implement the conventional molecular biological utilized in art technology (is included restructuring Technology), microbiology, cytobiology, biochemistry and immunological technique.Such as " Molecular Cloning:A Laboratory Manual ", the second edition (Sambrook etc., 1989)；“Oligonucleotide Synthesis” (M.J.Grait edits, 1984)；" Animal Cell Culture " (R.I.Freshney edits, 1987)；“Methods in Enzymology " (Academic Press, Inc.)；“Current Protocols in Molecular Biology” (F.M.Ausubel etc. edit, 1987 and regular update)；" PCR:The Polymerase Chain Reaction ", The document of (Mullis etc. edit, 1994) fully explains this kind of technology.Furthermore, it is possible to use standard technique known in the art Produce for the primer of the present invention, oligonucleotide and polynucleotide.

Unless otherwise defined, technology used herein and scientific terminology have and ordinary skill of the art Personnel are generally understood that identical meaning.Such as, Singleton etc., Dictionary of Microbiology and The Molecular Biology second edition, J.Wiley & Sons (New York, N.Y.1994) and March, Advanced Organic Chemistry Reactions, Mechanisms and Structure fourth edition, John Wiley & Sons (New York, N.Y.1992) is the general guide that those skilled in the art provide the many terms in the application.

Definition

For the purpose of explanation this specification, applying following definition, time appropriate, the term used in the singular also includes Plural form, vice versa.As this specification and claims use, unless the context clearly indicates otherwise, single Number form formula (" a ", " an " and " the ") includes plural form.Thus, such as, the appellation of " protein " includes plural number protein； The appellation of " cell " includes the mixture of cell, etc..It is described below definition and passes through to quote be incorporated into herein any In the case of definition conflict in file, definition hereinafter described is suitable for.

" lupus " used herein or " lupus disease " is the autoimmune disease relating generally to attack the antibody of connective tissue Disease or obstacle.The principal mode of lupus is systemic lupus, systemic lupus erythematosus (sle) (SLE), and it includes skin SLE and subacute Skin SLE, and other kinds of lupus (include that nephritis, kidney be outer, encephalitis, department of pediatrics, non-kidney, plate-like and depilation).

Exchange the term " polynucleotide " of use herein or " nucleic acid " refers to the nucleotide polymer of random length, and include DNA and RNA.This nucleotide can be deoxyribonucleotide, ribonucleotide, modified nucleotide or base and/or they Analog, maybe can mix any substrate in polymer by DNA or RNA polymerase.Polynucleotide can comprise modification core Thuja acid, such as methylated nucleotide and their analog.If existing, to the modification of nucleotide structure can assemble polymer it Before or carry out afterwards.Nucleotide sequence can be interrupted by non-nucleotide components.Can after polymerization as by with labelling Composition is puted together and is modified polynucleotide further.Other kinds of modification includes, such as " cap "；One or many is replaced with analog Individual naturally occurring nucleotide；Between nucleotide modify, such as have uncharged key (such as methyl phosphonate, phosphotriester, Phosphamide, carbamate (cabamate) etc.) and there is charged key (such as thiophosphate, phosphorodithioate etc.) Those, comprise that of overhang such as protein (such as nuclease, toxin, antibody, signal peptide, poly-L-Lysine etc.) A bit, there are those of intercalator (such as acridine, psoralen etc.), containing chelating agen (such as metal, radioactive metal, boron, oxygen Change metal etc.) those, containing alkylating agent (alkylator) those, there is that of modifier keys (such as α different head nucleic acid etc.) A bit and the polynucleotide of unmodified form.Additionally, any hydroxyl being typically found in saccharide can such as pass through phosphate ester Base, phosphate replace, and are protected by standard protecting group, or activation is with other keys of preparation with other nucleotide, or permissible Put together with solid support.5 ' and 3 ' can be replaced with phosphorylation or by organic capping group part of amine or 1 to 20 carbon atom The OH of end.Other hydroxyls can also be derived as standard protecting group.Polynucleotide can also comprise the most known in the art The ribose of analog form or deoxyribose saccharide, it includes such as 2 '-O-methyl-2 '-O-pi-allyl, 2 '-fluoro-or 2 '- Azido-ribose, carba sugars, α-different head saccharide, epimerism saccharide such as arabinose, xylose or lyxose, pyrans Saccharide, furan saccharide, sedoheptulose, acyclic analog and without base nucleosides analog such as methyl nucleoside.Can be passed through other Linking group replaces one or more phosphodiester bond.These other linking groups include but not limited to wherein by P (O) S (" monothioester (thioate) "), P (S) S (" dithioesters (dithioate) "), (O) NR2 (" amidate "), P (O) P, P (O) OR ', CO or CH2 (" formacetal ") replace the embodiment of phosphoric acid, and wherein R or R ' is H independently or optionally comprises Substituted or non-substituted alkyl (1-20C), aryl, alkenyl, cycloalkyl, cycloalkenyl group or the araldyl of ether (--O--) key.Without All keys in polynucleotide are the most identical.Aforementioned it is applicable to all polynucleotide mentioned in this article, including RNA and DNA.

" oligonucleotide " used herein refers to that length is at least about 7 nucleotide and length less than about 250 nucleotide Short single stranded polynucleotide.Oligonucleotide can be synthesis.Term " oligonucleotide " and " polynucleotide " are the most mutually exclusive. Description to polynucleotide above is applicable to oligonucleotide comparably and fully.

Term " primer " refers to single stranded polynucleotide, and it can be with nucleic acid hybridization and general by providing freely 3 '-OH groups Allow the polymerization of complementary nucleic acid.

Term " hereditary variation " or " nucleotide diversity " refer in nucleotide sequence relative to reference sequences (the most common and/ Or wild-type sequence and/or the sequence of major allele) change (insertion of the most one or more nucleotide, lack, fall Position or replacement, such as single nucleotide polymorphism (SNP)).Unless otherwise, this term also includes the complementary sequence of this nucleotide sequence Change corresponding in row.In one embodiment, hereditary variation is somatic cell polymorphism.In one embodiment, heredity Variation is germline polymorphism.

" single nucleotide polymorphism " or " SNP " refers to the single base positions in DNA, on this position, and different equipotential bases Cause or other nucleotide are present in colony.Allelic sequences (the example of high conservative it is generally of before and after SNP position Sequence as different in the member less than 1/100 or 1/1000 of colony).For the allele on each SNP position, Individuality can be isozygoty or heterozygosis.

Term " amino acid variation " refers in aminoacid sequence relative to the change of reference sequences (the most one or more amino The insertion of acid, replace or lack, as inside lacks or N end or C end truncate).

Term " makes a variation " and refers to nucleotide diversity or amino acid variation.

Term " hereditary variation corresponding on the nucleotide position of SNP position ", " the nucleotide position corresponding to SNP position The nucleotide diversity put " and grammer variants refer in polynucleotide sequence the heredity change on relatively corresponding DNA position Different, this position is occupied by this SNP in genome.Unless otherwise indicated, this term also includes the complementary sequence of this nucleotide sequence Variation corresponding in row.

Term " array " or " microarray " refer to interfertile array element, preferred polynucleotide probe (such as oligonucleotide) Ordered arrangement on ground.This ground can be solid substrates, such as microscope slide, or semi-solid ground, such as nitrocellulose filter.

Term " expands " method referring to produce one or more copies of reference nucleic acid sequence or its complementary series.Amplification can To be linear amplification or exponential amplification (such as PCR)." copy " and be not meant as the perfect sequence relative to template sequence Complementarity or homogeneity.Such as, copy can comprise nucleotide analog, as deoxyinosine, have a mind to sequence change (as passed through Comprise and can change with the sequence that template hybridization but the primer of not fully complementary sequence introduce) and/or amplification procedure in occur Sequence errors.

Term " allele specific oligonucleotide oligonucleotide " refers to and the target nucleic acid district comprising nucleotide diversity (usually replacing) The oligonucleotide of territory hybridization." allele specific oligonucleotide hybridization " refers to make allele specific oligonucleotide oligonucleotide miscellaneous with its target nucleic acid During friendship, the polynucleotide ground in this allele specific oligonucleotide oligonucleotide and this nucleotide diversity base pairing.Can be right Specific nucleotide variation carries out the allele specific oligonucleotide oligonucleotide of allele specific oligonucleotide hybridization and is referred to as " special to this variation ".

Term " allele specific oligonucleotide primer " refers to allele specific oligonucleotide oligonucleotide, and it is primer.

Term " primer extension mensuration " refers to such mensuration, wherein adds in nucleic acid by nucleotide, produces directly or indirectly The longer nucleic acid of detection or " extension products ".Nucleotide can be added to extend 5 ' or 3 ' ends of this nucleic acid.

Term " allele specific oligonucleotide nucleotide mixes and measures " refers to that such primer extension measures, and wherein makes primer (a) Hybridize with target nucleic acid in the region being in nucleotide diversity 3 ' or 5 ', and (b) is by polymerase extension, thus will be with this nucleotide In the nucleotide incorporation extension products that variation is complementary.

Term " allele specific oligonucleotide primer extension mensuration " refers to that such primer extension measures, and wherein makes allele special Different primer hybridizes with target nucleic acid and extends.

Term " allele specific oligonucleotide oligonucleotide hybridization mensuration " refers to such mensuration, and wherein (a) makes allele special Different oligonucleotide hybridizes with target nucleic acid, and (b) directly or indirectly detects hybridization.

Term " 5 ' nucleases measure " refers to such mensuration, and the most allele specific oligonucleotide oligonucleotide is miscellaneous with target nucleic acid Hand over nucleolysis cutting (nucleolytic cleavage) allowing hybridization probe, produce detectable signal.

Term " mensuration of application molecular beacon " refers to such mensuration, the most allele specific oligonucleotide oligonucleotide and target nucleus The hybridization of acid produces detection signal level, and it is higher than the detection signal level launched by free oligonucleotide.

Term " oligonucleotide connects mensuration " refers to such mensuration, wherein makes allele specific oligonucleotide oligonucleotide and second Oligonucleotide is adjacent to each other on target nucleic acid hybridize and link together (directly or through interleaving nucleotide indirectly), and Directly or indirectly detect this connection product.

Term " target sequence ", " target nucleic acid " or " target nucleic acid sequence " refers generally to doubtful or known wherein comprises nucleotide diversity Polynucleotide of interest sequence, including the copy of this target nucleic acid produced by amplification.

Term " detects " and includes any detection means, including directly or indirectly detecting.

Term " SLE risk genes seat " and " the SLE risk genes seat of confirmation " refer to the gene marked in either table 4 and table 6 Seat and BLK locus.

Term " SLE risk allele " and " the SLE risk allele of confirmation " refer to be present in SLE risk genes seat Variation.This kind of variation includes but not limited to single nucleotide polymorphism, inserts and lack.Table 4 and table 6 show some example Property SLE risk allele.

As used herein, have " risk " that lupus occurs object can with or without detectable disease or Disease symptoms, and can show or not yet show detectable disease or disease disease before Therapeutic Method as herein described Shape." it is in risk " and represents that object has one or more risks and assumptions, as described herein and it is known in the art that risks and assumptions is To lupus suffer from relevant measurable parameter.Have the object of these risks and assumptions one or more than without one or more this The object of a little risks and assumptions has higher probability lupus occur.

Herein by terms " diagnoses " and refers to molecule or the qualification of pathological state, disease or disease and classification.Such as, " diagnose " The qualification of the particular type of lupus disease, such as SLE can be referred to." diagnose " classification of the specific hypotype that can also refer to lupus, example As by involved tissue/organ (lupus nephritis), (being such as characterized as specific gene or nucleic acid region by characterization of molecules In the patient subgroups of hereditary variation).

Herein by terms " assisted diagnosis " refers to help to carry out the certain types of symptom about lupus or the existence of disease Or the method for the clinical assays of character.Such as, the method for assisted diagnosis lupus can include that measuring the biology from individual imitates Product lack one or more SLE risk genes seat or the allelic existence of SLE risk.

Herein by terms " prediction (prognosis) " refers to be attributable to the disease symptoms of autoimmune disorders, including example Recurrence, burst (flaring) and the prediction of probability of drug resistance such as autoimmune disease such as lupus.Herein by terms " prediction (prediction) " refers to the probability that medicine or medicine group will advantageously or adversely be reacted by patient.

As used herein, " treatment " refers to the clinical intervention attempting changing the natural process of individual treated or cell, And can be before clinical pathology process or period is carried out.Desired response to treatment includes preventing disease or its disease or symptom There is or recur, alleviate disease or the symptom of this disease, reduce any direct or indirect pathological examination of this disease, reduction disease Disease carries out speed, improves or relax morbid state and reach the prediction alleviated or improve.In some embodiments, the present invention Method and composition occurs in the trial of disease or obstacle for delay.

" effective dose " refers to reaching desired treatment or preventing result effectively to measure (required dosage and time).Therapeutic agent " therapeutically effective amount " can be according to such as individual morbid state, age, sex and body weight, and antibody causes uncommon in individuality The factor of ability of the reaction hoped and different.Therapeutically effective amount or such amount, the beneficial effect wherein treated is better than to be controlled Treat any toxicity or the illeffects of agent." prevention effective dose " refers to effectively measure (required agent to reaching desired prevention result Amount and time).Due to before disease or the commitment of disease uses preventive dose in object, prevention effective dose generally but Not necessarily less than therapeutically effective amount.

