CN102793910A - New application of casein kinase2-interacting protein-1 (CKIP-1) protein and coding gene thereof - Google Patents

Abstract

The invention discloses new application of a casein kinase2-interacting protein-1 (CKIP-1) protein and a coding gene thereof. The invention provides the CKIP-1 protein, the coding gene of the CKIP-1 protein or application of plasmids containing the coding gene of the CKIP-1 protein in preparation of medicaments for preventing and/or treating myocardial hypertrophy; and the CKIP-1 protein is shown as a sequence 1 of a sequence table. The regulating effect of the CKIP-1 protein and the coding gene thereof in myocardial hypertrophy diseases is discovered, so that a new target and a new method are sought for diagnosis and treatment of the myocardial hypertrophy, and a foundation is laid for seeking clinical diagnosis and treatment of related diseases. The new application has great value for treating and preventing the myocardial hypertrophy.

Description

The new purposes of CKIP-1 albumen and encoding gene thereof

Technical field

The present invention relates to the new purposes of a kind of CKIP-1 albumen and encoding gene thereof.

Background technology

Cardiovascular disease is one of healthy principal disease of harm humans, and annual main cardiovascular diseases's medical expense reaches 1,300 hundred million yuans, causes huge financial burden to society.Further investigation cardiovascular disease incidence mechanism and molecule mechanism are also set up new control strategy and prophylactico-therapeutic measures on this basis, reduce the mortality rate and the disability rate of cardiovascular disease, are the great basic science problems that life sciences need solve.

The myocardial cell hypertrophy be clinical multiple cardiovascular disease with pathological change, a kind of dominant response that to be heart stimulate bio-mechanical stretching and neuro humor.Though being heart, early stage myocardial hypertrophy keeps effectively kinemic a kind of compensatory mechanism; But persistent myocardial hypertrophy can cause heart to get into loses compensatory stage, period of fetus Gene A NP, BNP; β-MHC etc. express again; Irreversible myocardial hypertrophy and expansion take place then, and myocardial contraction descends, and causes heart failure.The reaction that triggers myocardial hypertrophy is relevant with the activation of many A signal pathways, comprise calcium ion/calmodulin dependence protein kinase (Calcium calmodulin-dependent protein kinases, CaMK)/HDACs/MEF2; Calcineurin (Calcineurin); The silk split plain activated protein kinase (mitogen-activated protein kinase, MAPK), phosphoinositide 3-kinase (phosphatidylinositol 3-kinase; PI3K); Protein kinase B (protein kinase B, PKB)/AKT, mammal rapamycin target protein (mammalian target of rapamycin; MTOR) and nuclear Factor-Kappa B (nuclear factor kappa B, NF-κ B) etc.This shows the regulated and control network that the loose signal path of myocardial cell is a complicacy.Seek the new gene of participation myocardial hypertrophy regulation and control and the research focus that signal path is cardiovascular field.

He Fu just laboratory is cloned into the CKIP-1 gene in 1999 from the people 22 ages in week the tire liver, express the CKIP-1 albumen that 409 aminoacid are formed.The CKIP-1 albumen n end contains a PH (pleckstrin homology) domain, has mediated its plasma membrane location through combining phospholipid, and C-terminal contains a leucine zipper, AP-1 family members' such as mediation CKIP-1 and c-Jun, JunD interaction.The Litchfield laboratory obtains same gene during through yeast two-hybrid screening kinase c K2 conjugated protein, the called after casein kinase conjugated protein (casein kinase2-interacting protein-1, CKIP-1).

Summary of the invention

The new purposes that the purpose of this invention is to provide a kind of CKIP-1 albumen and encoding gene thereof.

The plasmid that the invention provides CKIP-1 albumen, the proteic encoding gene of said CKIP-1 or contain the proteic encoding gene of said CKIP-1 prevents and/or treats the application in the medicine of myocardial hypertrophy in preparation; Said CKIP-1 albumen (ckip-1 albumen) is shown in the sequence 1 of sequence table.

The proteic encoding gene of said CKIP-1 (claiming CKIP-1 gene or ckip-1 gene again) is for following 1)-4) in arbitrary described dna molecular:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' terminal the 43rd to 1266 nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the dna molecular of encoding said proteins;

4) with 1) or 2) or 3) gene have homology and the dna molecular of encoding said proteins more than 90%.

Above-mentioned stringent condition can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

The plasmid that contains the proteic encoding gene of said CKIP-1 specifically can be the proteic encoding gene of said CKIP-1 is inserted the recombiant plasmid that pJG/ALPHA MHC plasmid obtains.