" individual ", " object " or " patient " is vertebrates.In certain embodiments, this vertebrates is that suckling is moved Thing.Mammal includes but not limited to primates (including people and non-human primates) and rodent, and (such as mice is with big Mus).In certain embodiments, mammal is people.

As used herein, what " patient subgroups " and grammer variants thereof referred to be characterized as to have one or more uniquenesses can Measure and/or the patient subgroups of appraisable feature, this feature by this patient subgroups from the wider array of classification of diseases that it is affiliated Other patient area separate.This category feature includes disease subclass (such as SLE, lupus nephritis), sex, life style, is good for Health history, involved organ-/ tissue, treatment history etc..

" comparison object " refers to that N-Y-D-, for suffering from lupus or lupus disease, and does not suffer from relevant to lupus or lupus disease Any symptom or the health objects of symptom.

Term used herein " sample " refers to available from or is derived from the compositions of purpose object, and it comprises treats such as according to thing Reason, biochemical, chemical and/or physiologic character sign and/or the cell identified and/or other molecular entities.Such as, phrase is " raw Thing imitates product " or " disease sample " and variants thereof refer to comprise cell to be characterized and/or molecule available from expection or known its The Arbitrary Samples of the purpose object of entity.

" tissue or cell sample " means a collection of similar cell available from object or patient tissue.This tissue or cell sample The source of product can be solid tissue, as from fresh, freezing and/or organ or tissue's sample of preservation or biopsy Look into or aspirate (aspirate)；Blood or arbitrarily blood constitutent；Body fluid, such as cerebrospinal fluid, amniotic fluid, peritoneal fluid or tissue fluid； From the pregnant of this object or the cell of developmental random time.Tissue sample can also is that cell or thin that is primary or that cultivate Born of the same parents are.Alternatively, tissue or cell sample are available from diseased tissue/organ.Tissue sample can comprise not sky in nature The compound so mixed with tissue, such as preservative, anticoagulant, buffer agent, fixative, nutrient, antibiotic etc..Used herein " reference sample ", " with reference to cell ", " reference tissue ", " control sample ", " compared with control cells " or " control tissue " refer to available from known Or think the cell or tissue in the source not suffering from disease or the disease just identified by the method for the present invention or compositions.At one In embodiment, reference sample, reference cell, reference tissue, control sample, compared with control cells or control tissue are available from just with this Bright compositions or method identify the healthy part of disease or the same target of disease or patient wherein.An enforcement In scheme, reference sample, reference cell, reference tissue, control sample, compared with control cells or control tissue are good for available from individual health Health part, this individuality is not that just compositions or method by the present invention identifies disease or the object of disease or patient wherein.

For purpose herein, " section " of tissue sample means single part or monolithic tissue sample, such as from tissue sample Tissue that product cut or the thin slice of cell.If understanding of present invention resides in both Morphology level and molecular level upper analyze or The method both protein and nucleic acid being analyzed to the same section of tissue sample, then understanding of and can obtain the multiple of tissue sample Section is also analyzed according to the present invention.

" be correlated with " or " relevant " mean to analyze first in any way or the performance of flow process and/or result with second point Analysis or the performance of flow process and/or result compare.For example, it is possible to be used for carrying out second by the result of the first analysis or flow process Journey, and/or can determine whether to carry out the second analysis or flow process by the result of the first analysis or flow process.With regard to gene expression analysis For the embodiment of analysis or flow process, can determine whether to carry out concrete controlling by the result of gene expression analysis or flow process Treatment scheme.

Time used herein, word " labelling " refers to that the direct or indirect reagent with such as nucleic probe or antibody is puted together or melts Close, and be easy to it and put together therewith or the compound of the detection of reagent that merges or compositions.Labelling itself can be detectable (such as labelled with radioisotope or fluorescent labeling), or in the case of enzyme labelling, it can be catalyzed detectable substrate Compound or the chemical modification of compositions.

" medicament " is treatment disease, obstacle and/or the active medicine of disease.In one embodiment, this disease, obstacle And/or disease is lupus or its symptom or side effect.

When using according to the present invention, " resistance of raising " of particular therapeutic agent or therapeutic choice is meant standard by term The medicine of dosage or the reaction of the reduction to standard care flow process.

When using according to the present invention, " sensitivity of reduction " of particular therapeutic agent or therapeutic choice is meant mark by term The therapeutic agent of quasi-dosage or the reaction of the reduction to standard care flow process, wherein can be strong by improving dosage of therapeutic agent or treatment Degree compensates the reaction that (at least partly compensating) reduces.

With display, any terminal of the benefit of patient can be come " pre-measured reaction " and variants, the institute of evaluation object State terminal and include the suppression to a certain degree of (1) progression of disease without limitation, including slowing down and stopping completely；(2) disease is sent out Make the minimizing of number of times and/or symptom；(3) reduction of size of tumor；(4) disease cells be impregnated into adjacent peripheral organs and/or The suppression (i.e. reduce, slow down or stop completely) of tissue；(5) suppression (i.e. reduce, slow down or stop completely) of disease's spread； (6) minimizing of autoimmune response, its can but not necessarily cause disappearing or departing from of disease focus；(7) with this obstacle phase One or more symptoms the alleviating to a certain degree closed；(8) increase of the length without disease is shown after treatment；And/or (9) treatment After at the mortality rate of reduction of some preset time.

" lupus therapeutic agent " used herein, " to treatment the effective therapeutic agent of lupus " and grammer variants refer to Effective dose provide time, it is known that, clinically display or clinician it is contemplated that suffer from the object of lupus provide treatment benefit work Property agent (agent).In one embodiment, this phrase includes that the activating agent as accepting clinically is sold by producer, or with Any activating agent that other modes are used by the clinician having license, it is contemplated that when providing with effective dose, it will suffer from wolf The object of skin ulcer provides response to treatment.In one embodiment, lupus therapeutic agent includes nonsteroid anti-inflammatory drugs (NSAID), It includes aspirin (such as aspirin), ibuprofen (Motrin), naproxen (Naprosyn), indomethacin (Indocin), nabumetone (Relafen), tolmetin (Tolectin), and be included in the upper equivalent for the treatment of active component and Other embodiments any of preparation.In one embodiment, lupus therapeutic agent includes that acetaminophen is (such as Tylenol), corticosteroid or anti-malarial agents 3 (such as chloroquine, hydroxychloroquine).In one embodiment, lupus therapeutic agent bag Include immunoregulation medicament (such as azathioprine, cyclophosphamide, methotrexate, cyclosporin).In one embodiment, lupus Therapeutic agent is anti-B cell agent (the most anti-CD20 (such as Rituximab), anti-CD22), antibacterial agent agent (such as antitumor Necrosin &, anti-IL-8-1-receptor (such as Antril (Synergen) (anakinra)), anti-IL-8 10, anti-white thin Born of the same parents' interleukin 6 receptor, anti-interferon alpha, anti-bone-marrow-derived lymphocyte stimulus object), stimulate inhibitor (the most anti-CD154, CTLA4-Ig (example altogether Such as abatacept)), B cell energy adjustment agent (such as LJP 394 (such as abetimus (abetimus))).An enforcement In scheme, lupus therapeutic agent includes hormone therapy (such as DHEA) and antihormonal therapies (such as prolactin antagonist agent bromine Ergota ring Peptide).In one embodiment, lupus therapeutic agent is to provide the activating agent of immunoadsorption, is that anticomplement factor is (the most anti- C5a), T cell vaccination, use φt cell receptor ζ chain transfectional cell or peptide therapy (edratide of such as targeting anti-DNA idiotype).

Used herein have " selling approval " or the therapeutic agent " ratified as therapeutic agent " or the grammer of these phrases Variants refers to be ratified by relevant governmental entity (such as federal, state or administrative offices in the localities, department, office), permit, registered Or authorize by and/or pass through and/or represent commercial entity's (entity of such as getting a profit) sale to be used for treating particular obstacle (such as wolf Skin ulcer) or patient subgroups (such as suffer from the patient of lupus nephritis, the trouble of particular race, sex, life style, disease risks spectrum Person etc.) activating agent (the such as form of pharmaceutical preparation, medicament).Relevant governmental entity includes such as U.S. food and drug control Office (FDA), Europe drug administration (EMEA) and equivalent mechanisms thereof.

" antibody " (Ab) and " immunoglobulin " (Ig) refers to the glycoprotein with similar structural characteristics.Antibody shows specifically The binding specificity of antigen, and immunoglobulin includes other antibody sample molecules two of antibody and general lack of antigenic specificity Person.The polypeptide of latter type such as by low-level and is pressed the level generation improved by lymphsystem by myeloma.

Term " antibody " and " immunoglobulin " are used interchangeably in broadest sense, and comprise monoclonal antibody (such as total length or complete monoclonal antibody), polyclonal antibody, univalent antibody, multivalent antibody, multi-specificity antibody are (the most double Specific antibody, as long as they show desired biological activity), and can also include that some antibody fragment is (as in further detail herein Ground describes).Antibody can be chimeric antibody, people's antibody, humanized antibody and/or affinity maturation antibody.

Herein term " full length antibody ", " complete antibody " and " whole antibody " is used interchangeably to finger and is in it substantially The antibody of complete form rather than antibody fragment as defined below.This term especially has the heavy chain that comprises Fc district Antibody.

" antibody fragment " comprises the part of complete antibody, especially comprises its antigen binding domain.The example bag of antibody fragment Include Fab, Fab ', F (ab ')₂With Fv fragment；Double antibody；Linear antibodies；Single-chain antibody molecules；Many with from antibody fragment formation Specific antibody.

Papain digestion of antibodies produces two identical Fabs, and (referred to as " Fab " fragment, each fragment has Have single antigen-binding site) and remaining " Fc " fragment (its title reflects it and is prone to the ability of crystallization).At pepsin Reason produces to be had two antigen-binding sites and remains able to the F (ab ') of crosslinking antigen₂Fragment.

" Fv " is the minimum antibody fragment comprising intact antigen binding site.In one embodiment, two-chain Fv species It is made up of a heavy-chain variable domains of tight Non-covalent binding and the dimer of a light variable domains.6 of Fv CDR gives antibody antigen binding specificity jointly.But, the most single variable domains (or only comprise 3 to antigen-specific Half Fv of CDR) also there is the ability identified with conjugated antigen, although with the affinity less than whole binding site.

Fab fragment comprises heavy-chain variable domains and light variable domains, and also comprise light chain constant domain and First constant domain (CH1) of heavy chain.Fab ' fragment is different from Fab fragment to be one or more to cut with scissors from antibody comprising The C end of the heavy chain CH1 domain of the cysteine of sequence adds several residue.Fab '-SH is herein to the most constant structure The cysteine residues in territory has the name of the Fab ' of free sulfhydryl group.Initially as the Fab ' therebetween with hinge cysteine Fragment is to producing F (ab ')₂.It is known that other chemical couplings of antibody fragment.

Term used herein " monoclonal antibody " refers to the antibody of the antibody population available from substantially homogeneity, i.e. except permissible The possible sudden change existed with less amount, outside the most naturally occurring sudden change, the colony comprising single antibody is same.Cause This, qualifier " monoclonal " represents that this antibody is not the character of the mixture of the antibody separated.In certain embodiments, this Monoclonal antibody generally includes the antibody containing the peptide sequence combining target, and wherein this peptide sequence combining target is to pass through Obtain including selecting the method for peptide sequence of single combination target from multiple peptide sequences.Such as, this system of selection is permissible Being from multiple clones, the storehouse such as hybridoma clone, phage clone or recombinant DNA clone selects unique clone.Should be understood that can With the sequence of the combination target selected by change further, such as to improve to the affinity of this target, with this combination of humanization The sequence of target, to improve its generation in cell culture, to reduce its immunogenicity in vivo, how special to produce Property antibody etc., and the antibody of the sequence of the combination target comprising this change is also the monoclonal antibody of the present invention.With generally comprise Polyclonal antibody preparations for the different antibodies of different determinants (epi-position) is different, each monoclonal of monoclonal antibody formulation Single determinant on antibody for antigen.In addition to its specificity, the advantage of monoclonal antibody formulation is that they are general not Polluted by other immunoglobulins.

Qualifier " monoclonal " represents this antibody character available from the antibody population of substantially homogeneity, and is not interpreted as needs This antibody is produced by the method for any specific.Dan Ke used according to the present invention is treated for example, it is possible to produced by multiple technologies Grand antibody, such as hybridoma (such as Kohler etc., Nature, 256:495 (1975)；Harlow etc.,Antibodies:A Laboratory Manual, (Cold Spring Harbor Laboratory Press, the second edition 1998)；Hammerling Deng,Monoclonal Antibodies and T-Cell Hybridomas563-681 (Elsevier, N.Y., 1981) In), recombinant DNA method (see such as U.S. Patent number 4,816,567), display technique of bacteriophage (see such as Clackson etc., Nature, 352:624-628 (1991)；Marks etc., J.Mol.Biol.222:581-597 (1992))；Sidhu etc., J.Mol.Biol.338 (2): 299-310 (2004)；Lee etc., J.Mol.Biol.340 (5): 1073-1093 (2004)； Fellouse, Proc.Natl.Acad.Sci.USA101 (34): 12467-12472 (2004)；With Lee etc., J.Immunol.Methods 284 (1-2): 119-132 (2004)) and in the portion with encoding human immunoglobulin's sequence Divide or the animal of whole human immunoglobulin gene's seat or gene produces the technology of people or human-like antibodies (see such as WO98/ 24893；WO96/34096；WO96/33735；WO91/10741；Jakobovits etc., Proc.Natl.Acad.Sci.USA 90:2551 (1993)；Jakobovits etc., Nature 362:255-258 (1993)；Bruggemann etc., Year in Immunol.7:33 (1993)；U.S. Patent number 5,545,807,5,545,806,5,569,825,5,625,126,5,633, 425、5,661,016；Marks etc., Bio.Technology 10:779-783 (1992)；Lonberg etc., Nature 368: 856-859(1994)；Morrison, Nature 368:812-813 (1994)；Fishwild etc., Nature Biotechnol.14:845-859 (1996)；Neuberger, Nature Biotechnol.14:826 (1996)；And Lonberg and Huszar, Intern.Rev.Immunol.13:65-93 (1995)).

Monoclonal antibody specificity ground herein includes " being fitted together to " antibody, wherein Partial heavy and/or light chain be derived from spy Earnest kind or sequence corresponding in being under the jurisdiction of the antibody of specific antibodies kind or subclass is identical or homology, and the remainder of chain with Sequence corresponding in being derived from another species or being under the jurisdiction of the antibody of another antibody type or subclass is identical or homology, and this kind of anti- The fragment of body, if they display desired biological activity (U.S. Patent numbers 4,816,567；With Morrison etc., Proc.Natl.Acad.Sci.USA81:6855-9855 (1984)).

Inhuman (such as Mus) antibody of " humanization " form is the embedding of the minmal sequence comprising and being derived from non-human immunoglobulin Close antibody.In one embodiment, humanized antibody is such human normal immunoglobulin (receptor antibody), wherein by from Non-human species's (donor antibody) such as mice, rat, rabbit or non-human primates has desired specificity, affinity and/or appearance The residue of the hypervariable region of amount replaces the residue from this receptor hypervariable region.In some cases, taken by corresponding non-human residues Framework region (FR) residue for this human normal immunoglobulin.Additionally, humanized antibody can comprise does not sees this receptor antibody or confession Residue in body antibody.These modifications can be carried out and refine antibody performance further.It is said that in general, humanized antibody will comprise At least 1, and usual 2 variable domains is substantially all, the highest rings that become are corresponding to inhuman The Gao Bianhuan of immunoglobulin, and completely or generally all FR is the FR of human normal immunoglobulin's sequence.Humanized antibody also will Comprise at least part of constant region for immunoglobulin (Fc) alternatively, it is common that human normal immunoglobulin constant region.Further details See Jones etc., Nature 321:522-525 (1986)；Riechmann etc., Nature 332:323-329 (1998)；With Presta, Curr.Op.Struct.Biol.2:593-596 (1992).See also following survey article and cited therein with reference to literary composition Offer: Vaswani and Hamilton, Ann.Allergy, Asthma & Immunol.1:105-115 (1998)；Harris, Biochem.Soc.Transactions 23:1035-1038 (1995)；Hurle and Gross, Curr.Op.Biotech.5: 428-433(1994)。

" people's antibody " is to comprise corresponding to being produced by people and/or with disclosed herein for the technology producing people's antibody In the antibody of aminoacid sequence of aminoacid sequence of any one antibody produced.This kind of technology includes screening the group that people derives Close library, as phage display library (see such as Marks etc., J.Mol.Biol., 222:581-597 (1991) and Hoogenboom etc., Nucl.Acids Res., 19:4133-4137 (1991))；By human myeloma and the miscellaneous myeloma of mice-people (heteromyeloma) cell line carrys out human monoclonal antibodies (see such as Kozbor J.Immunol., 133:3001 (1984)；Brodeur etc., Monoclonal Antibody Production Techniques and Applications, 55-93 page (Marcel Dekker, Inc., New York, 1987)；With Boerner etc., J.Immunol., 147:86 (1991))；With can without endogenous immunoglobulin produce in the case of produce people's antibody repertoire turn Genetic animal (such as mice) middle generation monoclonal antibody (see such as Jakobovits etc., Proc.Natl.Acad.Sci USA, 90:2551 (1993)；Jakobovits etc., Nature, 362:255 (1993)；Bruggermann etc., Year in Immunol., 7:33 (1993)).This definition specificity of people's antibody eliminates and comprises the antigen binding residues from non-human animal Humanized antibody.

" affinity maturation " antibody is compared with not having these parental antibodies changed, in one or more CDR In there is the antibody causing this antibody to one or more changes that the affinity of antigen improves.In one embodiment, parent The antibody ripe with power has nanomole or even picomole affinity to target antigen.Parent is produced by methods known in the art The antibody ripe with power.Marks etc., Bio/Technology 10:779-783 (1992) describes by VH and VL domain The affinity maturation of reorganization.Proc Nat.Acad.Sci.USA 91:3809-3813 (1994) such as Barbas；Schier etc. Gene 169:147-155 (1995)；The J.Immunol.155:1994-2004 such as Yelton (1995)；Jackson etc., J.Immunol.154 (7): 3310-9 (1995)；Describe with Hawkins etc., J.Mol.Biol.226:889-896 (1992) HVR and/or the random mutagenesis of Framework residues.

" blocking antibody " or " antagonist antibody " is suppression or reduces its bioactive antibody of antigen combined.Some Blocking antibody or antagonist antibody partially or completely suppress the biological activity of this antigen.

Herein " little molecule " or " little organic molecule " is defined as having the organic of below about 500 daltonian molecular weight Molecule.

Time used herein, word " labelling " refers to detectable compound or compositions.Labelling itself can be to detect (such as labelled with radioisotope or fluorescent labeling), or in the case of enzyme labelling, it can be catalyzed generation and can detect The substrate compounds of product or the chemical modification of compositions.Can as detection labelling radionuclide include such as I-131, I-123, I-125, Y-90, Re-188, Re-186, At-211, Cu-67, Bi-212 and Pd-109.

" separation " biomolecule, if nucleic acid, polypeptide or antibody are to have identified and from least one group of its natural surroundings The biomolecule separated and/or reclaim.

Include when " about " mentioned herein certain value or parameter that (description) relates to this value or the embodiment of parameter itself.Example As, the description mentioning " about X " includes the description of " X ".

General technology

Provided herein is the nucleotide diversity relevant to lupus.These variations provide for lupus and/or tend to or have Help the appearance of lupus, continue and/or the biomarker of progress.Therefore, invention disclosed herein is used for multiple background (setting) in, such as in the method and composition relating to lupus diagnosis and treatment.

In certain embodiments, method relates to prediction, is i.e. attributable to the disease symptoms of autoimmune disorders, including example Recurrence, burst (flaring) and the prediction of probability of drug resistance such as autoimmune disease such as lupus.An embodiment party In case, this prediction relates to the degree of those reactions.In one embodiment, whether this prediction relates to patient will be in treatment, example As with surviving after particular therapeutic agent treatment or improving and over a period to come without palindromia and/or its probability.By selecting It is suitable for the Therapeutic mode of any specific patient, the Forecasting Methodology of the present invention can be used clinically to make treatment and determine.This The Forecasting Methodology of invention be prediction patient whether may advantageously to therapeutic scheme (such as given therapeutic scheme, including such as giving The using of fixed therapeutic agent or combination, surgical intervention, steroid therapy etc.) reaction, or whether this patient may be at therapeutic scheme The valuable instrument of long-term surviving afterwards.The diagnosis of SLE can be according to current American College of Rheumatology (ACR) standard.British Isles Lupus Activity Group ' s (BILAG) can be passed through " A " standard or two BILAG " B " standards define active disease.Amendment is from " The Revised Criteria for such as Tan The Classification of SLE " Arth Rheum 25 (1982) for diagnose some symptom of SLE, symptom or its His indicant can be malar rass, such as cheek rash, plate-like rash or red protuberance speckle；Photosensitivity, as to photoperiodism, causes skin The development of rash or increase；Oral ulcer, such as the ulcer in nose or mouth, the most painless；Arthritis, such as relating to two or more periphery The not aggressive arthritis (the unspoilt arthritis of periarticular skeleton) in joint；Oromeningitis, pleuritis or pericarditis；Kidney Dysfunction, as in urine, protein (being 3+ more than 0.5gm/ days or on test bar) and/or the cellular cast of excess (are derived from urine And/or leukocyte and/or the abnormal component of renal tubular cell)；Neurological symptom, symptom or other indicants, epilepsy is (frightened Faint), and/or without the psychosis under drug condition, or the known metabolism disorder causing these effects；With haematological signs, symptom Or other indicants, such as hemolytic anemia or leukopenia, (numeration of leukocyte is less than 4,000 cell/mm³) or lymphocyte Reduce (less than 1,500 lymphocytes/mm³) or thrombocytopenia (less than 100,000 platelet/mm³).Leukopenia and pouring Bar Leukopenia typically must detect in two or more moment.Thrombocytopenia typically must lack known induced platelet Detect in the case of the medicine reduced.The present invention is not restricted to these symptom of lupus, symptom or other indicants.

The detection of hereditary variation

In above method, the nucleic acid of any one can be genomic DNA, the RNA transcribed from genomic DNA or produce from RNA CDNA.Nucleic acid can be derived from vertebrates, such as mammal.If if it is direct that obtain from this source or it It is the copy seeing the nucleic acid in this source, then nucleic acid is referred to as " being derived from " particular source.

Nucleic acid includes the copy of this nucleic acid, such as, be produced from the copy of amplification.Amplification can be intended in some cases , such as in order to obtain the material of desired amount for detecting variation.Then amplicon can be carried out mutation detection method, as Methods described below, to measure whether variation is present in this amplicon.

Variation can be detected by some method well known by persons skilled in the art.These methods include but not limited to DNA sequencing；Primer extension measures, and mixes including allele specific oligonucleotide nucleotide and measures and allele specific oligonucleotide primer extension Measure (the most allele specific oligonucleotide PCR, allele specific oligonucleotide connection chain reaction (LCR) and breach LCR)；Allele is special Different oligonucleotide hybridization measures (such as oligonucleotide connects mensuration)；Cutting protection measures, wherein with protecting against cut substrate Matter detects the base mismatch in nucleic acid duplex；MutS protein bound is analyzed；Relatively variant and wildtype nucleic acid molecule moves The electrophoretic analysis of shifting rate；Denaturing gradient gel electrophoresis (DGGE, in (1985) Nature313:495 such as such as Myers)； The analysis that place is cut by RNase at base mismatch；The chemistry of heteroduplex DNA or the analysis of cleavage；Mass spectrography (example Such as MALDI-TOF)；Genetic bit analysis (geneticbit analysis, GBA)；5 ' nucleases measure (such as)；With the mensuration utilizing molecular beacon.Discuss in further detail below some in these methods.

Can realize in this target nucleic acid with order-checking by target nucleic acid being carried out molecular cloning by technology well known in the art The detection of variation.It is alternatively possible to come directly from the gene from tumor tissues with amplification technique such as polymerase chain reaction (PCR) Group DNA prepared product amplifying target nucleic acid sequence.Then can measure the nucleotide sequence of expanded sequence, and identify variation from it. Amplification technique is known in the art, and such as polymerase chain reaction is described in Saiki etc., Science 239:487, and 1988；The U.S. In the patent No. 4,683,203 and 4,683,195.

Amplifying target nucleic acid sequence can also be carried out with ligase chain reaction known in the art.See such as Wu etc., Genomics 4:560-569 (1989).Further, it is also possible to detect variation (such as replacing) by the technology of referred to as allele specific pcr.See Such as Ruano and Kidd (1989) Nucleic Acids Research17:8392；McClay etc. (2002) AnalyticalBiochem.301:200-206.In some embodiment of this technology, use allele specific oligonucleotide drawing Thing, wherein 3 ' terminal nucleotides of this primer (i.e. can be joined by specific base therewith with the specific variation complementation in this target nucleic acid Right).If this specific variation does not exists, then do not observe amplified production.Amplification Refractory can also be used Mutation System (ARMS) detects variation (such as replacing).ARMS is described in such as European patent application publication No. With Newton etc. in 0332435, Nucleic Acids Research, 17:7, in 1989.

Include but not limited to that (1) allele specific oligonucleotide nucleotide is mixed for detecting the additive method of variation (such as replacing) Enter to measure, as Single base extension measures (see (2000) Genome Res.10:549-557 such as such as Chen；Fan etc. (2000) Genome Res.10:853-860；Pastinen etc. (1997) Genome Res.7:606-614；With (2001) such as Ye Hum.Mut.17:305-316)；(2) allele specific oligonucleotide primer extension measure (see (2001) Hum.Mut.17 such as such as Ye: 305-316；With Genetic Engineering News such as Shen, roll up on March 15th, 23,2003), including allele specific PCR；(3) 5 ' nucleases measure and ((describe see (2002) BioTechniques 32:S48-S54 such as such as De La VegaMeasure)；Ranade etc. (2001) GenomeRes.11:1262-1268；With Shi (2001) Clin.Chem.47:164-172)；(4) utilize the mensuration of molecular beacon (see (1998) Nature such as such as Tyagi Biotech.16:49-53；With (2001) Methods 25:463-71 such as Mhlanga)；(5) oligonucleotide connect measure (see Such as Grossman etc. (1994) Nuc.Acids Res.22:4527-4534；Patent application publication number US 2003/ 0119004A1；PCT International Publication WO 01/92579A2；With U.S. Patent number 6,027,889).

Variation can also be detected by mispairing detection method.Mispairing is the hybrid nucleic acid duplex of not 100% complementation.Complete Complete complementary shortage can be caused by disappearance, insertion, inversion or replacement.One example of mispairing detection method is to be described in such as Faham etc., Proc.Natl Acad.Sci USA102:14717-14722 (2005) and Faham etc., Mispairing reparation detection (MRD) in Hum.Mol.Genet.10:1657-1664 (2001) measures.Another of mispairing cutting technique Example is RNase Protection Code, and it is described in Winter etc., Proc.Natl.Acad.Sci.USA, 82:7575,1985 and Myers Deng, Science 230:1242, in 1985.Such as, the method for the present invention can relate to and the mark of people's wildtype target complementary nucleic acid The use of the riboprobe of note.By riboprobe together with the target nucleic acid renaturation (hybridization) being derived from tissue sample, Subsequently with the enzyme RNase A digestion of some mispairing that can detect in duplex RNA structure.If RNase A detects mispairing, then It cuts at this mismatch site.Therefore, when running gel substrate separates the RNA prepared product of renaturation, if RNase A examines Measure and cut mispairing, then it will be seen that the RNA product less than the total length duplex RNA of riboprobe Yu mRNA or DNA. Riboprobe needs not be the total length of target nucleic acid, and can be the part of target nucleic acid, as long as it comprises and doubtful has variation Position.

Mispairing can be detected in a similar fashion, such as by enzyme or chemical cleavage with DNA probe.See such as Cotton Deng, Proc.Natl.Acad.Sci.USA, 85:4397,1988；With Shenk etc., Proc.Natl.Acad.Sci.USA, 72: 989,1975.It is alternatively possible to detect mispairing by mispairing duplex relative to the electrophoresis mobility shift of pairing duplex. See such as Cariello, Human Genetics, 42:726,1988.Can be with riboprobe or DNA probe before hybridization Expand the doubtful target nucleic acid comprising variation.Can also be with the change in Southern hybridization check target nucleic acid, if especially should Change is overall rearrangement (gross rearrangement), such as disappearance and insertion.

Can detect with restriction fragment length polymorphism (RFLP) probe for target nucleic acid or surrounding markings gene Variation, such as, insert or lack.Can also by the clone of target nucleic acid, check order and expand detect insertion and disappearance.All right Analyze with single strand conformation polymorphism (SSCP) and detect allelic sequence change variant.See such as Orita etc., Proc.Natl.Acad.Sci.USA 86:2766-2770,1989 and Genomics, 5:874-879,1989.

Microarray is Multiple techniques, generally uses a series of thousands of nucleic acids probes and such as cDNA or the cRNA sample of arrangement Product hybridize under high high stringency conditions.Generally by detection fluorogen-, silver-or the target of chemiluminescence-labelling, detect and quantitatively Probe-target hybridization, determines the relative abundance of nucleotide sequence in target.In typical microarray, probe by with chemical matrix Covalent bond (by epoxy silane, amino silane, lysine, polyacrylamide or other) be attached to the surface of solids.Solid table Face is such as glass, silicon chip or micro-pearl (microscopic bead).Various microarraies are commercially available, including by such as Affymetrix, Inc. and Illumina, those of Inc. production.

Biological sample can be obtained by some method well known by persons skilled in the art.Can be from vertebrates, and especially It is that mammal obtains biological sample.Generally obtain representative tumor tissue with tissue biopsy.Alternatively, may be used With with known or think that its tissue comprising purpose tumor cell or fluid form directly obtain tumor cell.For example, it is possible to it is logical Cross excision, bronchoscopy art, fine needle aspiration, bronchial brushing, or obtain pulmonary carcinoma focus from saliva, Pleural fluid or blood Sample.Can be from tumor sample or (tumor cell comes off from tumor and occurs in from other body sample such as urine, saliva or serum In this kind of body sample) detect the variation in target nucleic acid (or coded polypeptide).By screening this kind of body sample, Ke Yida Simple early diagnosis to disorders such as cancers.Additionally, by for the mutation testing in target nucleic acid (or coded polypeptide) this Class body sample, can more easily monitor the progress for the treatment of.Additionally, it is known in the art for for tumor cell enrichment tissue The method of prepared product.For example, it is possible to from paraffin or cryostat section chorista.Can also be caught by flow cytometry or laser Obtain microdissection from normal cell separation cancerous cell.

After determining that experimenter or tissue or cell sample comprise hereditary variation disclosed herein, it is considered to can be tested to this Person uses the suitable lupus therapeutic agent of effective dose, to treat this lupus disease in this experimenter.Can be by skilled working Person carries out the diagnosis of multiple pathologic conditions as herein described in mammal.Allow such as diagnose in mammal or detect The diagnostic techniques of lupus is that this area is available.

Lupus therapeutic agent can be used in accordance with known methods, as bolus injection or by continuous within a period of time Use in intravenous injection, by intramuscular, intraperitoneal, intracerobrospinal, subcutaneous, intraarticular, intrasynovial, sheath, mouth Chamber, local or inhalation route.It is optionally possible to by using the combination microinjection pump of multiple commercially available apparatus to be administered.

Can rule of thumb measure effective dose and the timetable using lupus therapeutic agent, and carry out this kind of mensuration at this In the range of art.Single or multiple dosage can be utilized.Such as, the effective dose of the interferon inhibitor being used alone or Amount can from about 1mg/kg body weight every day in the range of about 100mg/kg body weight.Can in a manner known in the art, example As by Mordenti etc., carry out disclosed in Pharmaceut.Res., 8:1351 (1991) increasing and decreasing between the species of dosage.

Utilize lupus therapeutic agent internal use time, depend on route of administration, normal dose can be from about 10ng/ every day Kg is at most 100mg/kg weight of mammal or more variation, preferably from about 1 μ g/kg/ days to 10mg/kg/ days.Document provides About given dose and the guidance of delivering method；See such as U.S. Patent number 4,657,760,5,206,344 or 5,225, 212.Expecting that different preparations will be effective to different therapeutic compounds and different obstacle, one organ or tissue of targeting uses example As so that must deliver in the way of being different from another organ or tissue.

Consideration can also utilize other therapies in the method.These one or more other therapies can include but not limited to The obstacle discussed is used the other standards of steroid and care regimen.Other therapies this kind of can be used as from such as by consideration The orientation separate activating agent of lupus therapeutic agent.

Test kit

For the application in application that is described above or that pointed out, additionally provide test kit or prepare product.This type of test kit Can include that carrier tool, described carrier tool are divided thus with tight seal to accept one or more container instrument, such as Bottle, pipe etc., each container instrument includes the element of a kind of separation in method.Such as, a container instrument can include Probe, described probe by or can be by detectable labelling.This type of probe can be that specificity is for comprising SLE risk genes seat The polynucleotide of polynucleotide.Wherein, test kit utilizes nucleic acid hybridization to detect target nucleic acid, and test kit can also have and comprises For the container of one or more nucleotide of amplifying target nucleic acid sequence, and/or comprise the container of report instrument, this report instrument Such as biotin binding protein, such as be combined with the reporter molecule of such as enzyme labelling, fluorescent labeling or labelled with radioisotope Avidin or Succ-PEG-DSPE.

Test kit generally includes said vesse and other containers one or more, and other containers described include from market and use The material needed from the viewpoint of family, including buffer, diluent, filter, syringe needle, syringe, and instructs the explanation used Book.Label may be located on container, and prompting combination thing is to apply for specific therapy or non-therapeutic, it is also possible to for internal or In vitro use prompting explanation, those purposes as described above.

Other optional components in test kit include one or more buffer (such as, Block buffer, washing buffer Liquid, substrate buffer solution etc.), other reagent are such as retrieved solution by the substrate (such as, chromogen) of enzyme labelling chemical modification, epi-position (epitope retrieval solution), control sample (positive and/or negative control), comparison slide etc..Other components It is enzyme, such as, includes but not limited to nuclease, ligase or polymerase.

Selling method

Additionally providing for selling lupus therapeutic agent or the method for its pharmaceutically acceptable compositions, it includes declaring to target audience Pass, inform and/or illustrate this therapeutic agent or its pharmaceutical composition treatment from its obtain sample show exist disclosed herein The lupus patient of hereditary variation or patient subgroups in purposes.

Sell the paying generally by inhuman medium to propagate, wherein confirm advertiser and control information.In order to herein Purpose, sell include that publicity, public relations activity, product are placed, support, sold exclusively and sales promotion.This term also includes the appearance of patronage Information bulletin in any Print Communication medium, it is designed for appealing a large amount of reader, to persuade, inform, promote, to stimulate, Or otherwise change the purchase to preference, support or ratify the behavior of pattern of the present invention.

The sale of diagnostic method can be realized by any means.For transmitting the example of the marketing intermediaries of these information Including TV, broadcast, film, magazine, newspaper, network and billboard, including advertisement, it occurs from the letter in broadcast medium Breath.

The following is the embodiment of the method and composition of the present invention.Should be understood that due to general description provided above, permissible Implement other embodiments multiple.

Embodiment

In all embodiments, being quoted some publication by numbering mark, described numbering is in embodiment part Finally there is complete directory information.

Embodiment 1

Differentiate the novel risk locus of SLE

Method and object

Object

Have been described for SLE case, for the sample of full-length genome relatedness scanning (GWAS) and from New before York Health Project (NYHP) collecting center (Mitchell etc., J Urban Health 81 (2): 301-10 (2004) selection of comparison) and genotyping (Hom etc., N Engl J Med 358 (9): 900-9 (2008)).As hereafter Describing in detail, this SLE case is made up of 3 case series: a) carry out the storage Autoimmune that free NIH/NIAMS subsidizes Biomarkers Collaborative Network (ABCoN) (Bauer etc., PLoS medicine 3 (12): e491 (2006) 338 cases) and from Multiple Autoimmune Disease Genetics Consortium (MADGC) 141 cases of (Criswell etc., Am J Hum Genet 76 (4): 561-71 (2005))；B) from University of California San Francisco(UCSF)Lupus Genetics Project(Seligman Deng, Arthritis Rheum 44 (3): 618-25 (2001)；Remmers etc., N Engl JMed 357 (10): 977-86 (2007) 613 cases)；And c) from University of Pittsburgh Medical Center (UPMC) 335 cases of (Demirci etc., Ann Hum Genet 71 (Pt 3): 308-11 (2007)) and from The Feinstein 8 cases of Institute for Medical Research.Comparison is 1861 samples from NYHP collection, comes From 1722 samples of publicly available iControlDB data base (can obtain at Illumina Inc.) with from publicly available National Cancer Institute Cancer Genetic Markers of Susceptibility (CGEMS) item 4564 samples of mesh (can obtain under URL:cgems (dot) cancer (dot) gov).

1310 SLE cases and the full-length genome data set of 7859 comparisons

Selection and genotyping (Hom etc., the N Engl J Med 358 of SLE case sample is described before us (9): 900-9 (2008)).As determined by self-report and being confirmed by genotyping, all SLE cases are all Europe blood The people from North America of system.By medical records review (94%) or the normative document (6%) write by mainly curing rheumatism scholar in institute The diagnosis confirming SLE is had in case (to reach 4 or the definition of a plurality of American College ofRheumatology [ACR] Standard [Hochberg etc., Arthritis Rheum 40 (9): 1725 [1997]]).The clinical data of these case series exists Provide (Seligman etc., Arthritis Rheum 44 (3): 618-25 (2001) elsewhere；Criswell etc., Am J Hum Genet 76 (4): 561-71 (2005)；Bauer etc., PLoS medicine 3 (12): e419 (2006)；Demirci Deng, Ann Hum Genet 71 (Pt 3): 308-11 (2007)；Remmers etc., N Engl J Med 357 (10): 977-86 (2007)).Describe the genotyping of NYHP sample before and select (Hom etc., N Engl J Med 358 (9): 900-9 (2008)).Table 1 describes by effective sample number of site organization.

Carry out sample by the analysis module in software program P LINK hereinafter described and EIGENSTRAT and SNP filters (also See Purcell etc., Am J Hum Genet 81 (3): 559-75 (2007)；Price etc., Nat Genet 38 (8): 904-09 (2006)).Full-length genome SNP data are used in this research, in order to case and the tight fit of comparison, it is provided that confirmed With the genotype on doubtful SLE locus.

Table 1. full-length genome and press site organization replicate research in analyze sample number

^aDescribe sample (Hom, G. et al., the N Engl J Med358:900-9 of the scanning of full-length genome relatedness (2008))。^bThe independent SLE case of U.S.'s cohort is from PROFILE SLE community, branch school, three kinds, University of California (UCSF) (Thorburn, C.M. et al., Genes Immun8:279-87 (2007)), University of Pittsburgh Medical Center (UPMC), University of Minnesota (UMN), and Johns Hopkins University (JHU).The U.S. compares from New York fitness programme (Gregersen Et al.) and alzheimer case and comparison from Pittsburg university and NCRAD.^cSLE case and comparison from Stockholm, Karolinska, Solna, Uppsala, Lund andSweden。^dUse the Illumina 317K SNP array will be from The 823 example crt gene typings of Stockholm.By described in " method ", the SNP in these samples is carried out attribution and analysis.

Customization SNP array

Array with 10,848 SNP design customizations of the quality control survey passed through hereinafter described.Complete array Having 12,864 SNP, but 2016 SNP not met quality control surveys, remaining 10,848 SNP enter and analyze.Customization Array by 3,188 SNP composition, described SNP be based on the nominal P ＜ 0.05 in the relatedness scanning of SLE full-length genome and Selecting, 505 SNP are from 25 SLE risk genes seats reported before, and 42 SNP are for the risk etc. confirmed Position gene selects after carrying out literature search from other autoimmune diseases, and 7113 SNP are used for determining and control colony Asia Structure.Rear group includes SNP (Kosoy, R. et al., the Hum.Mutat.30:69-78 having been used for defining continent population difference ) and the SNP (Tian, C. et al., PLoS Genet 4, e4 (2008)) of Europe colony substructure enrichment (2009).The battle array of customization Arrange and used its iSelect Custom BeadChip to be to have passed through quality hereinafter described with us by Illumina, Inc. The rs identification number that the SNP controlling to filter provides produces.

Quality control and interpolation (imputation)

About U.S. Data, by 64 U.S. cases of Isosorbide-5-Nitrae and 3 altogether on the Illumina chip of described customization, 078 U.S.'s crt gene typing, described chip is referred to herein as the 12K chip of customization.Strict quality control (QC) is used to mark Accurately protect final analysis and include high-quality data.Specifically, a) eliminate 116 there is ＞ 5% to lose data Individuality, and b) based on implicit sibship (cryptic relatedness) with based on state homology (Identical by State；IBS) repeat samples of state (PIHat ＞ 0.15), eliminates 279 individualities.Only include such SNP, described SNP There is a) ＜ 5% and lose data, b) Hardy-Weinberg equilibrium (HWE) p value ＞ 1x10^-6, c) little gene frequency (MAF) ＞ 0.01% and d) about case and comparison difference lose disappearance test in there is p value ＞ 1x10^-5SNP.Also examine The batch effect of SNP.After applying above-mentioned filtration, the final group of 1144 cases and 3003 comparisons and 11024 SNP is available In analysis.Use PLINK to implement all QC and test (Purcell et al., Am J Hum Genet 81 (3): 559-75 (2007))。

About Swedish data, gene type is crossed on the 12K chip of customization 888 cases and 527 comparisons Group can be used for analyzing.Also being mixed with in analysis at Illumina, Inc.317K Human HapMap SNP bead array is (at this Literary composition is also referred to as 317K array) go up the combination that separate 1115 Swedes of gene type compare.Follow these steps to combine two sets Data set.First, 6 between 12K and 317K data, the overlapped data collection of 789SNP are generated.This data set is used to check Sweden The implicit sibship of people's copy group and repeat samples.Result eliminates 313 samples (PI Hat ＞ 0.15).In quality control After system checks, just analyze 863 cases transporting gene type on the 12K chip of customization and 523 comparisons and at 317K 831 comparisons of gene type on Illumina chip.Second, 831 crossed with 317K array interpolation (seeing below) gene type Individual Swede compares, and produces bigger overlapping SNP collection.In remaining SNP, capture 4605 SNP by interpolation.Finally The final collection of 11394 overlapping SNP is analyzed.Use the SNP in above-mentioned this data set of identical threshold filtering.Remaining not It is interpolated 1250 SNP that (imputation) capture only on 12K chip in Swede's sample initial sets of gene type It is analyzed.

Use II phase HapMap CEU sample as reference, use MACH (haplotype typing based on Markov Chain Software program, is available from URL sph.umich.edu/csg/abecasis/MACH) interpolation 831 uses 317K array gene Swede's comparison of typing.II phase HapMap CEU refers to the sample from human haplotype's project, it is known that be from " II phase " data Human haplotype's project of the Utah State resident with Northern Europe and West Europe ancestors (CEU) of release is (referring further to Li et al., Am JHum GenetS79 at 2290(2006)).Before interpolation, the quality control checking strict to 317K SNP application.In interpolation Including 293,242 have been passed through following standard (1) MAF ＞ 1%, (2) miss rate ＜ 5% and (3) HWE p value ＞ 1x10^-6's Label subset.After interpolation, abandon the SNP with low interpolation quality, i.e. the R square _ Hat (RSQR_ of MACH report HAT) ＜ 0.40.11394 overlapping label collection can be used for analyzing.In view of the uncertainty in interpolation, analysis uses Probability score rather than read genotype (genotype call).

For interpolation full-length genome relatedness study sample, analyze the genotype number of (meta-analysis) for meta- (Hom, G. et al., N is seen by the SLE case of Illumina 550K full-length genome SNP platform gene type according to from 1310 Engl J Med 358:900-9 (2008)).Describe before the selection of SLE case sample and gene type (Hom, G. et al., N Engl J Med 358:900-9 (2008)).In addition to above-mentioned 3583 comparisons (Hom, G. et al., N Engl J Med 358: 900-9 (2008)), it is thus achieved that also include 4564 after approval from publicly available cancer genet susceptibility label The control sample of (Cancer Genetics Markers of Susceptibility (CGEMS)) project (it is derived from URL: cgems.cancer.gov).Above-mentioned data quality control is used to filter (Hom, G. et al., N Engl J Med 358:900-9 (2008) sample of whole 7859 comparisons) is checked.IMPUTE version 1 is used (to be derived from afterwards URLwww.stats.ox.ac.uk/～marchini/software/gwas/impute.html) infer use HapMap Phase II CEU sample is as gene type (Marchini, J. et al., the Nat.Genet.39:906-913 of reference (2007)).SNPTEST is used (to be derived from URLwww.stats.ox.ac.uk/～marchini/software/gwas/ Snptest_v1.1.4.html) relatedness statistics (Marchini, J. et al., Nat.Genet.39:906-913 are generated (2007)).Specifically, additive model (Frequentist 1 option in SNPTEST) is used to generate relatedness statistics, right The uncertainty of interpolation genotype is adjusted (-proper the option in SNPTEST).The sorted lists of relatedness statistics is used for Replication region described in selection.

Colony's layering (Population Stratification) of replicate sample

For each copy group (replication cohort), use ancestors' information flag thing to correct possible colony and divide Layer.Use the subset of 5486 the incoherent ancestors' information flag things having passed through strict quality control standard, use Central genetic variation component (Price et al., the Nat Genet 38 (8): 904-09 of top ten inferred by EIGENSTRAT software (2006)).Outlier (being defined as σ ＞ 6) is removed from each sample sets.Specifically, 27 something lost are eliminated from U.S.'s group respectively Pass outlier, and eliminate 45 outliers from Sweden's group.Replicate in set in the U.S. and Sweden and all observed along front two A certain degree of colony layering of individual characteristic vector.In order to correct case-control layering, use one of following strategy: (1) is to can The U.S.'s duplication data set and the Sweden that obtain genotype data replicate data set application and are incorporated in EIGENSTRAT The correction of Cochran-Armitage statistic of test；(2) in the Swede's data analyzing interpolation, key component conduct is used Covariant in Logic Regression Models.

Correlation analysis

For American's data, after the allelic association test implementing uncorrected degree of freedom 1, it was observed that test Some of statistical value expand (inflation) (PLINK (Purcell, S. et al., Am J Hum Genet 81:559-75 (2007))).In order to correct the colony's layering in American's sample, 5486 incoherent ancestors' information flag things are used to carry out Principal component analysis (EIGENSTRAT).First, heredity outlier (being defined as σ ＞ 6) is removed.Secondly, 1129 cases are calculated With the Cochran-Armitage trend chi square test statistical value of the SNP of each gene type in 2991 comparisons, re-use The test statistics of each SNP in front four characteristic vectors regulation EIGENSTRAT.Calculate test statistics based on each SNP Double tail p values of value.After correcting colony's layering, the λ of American's sample_gcIt is 1.05.

For Swede's data, use 5486 in 12K sample and extra Illumina 317K compare gene divide Ancestors' information flag thing that type is crossed, checks the colony the hidden layering of Sweden's group.After removing heredity outlier, there are 834 diseases Example and 515 are to impinging upon gene type on the 12K chip of customization, and 823 are divided impinging upon gene on Illumina 317K chip Type.By the weight of 6789 SNP that the test statistics performed in EIGENSTRAT correction is used between two Illumina arrays Stacked group.In order to correct in 12K sample gene type and in Illumina 317K sample 4605 SNP groups of interpolation point Layer, employs above-mentioned front four characteristic vectors determined different as the covariant of the Logic Regression Models performed in SNPTEST, because EIGENSTRAT is not intended to the genotype data for interpolation.A small group is not captured by Illumina 317K SNP interpolation 1250 labels only on the 12K chip of customization, 834 cases of gene type and 515 comparisons are analyzed.? After correcting colony's layering, the λ of Swede's sample_gcIt is 1.10.

Meta-analyzes

The z-score method using weighting carries out meta-analysis.In order to combine the result of different group, allele is positioned On the forward chain of No. 36 canonical sequences of human genome at US National Biotechnology Information center (NCBI), to avoid and C/G The ambiguity relevant with A/T SNP.The human genome canonical sequence of NCBI is available from URL:www.ncbi.nlm.nih.gov.Also See Pruitt et al., Nucl.Acids Res.35 (database issue): D61-D65 (2007).Consider relative to arbitrarily With reference to allelic effect direction, the P value of each group is converted into z-score.By taking sample size flat of each group Root, then by its summation divided by the square root of total sample size, weights each z-score, calculates the weighted sum of z-score.Will The combination z-score of Swede and American's copy group is converted into single tail p value.The z-score that meta-analyzes is converted into two tail p values, And calculate the evidence of relatedness.Think and cross threshold value 5x10^-8SNP to SLE inundatory relevant.Show not over full-length genome Write property, have less than 1x10^-5The locus of combination p value be considered as strong material standed for.The METAL that use can freely obtain is soft Part bag (it is available from URL:www.sph.umich.edu/csg/abecasis/Metal) carry out meta-analysis method.In order to Calculate the odds ratio collected, use Cochran-Mantel-Haenszel (CMH) method that METAL software performs.Odds ratio Calculating is that the risk relative to each SNP is allelic.Additionally, the risk allele relative to each SNP calculates comparison In weighted average gene frequency.

Percentage ratio variance explains (Percent Variance Explained)

Have less than 1x10 for SNP relevant to SLE before with in our duplication is studied^-5Meta p value SNP, calculates the percentage ratio that variance is explained.Use liability threshold model (liability threshold model), wherein false If SLE has potential liability (liability) mark being generally distributed with average 0 and variance 1.Assume that SLE is at ordinary group In prevalence rate be 0.1%.In order to calculate the threshold value of each genotype, use the gene frequency in comparison and divide with us The effect-size that odds ratio (OR) in analysis is corresponding.

Transactional analysis

In order to find the epistatic effect between top signal, the list of all SNP that collected in table 2,4 and 6, and use The epistasis option performed in PLINK, carries out transactional analysis to each copy group.In order to obtain bigger statistical power, Implement pure analysis of cases (case-only analysis).After correcting test number, the significance level at p ＜ 0.05 is not sent out What SNP-SNP incumbent interacts.

Condition analysis

Show and the genome area of SLE High relevancy each, select to show the SNP of peak signal.Use PLINK is as the condition of this SNP, and finds other and show and the SNP of SLE High relevancy.

Large-scale research discriminating TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10 of replicating is systemic lupus erythematosus (sle) Novel risk locus

Existing full-length genome relatedness (GWA) and Candidate Gene Study authenticated at least 15 and reached full-length genome Significance (P ＜ 5x 10^-8) community risk allele.These include producing important to acquired immunity and autoantibody Gene (HLA II class allele, BLK, PTPN22 and BANK1), and play in innate immunity and interferon signal are conducted Effect gene (ITGAM, TNFAIP3, STAT4 and IRF5) (Cunninghame Graham, D.S. et al., Nat.Genet.40:83-89 (2008)；Graham, R.R. et al., Nat.Genet.40 (9): 1059-61 (2008)； Graham, R.R. et al., J Intern Med 265:680-88 (2009)；Harley, J.B. et al., Nat.Genet.40: 204-10(2008)；Hom, G. et al., N Engl J Med 358:900-9 (2008)；Kozyrev, S.V. et al., Nat.Genet.40:211-6 (2008)；Sawalha, A.H. et al., PLoSONE 3:e1727 (2008)；Sigurdsson, S. Et al., Am J Hum Genet 76:528-37 (2005)).In order to differentiate other risk genes seat, to 2446 locus SNP implement targeting replicate research, described locus existing to 1310 cases and 7859 comparison GWAS7 scanning in Show nominal p value ＜ 0.05.Also by from the SNP in the SLE risk genes seats reported before 25, from other self Immunological disease prompting 35 locus in 42 SNP and more than 7000 ancestors' information flag thing gene types.Experimental design Summary show in FIG.Above-mentioned SNP is incorporated into the SNP array of Illumina customization.Array is to the U.S. and the independence of Sweden Case and crt gene typing.Use Illumina 310K SNP array is by 823 Swede's crt gene typings, as above " method " is described, analyzes variant.

Specifically, as it has been described above, devise by ＞ 12, the customization SNP array of 000 variant composition, gene type is 2 The SLE case of class independence and control population, respectively from U.S.'s (1129 SLE cases and 2991 comparisons) and (834, Sweden SLE case and 1338 comparisons).Including the case/control sample of 2215 stages alzheimer's disease in American's comparison, this is recognized For being acceptable as comparison, because the hereditary basis of SLE and stages alzheimer's disease estimates it is separate.Afterwards, application data Sample that mass filter removal capacity is low and SNP, colony's outlier and repetition/relevant individuality (sees above " side Method ").After these quality control surveys, examine the final set of 10848 SNP, as shown in Figure 1.Calculate 3735 variants Relatedness statistical value, and use 7113 ancestors' information flag things correction colony's layering (seeing above " method ").

First 25 variants (from 23 locus) (seeing table 2) that report before is relevant to SLE are examined.We are also Find other evidences of the relatedness about 21 variants (P ＜ 0.05), be included in existing data splitting concentration and reach full base Because of group significance (P ＜ 5x10^-8) 9 locus.Is HLA II class DR3 (DRB1* in the significant result of full-length genome 0301), IRF5, TNFAIP3, BLK, STAT4, ITGAM, PTPN22, PHRF1 (KIAA 1542) and TNFSF4 (OX40L).Should Analysis is that the variant of 9 locus provides extra evidence, reports the full genome of significance in the research before one Group level: HLA*DR2, TNFAIP3 (rs6920220), BANK1, ATG5, PTTG1, PXK, FCGR2A, UBE2L3 and IRAK1/ MECP2。

Candidate Gene Study earlier authenticated MECP2 potential risks allele (Sawalha, A.H. as SLE Et al., PLoS ONE 3:e1727 (2008)).But, in existing data set, show the strongest near the SNP of IRAK1 Relatedness evidence, wherein IRAK1 is the key gene of toll sample receptor 7 and 9 signal conduction, is positioned at around MECP2 and differentiates Linkage disequilibrium region in.The most also report similar discovery (Jacob, C.O. et al., Proc.Natl.Acad.Sci.USA (2009)), in addition it is also necessary to other work determine the cause and effect etc. in IRAK1/MECP2 locus Position gene.We have found other evidences of relatedness about 3 locus Ts YK2, ICA1 and NMNAT2, these are 3 years old Show significance before individual locus but do not have full-length genome level relatedness evidence (Harley, J.B. et al., Nat.Genet.40:204-10 (2008)；Sigurdsson, S. et al., Am JHum Genet 76:528-37 (2005)).Right Before 4, variant LYN, SCUBE1, TLR5 and LY9 of prompting do not observe any at the data set values of combination The evidence of relatedness.

In order to differentiate new SLE risk genes seat, we examine 3188 SNP altogether, these SNP come comfortable we Full-length genome data set shows 2446 different locus (Hom, G. et al., the N Engl of relatedness evidence from SLE J Med 358,900-9 (2008)), described data set includes 7859 comparison set in 1310 SLE cases and extension 502033 SNP that middle gene type is crossed.Use this data set, with Phase II HapMap CEU sample as reference, interpolation 2.1M variant of ＞ (seeing above " method "), and generate the relatedness statistical value list of ordered arrangement.For wrapping It is contained on the duplication array of customization, selects the variant of P ＜ 0.05.For gene type effectively, authenticated related variants (r² ＞ 0.2) group, then select at least 2 SNP from the group of each minimum p value ＜ 0.001.For remaining group, will group have The SNP having minimum p value is included.In replicate sample, calculate relatedness statistical value (seeing " method "), and observe relatively Significant enrichment in the duplication result of intended zero cloth.The SLE risk allele reported before eliminating, has 134 bases Because seat has P ＜ 0.05 (expection 64, P=2x10^-15) and 12 locus there is P ＜ 0.001 (expection 1, P=1x10^-9), carry Show and there is true positives.

Fig. 2 A-2 each displays by TNIP1 (Fig. 2 A), PRDM1 (Fig. 2 B), JAZF1 (Fig. 2 C), UHRF1BP1 (figure 2D) and around the locus that defines of IL-10 (Fig. 2 E) in 500kb region, relative to the genomic locations in x-axis, y-axis is marked and drawed Full-length genome relatedness scanning relatedness result.In each Fig. 2 A-2E, closed square represents maximally related label Meta-analyzes P value.For each Fig. 2 A-2E, the P value from genome scanning is labeled to represent relevant to full-length genome The LD of variant: have a circle to represent r²＞ 0.8, dashed circle, r²＞ 0.5；Dapple circle, r²＞ 0.2；Empty circles r²＜ 0.2.Along the bottom of each figure of Fig. 2 A-2E, (solid black line) and the known mankind in each figure is shown below CEU HapMap The recombination fraction of gene.In Fig. 2 B (PRDM1), reported before having been marked near ATG5 gene by solid black circle With independent SLE risk genes seat (rs2245214).Fig. 2 F shows at 1963 cases and 4329 comparison replicate samples In, 1256 independent SNP (r with any other SNP in array²＜ 0.1) P value histogram.Plant in zero, in Fig. 2 F Expected result density has been marked with dotted line.As shown in Figure 2 F, it was observed that the significant enrichment of the result less than P ＜ 0.05.

Therefore, replicate research identifying 5 new SLE risk genes seats, these 5 locus have exceed full-length genome show Combination P value (the P ＜ 5x10 of work property threshold value^-8): TNIP1, PRDM1, JAZF1, UHRF1BP1 and IL10.About these locus and The detail statistics relatedness of other locus shows in table 4 below.

Variant rs7708392 on 5q33.1 in all 3 groups with SLE significant correlation, there is combination P=3.8x10^-13 (Fig. 2 A), this variant is positioned in the intron of interaction protein 1 (TNIP1) of TNF-α induced protein 3 (TNFAIP3).Recently Find that the variant near TNIP1 has effect (Nair, R.P. et al., Nat Genet 41:199-204 to psoriasic risk (2009)), but SLE and psoriasis variant are separated by 21kb, and the most different Genetic signals (r²=0.001).TNIP1 It is the protein (Heyninck, K. et al., FEBS Lett 536:135-40 (2003)) interacted with TNFAIP3, but, The TNIP1 accurate effect in regulation and control TNFAIP3 still belongs to unknown.Near TNFAIP3 multiple different variants and SLE (Graham, R.R. et al., Nat.Genet.40 (9): 1059-61 (2008), Musone, S.L. et al., Nat.Genet.40 (9): 1062- 64 (2008)), rheumatoid arthritis (Plenge, R.M. et al., Nat Genet 39:1477-82 (2007)), psoriasis (Nair, R.P. et al., Nat Genet 41:199-204 (2009)) and type i diabetes (Fung, E.Y. et al., Genes Immun 10:188-91 (2009)) relatedness prompting, this path has important effect in the regulation and control of autoimmune disease.

Second risk variants (rs6568431, P=7.12x10 confirmed^-10) it is that there is tying containing PR of ZNF domain In intergenic region between 1 (PRDM1, also referred to as BLIMP1) and APG5 autophagy 5-sample (ATG5) in structure territory identified 's.The signal of rs6568431 seems the SLE risk allele rs2245214 being different from the ATG5 reported before (Harley, J.B. et al., NatGenet 40:204-10 (2008)) (seeing table 4), because rs6568431 and rs2245214 There is r²＜ 0.1, and rs2245214 be mixed with rs6568431 conditional logic return after still with SLE significant correlation (P ＜ 1x10^-5) (Fig. 2 B).

The promoter region of 1 (JAZF1) arranged side by side with another zinc finger gene is the SLE locus of the 3rd new confirmation (rs849142, P=1.54x10^-9) (Fig. 2 C).Interestingly, before same variant with the risk of type 2 diabetes mellitus (Zeggini, E. et al., Nat Genet 40:638-45 (2008)) and height differences (Johansson, A. et al., Hum Mol Genet 18:373-80 (2009)) it is associated.Carcinoma of prostate allele rs10486567 near the separation of JAZF1 (Thomas, G. et al., NatGenet 40:310-5 (2008)) does not the most show the evidence of any relatedness.

ICBP90 Binding Protein 1 (UHRFBP1, rs11755393, P=2.22x10^-8) non-synonym allele (R454Q) the 4th new risk genes seat in SLE is defined.This allele is in the binding partner of the supposition of UHRF1 Non-conservative amino acid change, UHRF1 be relevant to multiple paths transcribe and the factor that methylates (Arita, K. et al., Nature 455:818-21 (2008)).UHRFBP1 risk allele is positioned at the linkage disequilibrium region of extension, described district Territory covers multiple gene, including micronuclear ribonucleoprotein peptide C (SNPRC), SNPRC be SLE autoantibody often for A part for RNA processing complex.

The 5th the novel SLE locus differentiated is IL-10 INTERLEUKIN-10 (IL10；Rs3024505, P=3.95x10^-8) (figure 2E).IL-10 is important immunoregulation cytokine (Diveu, C. et al., the Curr by lowering immunne response function Opin Immunol 20:663-8 (2008)), the variation in IL-10 with associating by inconsistent report of SLE (Nath, S.K. et al., Hum Genet118:225-34 (2005)).The variant relevant to SLE and discriminating at present are for ulcerative colitis (Franke, A. et al., Nat Genet 40:1319-23 (2008)) and type i diabetes (Barrett, J.C. et al., Nature Genetics 41:703-707 (2009)) contribute the SNP of risk identical, prompting may have shared between these obstacles The pathophysiology of IL10 path.

P ＜ 1x10 is used in the replicate sample of combination^-5Significance threshold value, authenticated 21 extra SLE candidate's wind Danger locus (table 4).Under zero distribution occasion that meta-analyzes, it is contemplated that less than 1 (0.01) locus, there is P ＜ 1x10^-5(P =8x10^-77), several pointing out in these locus are probably the locus of true positives.Time interesting in this list Select gene to include: a) interferon regulatory factor 8 (IRF8), its be prompted in GWAS before (Graham, R.R. et al., Nat.Genet.40 (9): 1059-61 (2008)), and its family member IRF5 and IRF7 both fall within the SLE risk of confirmation In locus；B) TAO kinases 3 (TAOK3), it be in lymphocyte express kinase whose missense allele (rs428073, N47S)；C) lysosome transport regulatory factor (LYST), its sudden change causes the Chediak-Higashi syndrome of the mankind, and this is It is characterized as the complex disease of lymphoproliferative disorder；And d) interleukin 12 receptor β 2 (IL12RB2), this locus includes IL23R and SERPBP1, but seem to be different from autoimmune disease inflammatory bowel, psoriasis and ankylosing spondylitis were reported IL23R variant (Duerr, R.H. et al., Science 314:1461-3 (2006)).

GWA research at present is noteworthy characterized by between different complex diseases the substantial amounts of overlapping genes seat shared (Zhernakova, A. et al., Nat Rev Genet 10:43-55 (2009)).We test 42 from 35 locus Individual variant (table 6 and 7), is reported as the autoimmune disease risk allele relevant to SLE before described locus.But, do not have Term single gene seat is had to have unadjusted P value ＜ 5x10^-8, however, it was found that the enrichment of associated alleles.From 35 tests In locus (42 variants altogether), there are 5 allele to have unadjusted P ＜ 0.0004 and (are less than by expected from probability One result, P=4.4x10^-12), and after the locus illustrated before for 35 carries out Bonferroni correction, there is P ＜ 0.05.For each in these 5 variants, the allele reported before allele coupling relevant for SLE also has There is identical effect direction (table 6).Observe relatedness (rs1990760, the p=of the missense allele highly significant of IFIH1 3.3x10^-7), (Smyth, D.J. et al., Nat Genet relevant to type i diabetes and Grave ' s disease before this allele 38:617-9 (2006)；Sutherland, A. et al., J Clin Endocrinol Metab 92:3338-41 (2007)).Also Observing the relatedness of the missense allele (R32Q) of complement factor B (CFB, rs641153), this gene is positioned at Group III HLA Region in, be risk allele (Gold, B. et al., the Nat Genet of age-related macular degeneration through checking 38:458-62 (2006)).The HLA regional variety (DR2/DR3) that SLE risk allele is relevant to other and SLE is the most notable Linkage disequilibrium (LD), after the conditional logic regression analysis incorporating DR2 and DR3, remain significant.HLA is multiple Miscellaneous hereditary district, but surprisingly the allele of SNP rs641153 has and the AMD risk allele reported The protective effect that (Gold, B. et al., Nat Genet 38:458-62 (2006)) is almost identical.Indicate 5 candidate diseases etc. Other researchs of position gene.

Additionally, table 7 provides the detailed summary statistics of 42 variants differentiated in other autoimmune diseases.Make us sense Interest, the variant of notable risks and assumptions CTLA4, IL23R, NOD2 and CD40 in other autoimmune diseases does not appears to table Reveal any and SLE relatedness evidence.

Use 26 SLE risk allele (locus reported in table 2 before 21, and 5 above-mentioned novel SLE locus), implement some extra analyses.Paired transactional analysis is carried out, with SLE before with the locus confirmed (Harley, J.B. et al., Nat Genet 40:204-10 (2008)) and other complex diseases (Barrett, J.C. et al., Nat Genet 40:955-62 (2008)) document consistent, do not observe the evidence of any non-cumulative interaction.Use Conditional logic regression analysis, does not find that the risk of any single risk genes seat is worked by multiple independent allele Any evidence.Afterwards, method (Barrett, J.C. et al., Nat Genet40:955-62 that Barrett et al. describes are used (2008)), the SLE risk allele of each confirmation the percentage ratio that variance is explained has been estimated.HLA-DR3, IRF5 and STAT4 The most evaluated genetic variance accounting for ＞ 1%, and remaining locus accounts for the variance less than 1% respectively.Sum it up, these 26 SLE risk genes seat explains the total genetic predisposition of SLE of about 8%.

It is to verify effective research design (Hirschhorn, the J.N. etc. of other risk genes seats that targeting replicates GWAS result People, Nat Rev Genet 6:95-108 (2005)).But, for lack acceptable for full-length genome significance can The probability of the duplication result of the P value standard accepted, the only available data of only a few.In our current research, duplication enumerates From the variant of all P ＜ 0.05 that original GWAS studies.As it is shown on figure 3, the P value in GWAS research is the lowest, divide replicating meta- The probability obtaining material standed for or proofing state in analysis is the highest.Interestingly, at GWAS P between 0.05 and 0.01 Variant group existing research in, there is no the result of any material standed for or checking, although described group accounts in duplication test All variants～50%.These results can be used for instructing other targeting research design, although really at plan replication work In also need to think over the size of original GWAS colony, replicate sample size, disease composition and the effect quantity of candidate variant.

These data further provide evidence, it was demonstrated that for immune Secondary cases and innate defence function weight Covariation in the gene wanted, is important for establishing risk SLE occur.Although the allele of each discriminating is the most right A part for overall genetic risk is responsible for, and these and other ongoing researchs are that the pathogenesis of lupus provides new regarding Angle, has pointed out new target and path for drug discovery and research and development.

Embodiment 2

Again check order to the cause and effect of BLK is allelic and differentiates

As it has been described above, BLK is identified as reaching full-length genome significance (P ＜ 5x10^-8) the risk genes relevant to SLE Seat.In order to further characterize the hereditary basis of this relatedness and differentiate cause and effect allele, BLK locus is carried out again by we Order-checking research and reporter gene expression hereinafter described measure.

For research of again checking order, all 13 exons and the 2.5kb upstream promoter to the BLK locus in DNA Sequence checks order again, and described DNA is isolatable from the resources bank autoimmune disease biomarker cooperation subsidized by NIH/NIAMS 192 patients (Bauer et al., PLoS medicine 3 (12): e491 (2006)) of network (ABCoN), and New York cancer item 96 comparisons of mesh (NYCP) are individual (Mitchell et al., J.Urban Health 81:301-10 (2004)).Genomic DNA Be before order-checking according to manufacturer code amplification full-length genome (Qiagen, Valencia, CA., article No. 150045).

Again the result checked order shows, be found that 17 sudden changes (10 non-synonyms, 7 same in the coding region of BLK gene Justice) (table 8).These suddenly change, and none shows the frequency more significantly higher than comparison in case.The overall frequency of nonsynonymous mutation Rate is not significantly higher than comparison (7/96) in case (14/191).

Additionally, identify multiple common mutations (display is in table 9) in the noncoding region of BLK.Three SNP (rs4840568, rs1382568 [SNP (A/C/G) of three equipotentials；Risk allele it is identified as before C allele] and Rs922483 (SEQ ID NO:13)) show and locus (Hom et al., the N Engl J Med of discriminating in GWAS before 358:900-09 (2008)) r²The relatedness of ＞ 0.5 (rs13277113, odds ratio, 1.39, P=1x10^-10).Fig. 4 shows (software freely can obtain use Haploview from URL www.broadinstitute.org/haploview/haploview ?；See Barrett J.C. et al., Bioinformatics 21:263-65 (2005)) generate, in the promoter region of BLK Linkage disequilibrium (LD) block (block) in territory is (with r²Display).The top of figure shows the schematic diagram of BLK promoter region, mark Go out the relative position of the SNP differentiated.The cited r between SNP²Value display is in frame.LD intensity between two SNP Use r²Value represents, it is provided that in each frame.Marked the locus differentiated from GWAS with black runic on the top of figure (rs13277113) and again check order differentiate three SNP (rs4840568, rs1382568 and rs922483 (SEQ ID NO: 13))。

This any common variation that research does not disclose in BLK coding region of again checking order.But, identify promoter region Three typical variant (rs4840568, rs1382568 and rs922483 (SEQ ID NO:13)) are as the SLE wind of BLK Yu increase The one or more potential cause and effect allele of the biological effect that danger is associated.It is used for each this kind of variation being detailed below Luciferase reporter gene measures, and further characterizes described relatedness.

Sudden change in table 8.BLK coding region

Common variation (' rs922483 ' is disclosed as SEQ ID NO:13) in table 9.BLK noncoding region

Implement luciferase reporter gene to measure, study three SNP rs4840568, rs1382568 and rs922483 (SEQ ID NO:13) effect to the gene expression that BLK mediates.Use the individuality of the haplotype carrying risk or devoid of risk The upstream sequence (-2256 to+55bp) of genomic DNA amplification BLK.Each PCR primer is cloned into pCR2.1-TOPO carrier (Invitrogen, Carlsbad, CA；Article No. K4500-01) in, then it is subcloned into pGL4 luciferase reporter gene carrier (Promega, Madison, WI；Article No. E6651) in.Use the construct carrying devoid of risk haplotype as template for mutation (Stratagene, La Jolla, CA；Article No. 10519-5), produce various haplotype.

As follows for the primer of PCR amplification: forward: CCACCTCTCTTCCGCCTTTCTCAT (SEQ ID NO.:1)；Instead To: TTTCATGGCTTGTGGCTTTCTGCC (SEQ ID NO.:2).Primer for mutation is set forth in table 10 below.

Table 10. mutagenic primer list

Renilla luciferase control is used to report sub-carrier pRL-TK (Promega, Madison, WI；Article No. E2241) It is normalized.Cell line BJAB (is had the lasting lymphoid cell line (derived from bone marrow) of B cell feature, lacks Epstein-Barr viral genome, from the lymphoma of three people；Klein et al., Proc.Natl.Acad.Sci.USA 71:3283-86 (1974)) or Daudi cell line (American Type culture collecting center (ATCC) article No. CCL-213) for turn Dye.For transfection every time, useDevice (Lonza, Walkersville Inc., Walkersville, MD (Lonza Group Ltd., Switzerland)；Article No. AAD-1001), with every kind of carrier of 5 μ g DNA transfects 5x10⁶Cell.Daudi cell uses cell lineTest kit L (Lonza, article No. VCA- 1005) andDevice program A-030.Bjab cell uses cell lineTest kit V (Lonza, article No. VCA-1005) andDevice program T-020.All of transfection is all repeated twice or repeats The carrying out of three times.After transfection, cell hatches 16 hours at 37 DEG C.After incubation, harvesting, use according to the explanation of manufacturerReport sub-mensuration system (Promega, Madison, WI；Article No. E1960) measure luciferase work Property.

In above-mentioned Luciferase reporter mensuration system measure every kind of SNP:rs4840568, rs1382568 and The effect of the gene expression that BLK mediates is shown in Figure 5 by rs922483 (SEQ ID NO:13).Mutation produced is different single (wild type) haplotype 22-GAC of unit type and devoid of risk (Fig. 5 A-F each in hollow strips) and the haplotype 22-ACT of risk (Fig. 5 A-F each in shaded bar) compares.

Fig. 5 A and 5B shows that SNP rs922483 (C ＞ T) (SEQ ID NO:13) is at BJAB (Fig. 5 A) and Daudi cell (Fig. 5 B) results in the remarkable effect to the gene expression that BLK mediates.Haplotype 22-GAC (hollow strips) phase with devoid of risk Ratio, haplotype 22-ACT shows transcriptional activity in two kinds of cell line and reduces almost 50%.Containing the allelic haplotype of T Continuous exhibition goes out the activity lower than the allelic haplotype containing C.5 independent experiments have been carried out in bjab cell, Daudi cell has carried out 6 independent experiments.The data of display represent that the meansigma methods +/-in mensuration in triplicate is average The standard error (s.e.m.) of value；* p ＜ 0.05, * * p ＜ 0.01, * * * p ＜ 0.001 (t inspection).

Fig. 5 C and 5D shows that SNP rs1382568 (A ＞ C/G ＞ C) is situated between without result in BLK in every kind of cell line Any remarkable effect of the expression led.Compared with the haplotype 22-GAC (hollow strips) of devoid of risk, two kinds of haplotype 22-GCC and 22-GGC (bar a little) shows the uciferase activity of similar level.5 independent realities have been carried out in bjab cell Test, Daudi cell has carried out 6 independent experiments.The data of display represent the meansigma methods +/-in mensuration in triplicate s.e.m.；* p ＜ 0.05, * * p ＜ 0.01, * * * p ＜ 0.001, ns=be not notable (t inspection).

Fig. 5 E and 5F show SNP rs4840568 (G ＞ A) in bjab cell or Daudi cell all without result in right The remarkable effect of the expression of BLK mediation.In bjab cell, haplotype 22-AAC (bar a little) and the haplotype of devoid of risk Difference between 22-GAC (hollow strips) does not has significance,statistical (Fig. 5 E), but is statistically significant in Daudi cell (Fig. 5 F).The haplotype 22-GAC (hollow strips) comparing devoid of risk in view of haplotype 22-ACC (bar a little) does not show The defect of any uciferase activity, A allele becomes the allelic probability of cause and effect and reduces (Fig. 5 F) greatly.Display Data represent meansigma methods +/-s.e.m. in mensuration in triplicate；* p ＜ 0.05, * * p ＜ 0.01, * * * p ＜ 0.001, ns=is not notable (t inspection).

Show that (GT) repetition in BLK promoter upstream region can be as the enhancer of BLK gene expression before Play a role (Lin et al., J Biol Chem 270:25968 (1995)).Therefore, we are also tested for the length that (GT) repeats Whether can affect the transcriptional activity of BLK promoter.In order to implement these experiments, use above-mentioned countermeasure, select from taking simultaneously The individual genome DNA sample repeating (SEQ ID NO:14) or 22 (GT) repetition (SEQ ID NO:15) with 18 (GT) enters Row clone.Check order five carriers, verifies that (GT) that they contain correct length repeats.As shown in Figure 6, at Luciferase reporter In mensuration, the haplotype repeating (SEQ ID NO:14) containing 18 (GT) shows and repeats (SEQ ID NO:15) containing 22 (GT) The transcriptional activity level that haplotype is similar.The data of display represent meansigma methods +/-s.e.m. in the mensuration being repeated twice；Ns= Not notable (t inspection).

Sum it up, the result that these results of BLK examining order again and luciferase reporter gene measure represents SNP Rs922483 (C ＞ T) (SEQ ID NO:13) is the cause and effect allele causing the BLK reduced to transcribe, and described BLK transcribes minimizing Biological effect be to increase SLE risk relevant.Additionally, result shows, T allele (the SEQ ID of rs922483 NO:13) gene expression dose making BLK mediate reduces 50%.

Interestingly, it is noted that rs922483 (SEQ ID NO:13) is positioned at the evolution of the First Exon of BLK In conservative region, in possible people's transcriptional start site.The consensus of people's Inr motif differentiates as YYANWYY (IUPAC core Thuja acid code).Juven-Gershon et al., Dev.Biol.339:225-229 (2010).At SNP rs922483 (SEQ ID NO:13), in, second base in Inr district is changed relative to common sequence motifs.Therefore, SLE risk unit type Inr sequence is CTACCTC, and " wild type " haplotype Inr sequence is CCACCTC.Second base in conservative Inr motif is modified in prompting The affinity of TFIID transcription complex may be changed, cause viewed above-mentioned transcribe in difference.

Claims

1. for detecting in the biological sample be derived from object described in the variation in TNIP1 locus and optional earth's surface 4 The instrument of the existence of the variation at least one SLE risk genes seat preparation for identify in object lupus test kit or Preparing the purposes in product, the variation in wherein said TNIP1 locus is the nucleotide sequence as shown in SEQ ID NO:16 The cytosine allele of single nucleotide polymorphism (SNP) at middle rs7708392, and wherein at least one SLE wind described in table 4 Variation in the locus of danger occurs in the position pair with the single nucleotide polymorphism (SNP) of at least one locus described in table 4 On the nucleotide position answered, and wherein object suspects suffer from lupus.

2. the purposes of claim 1, wherein said instrument is at least two locus or at least three locus or extremely Lack four locus or at least five locus or at least ten locus or at least 13 locus or 26 locus Middle detection variation.

3. the purposes in claim 1, wherein said instrument is additionally operable to detect the existence of the variation in BLK locus, wherein BLK In variation be single nucleotide polymorphism (SNP) at rs922483 in the nucleotide sequence as shown in SEQ ID NO:13 Thymus pyrimidine allele.

4. the purposes any one of claim 1-3, the variation at least one locus wherein said also includes one or many The individual variation in PRDM1, JAZF1, UHRF1BP1 and IL10, and wherein

Variation in PRDM1 is the adenine of SNP at rs6568431 in the nucleotide sequence as shown in SEQ ID NO:17 Allele；

Variation in JAZF1 is that at rs849142, the thymus of SNP is phonetic in the nucleotide sequence as shown in SEQ ID NO:18 Pyridine allele；

Variation in UHRF1BP1 is the bird of SNP at rs11755393 in the nucleotide sequence as shown in SEQ ID NO:19 Purine allele；And

Variation in IL10 is the adenine of SNP at rs3024505 in the nucleotide sequence as shown in SEQ ID NO:20 Allele.

5. the purposes any one of claim 1-3, the variation at least one locus wherein said also includes one or many The individual variation in IFIH1, CFB, CLEC16A, IL12B and SH2B3, and wherein

Variation in IFIH1 is that at rs1990760, the thymus of SNP is phonetic in the nucleotide sequence as shown in SEQ ID NO:21 Pyridine allele；

Variation in CFB is the guanine etc. of SNP at rs641153 in the nucleotide sequence as shown in SEQ ID NO:22 Position gene；

Variation in CLEC16A is the gland of SNP at rs12708716 in the nucleotide sequence as shown in SEQ ID NO:23 Purine allele；

Variation in IL12B is the guanine of SNP at rs6887695 in the nucleotide sequence as shown in SEQ ID NO:24 Allele；And

Variation in SH2B3 is the thymus of SNP at rs17696736 in the nucleotide sequence as shown in SEQ ID NO:25 Pyrimidine allele.

6. the purposes any one of claim 1-3, making a variation at least one locus wherein said, it is one or more also to include PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B and SH2B3 in variation, and wherein

Variation in UHRF1BP1 is the bird of SNP at rs11755393 in the nucleotide sequence as shown in SEQ ID NO:19 Purine allele；

Variation in IL10 is the adenine of SNP at rs3024505 in the nucleotide sequence as shown in SEQ ID NO:20 Allele；

7. the purposes any one of claim 1-3, wherein the variation bag at least one the SLE risk genes seat described in table 4 Include the SNP described in table 4.

8. the purposes any one of claim 1-3, described instrument is additionally operable to detection at least one the SLE risk described in table 6 In locus other variation, wherein other at least one locus variation occur with at least one base described in table 6 Because of on the nucleotide position that the SNP position of seat is corresponding.

9. the purposes of any one of claim 1-3, wherein detection includes carrying out measuring selected from primer extension；Allele specific Property nucleotide mix measure；Allele specific oligonucleotide hybridization assays；5 ' nucleases measure；The survey of application molecular beacon Fixed；Method for measuring is connected with oligonucleotide.

10. the purposes of claim 9, wherein said primer extension is determined as allele-specific primers and extends mensuration.

11. for determining whether object is included in the variation in TNIP1 locus and at least one described in optional earth's surface 4 The instrument of the variation in SLE risk genes seat has the examination to the response of lupus therapeutic agent of the object of lupus in preparation for prediction Agent box or prepare the purposes in product, the variation in wherein said TNIP1 locus is the nucleoside as shown in SEQ ID NO:16 The cytosine allele of single nucleotide polymorphism (SNP) at rs7708392 in acid sequence, and wherein described in table 4 at least one Variation in individual SLE risk genes seat occurs in single nucleotide polymorphism (SNP) position with at least one locus described in table 4 Put on the nucleotide position of correspondence, wherein make a variation at least one locus described in TNIP1 locus and optional earth's surface 4 Existence represent the object response to therapeutic agent.

The purposes of 12. claim 11, wherein said instrument at least two locus or at least three locus or At least four locus or at least five locus or at least ten locus or at least 13 locus or 26 genes Detection variation in Zuo.

The purposes of 13. claim 11, wherein said instrument is additionally operable to detect the existence of the variation in BLK locus, wherein BLK In variation be single nucleotide polymorphism (SNP) at rs922483 in the nucleotide sequence as shown in SEQ ID NO:13 Thymus pyrimidine allele.

Purposes any one of 14. claim 11-13, the variation at least one of which locus also includes one or more PRDM1, JAZF1, UHRF1BP1 and IL10 in variation, and wherein

Variation in JAZF1 is that at rs849142, the thymus of SNP is phonetic in the nucleotide sequence as shown in SEQ ID NO:18 Pyridine allele

Purposes any one of 15. claim 11-13, the variation at least one locus wherein said also include one or Multiple variations in IFIH1, CFB, CLEC16A, IL12B and SH2B3, and wherein

Purposes any one of 16. claim 11-13, the variation at least one locus wherein said also include one or Multiple variations in PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B and SH2B3, and wherein

Purposes any one of 17. claim 11-13, wherein variation bag at least one the SLE risk genes seat described in table 4 Include the SNP described in table 4.

18. the purposes any one of claim 11-13, wherein said instrument is additionally operable to determine whether object is included in table 6 institute Other variation at least one the SLE risk genes seat stated, wherein the variation of other at least one locus occurs On the nucleotide position corresponding with the SNP position of at least one locus described in table 6.

19. for detecting in the biological sample be derived from object described in the variation in TNIP1 locus and optional earth's surface 4 At least one SLE risk genes seat in the instrument of existence of variation in preparation for diagnosing or predict the examination of lupus in object Agent box or prepare the purposes in product, wherein said diagnosis or prediction include:

A () biological sample is known include or suspect include comprise TNIP1 locus and optionally described in earth's surface 4 at least one The nucleic acid of the variation in individual SLE risk genes seat；

B the variation in () described TNIP1 locus is in the nucleotide sequence as shown in SEQ ID NO:16 at rs7708392 The cytosine allele of single nucleotide polymorphism (SNP)；

C () variation at least one the SLE risk genes seat described in table 4 includes the SNP described in table 4 or is positioned at and table 4 institute On the nucleotide position corresponding for SNP stated；With

D () existence of variation at least one locus described in TNIP1 locus and optional earth's surface 4 is lupus in object Diagnosis or prediction.

20. the purposes of claim 19, wherein said instrument at least two locus or at least three locus or At least four locus or at least five locus or at least ten locus or at least 13 locus or 26 genes Detection variation in Zuo.

The purposes of 21. claim 19, the variation at least one locus wherein said also includes one or more Variation in PRDM1, JAZF1, UHRF1BP1 and IL10, and wherein

The purposes of 22. claim 19, wherein makes a variation at least one the risk genes seat described in table 4 and includes described in table 4 SNP。

The purposes of 23. claim 19, wherein:

A () biological sample is known also includes or suspects the nucleic acid that further comprises other variation comprised in BLK locus；

B () other variation in BLK locus includes single nucleotide polymorphism (SNP), or be positioned at and single nucleotide polymorphism (SNP) nucleotide position that position is corresponding, wherein said SNP is rs922483 (SEQ ID NO:13), wherein said variation It it is the thymus pyrimidine at the chromosome position 11389322 on human chromosome 8；With

C () existence of other variation in BLK locus is diagnosis or the prediction of lupus in object.

The purposes of 24. claim 19 or 23, wherein:

A () biological sample is known also includes or suspects further comprises at least one the SLE risk genes seat comprised described in table 6 Other variation nucleic acid；

B () other variation at least one locus includes the SNP described in table 6 or is positioned at corresponding with the SNP described in table 6 On nucleotide position；With

C () existence of other variation at least one locus is diagnosis or the prediction of lupus in object.

Purposes any one of 25. claim 19-23, wherein detection includes carrying out measuring selected from primer extension；Allele Specific nucle mixes and measures；Allele specific oligonucleotide hybridization assays；5 ' nucleases measure；Application molecular beacon Mensuration；Method for measuring is connected with oligonucleotide.

The purposes of 26. claim 25, wherein said primer extension is determined as allele-specific primers and extends mensuration.

27. for detecting the hereditary variation in TNIP1 locus and optional at least one SLE risk base described in earth's surface 4 Because of the instrument of existence of the hereditary variation in seat in preparation for selecting for the lupus patient of suffering from of lupus therapeutic agent treats Test kit or prepare the purposes in product, the hereditary variation in wherein said TNIP1 locus is as shown in SEQ ID NO:16 Nucleotide sequence in the cytosine allele of single nucleotide polymorphism (SNP) at rs7708392.

The purposes of 28. claim 27, the variation at least one SLE risk genes seat wherein said also includes one or more Variation in PRDM1, JAZF1, UHRF1BP1 and IL10, and wherein

The purposes of 29. claim 27 or 28, wherein detection includes carrying out measuring selected from primer extension；Allele-specific core Thuja acid mixes and measures；Allele specific oligonucleotide hybridization assays；5 ' nucleases measure；The mensuration of application molecular beacon； Method for measuring is connected with oligonucleotide.

The purposes of 30. claim 29, wherein said primer extension is determined as allele-specific primers and extends mensuration.

31. there is the existence of the genetic tags of the risk of lupus for detection instruction in the biological sample obtained from object Instrument is used for the test kit whether evaluation object is in risk lupus occur or the purposes preparing in product in preparation, wherein said Genetic tags includes one group of at least three single nucleotide polymorphism (SNP), one of them SNP occur TNIP1 locus and its His each SNP occurs at the SLE risk genes seat described in table 4 and table 6, and wherein the SNP in TNIP1 locus is such as SEQ ID Single nucleotide polymorphism (SNP) at rs7708392 in nucleotide sequence shown in NO:16.

The purposes of 32. claim 31, wherein genetic tags includes one group of at least 4 SNP or at least 5 SNP or at least 7 SNP or at least 10 SNP or at least 15 SNP or at least 20 SNP or at least 30 SNP.

The purposes of 33. claim 31, wherein the SNP of the SLE risk genes seat of other in addition to TNIP1 selected from PRDM1, SNP in JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B and SH2B3, and wherein

The purposes of 34. claim 31, the SNP during wherein genetic tags also includes SLE risk genes seat, wherein SNP is Rs922483 (SEQ ID NO:13), and SLE risk genes seat is BLK, wherein variation is the chromosome of No. 8 chromosomes people The thymus pyrimidine of 11389322.

35. for the instrument of the existence of the genetic tags of detection instruction lupus in the biological sample obtained from object in preparation For the test kit diagnosing the lupus of object or the purposes preparing in product, wherein said genetic tags includes one group of at least three list Nucleotide polymorphisms (SNP), one of them SNP occurs to occur in table 4 and table 6 institute at TNIP1 locus and other each SNP In the SLE risk genes seat stated, wherein the SNP in TNIP1 locus is the nucleotide sequence as shown in SEQ ID NO:16 Single nucleotide polymorphism (SNP) at middle rs7708392.

The purposes of 36. claim 35, wherein genetic tags includes one group of at least 4 SNP or at least 5 SNP or at least 7 SNP or at least 10 SNP or at least 15 SNP or at least 20 SNP or at least 30 SNP.

The purposes of 37. claim 35, the wherein choosing of the SNP in each SLE risk genes seat of other in addition to TNIP1 locus From the SNP of PRDM1, JAZF1, UHRF1BP1, IL10, IFIH1, CFB, CLEC16A, IL12B and SH2B3, and wherein

The purposes of 38. claim 35, the SNP during wherein genetic tags also includes SLE risk genes seat, wherein SNP is Rs922483 (SEQ ID NO:13), and SLE risk genes seat is BLK, and wherein variation is the dyeing of No. 8 chromosomes people The thymus pyrimidine that body is 11389322.

The purposes of any one of 39. claim 35-38, wherein detection includes carrying out measuring selected from primer extension；Allele Specific nucle mixes and measures；Allele specific oligonucleotide hybridization assays；5 ' nucleases measure；Application molecular beacon Mensuration；Method for measuring is connected with oligonucleotide.

The purposes of 40. claim 39, wherein said primer extension is determined as allele-specific primers and extends mensuration.