Said CKIP-1 albumen, the proteic encoding gene of said CKIP-1 or the plasmid that contains the proteic encoding gene of said CKIP-1 can be presented as as follows at least a in (a) to (e) to the effect that prevents and/or treats of myocardial hypertrophy: (a) impel myocardial cell to diminish and the myocardial fibrosis degree weakens; (b) reduce cardiac index; (c) reduce the left ventricle index; (d) reduce period of fetus expression of gene level in the heart tissue; (e) increase left ventricular ejection fraction and ventricle shortening fraction.

The present invention also provides said CKIP-1 albumen, the proteic encoding gene of said CKIP-1 or has contained the application of plasmid in preparing product of the proteic encoding gene of said CKIP-1; Said product is the product that has as follows at least a function in (a) to (e): (a) impel myocardial cell to diminish and the myocardial fibrosis degree weakens; (b) reduce cardiac index; (c) reduce the left ventricle index; (d) reduce period of fetus expression of gene level in the heart tissue; (e) increase left ventricular ejection fraction and ventricle shortening fraction.

The present invention also provides and has been used for suppressing the application of the material of said CKIP-1 protein coding gene expression at preparing product; The product of said product for having as follows at least a function in (1) to (4): (1) makes the myocardial hypertrophy animal model; (2) impel the big and myocardial fibrosis generation of myocardial cell change; (3) increase cardiac index; (4) increase period of fetus expression of gene level in the heart tissue.

More than arbitrary said period of fetus gene be at least a in ANF gene, BNP gene and the β-mhc gene.

The present invention has following great discovery: (1) CKIP-1 gene knockout can cause the generation of spontaneous myocardial hypertrophy, the sensitivity of the myocardial hypertrophy that the increase pressure overload causes; (2) the CKIP-1 gene overexpression can obviously resist because the decline of the myocardial function that the pressure overload causes and the generation of myocardial hypertrophy; (3) the proteic mechanism of action of CKIP-1 through with the HDAC4 realization that directly interacts, the interaction of the two can promote HDAC4 to get in the nuclear, suppresses the transcriptional activity of MEF2C.

The present invention has found CKIP-1 albumen and the regulating action of encoding gene in the myocardial hypertrophy disease thereof, so that be the new target spot and the method for Clinics and Practices searching of myocardial hypertrophy, for clinical diagnosis and the treatment of seeking relevant disease lays the foundation.The present invention has great value for the treatment and the prevention of myocardial hypertrophy.

Description of drawings

Fig. 1 is the variation of KO mice and WT mouse heart tissue morphology.

Fig. 2 is that the ratio of KO mice and WT mouse heart weight and body weight changes.

Fig. 3 is KO mice and WT mice ANF gene, BNP gene and β-mhc gene change of Expression.

Fig. 4 is the sub-HDAC4 of MEF2C transcription inhibition factor localized variation in myocardial cell in KO mice and the WT mice.

Fig. 5 be in KO mice and the WT mice in, the variation of HDAC4 phosphorylation level.

Fig. 6 is in KO mice and WT mice, the comparison of Akt/mTOR/S6K phosphorylation level.

Fig. 7 is the variation of KO mice and WT mice operation 4 all backs heart tissue morphosiss.

Fig. 8 is the variation of KO mice and WT mice operation 4 all backs cardiac indexs.

Fig. 9 is KO mice and WT mice operation 4 all backs ANF genes, BNP gene and β-mhc gene change of Expression.

Figure 10 is that KO mice and the back cardiac function variation of 4 week of WT mice operation are compared.

Figure 11 is the variation of TG mice and WT mice operation 4 all backs heart tissue morphosiss.

Figure 12 is the variation of TG mice and WT mice operation 4 all backs cardiac indexs.

Figure 13 is ANF, BNP and β-MHC change of Expression in TG mice and the WT mice operation 4 all backs heart tissues.

Figure 14 is the TG mice and passes through the variation that ultrasonic cardiography detects cardiac function after 4 weeks of WT mice operation.

Figure 15 is the inhibitory action of CKIP-1 to myocardium enhancer MEF2C transcriptional activity.

Figure 16 is that the CKIP-1 of heterogenous expression is to HDAC4 location influence in born of the same parents.

Figure 17 be embodiment 2 step 32 in the pcr amplification program.

The specific embodiment

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment like no specified otherwise, is conventional method.Used test material among the following embodiment like no specified otherwise, is to buy from routine biochemistry reagent shop and obtains.Quantitative test in following examples all is provided with repeated experiments three times, results averaged.

C57/BL mice (claim wild-type mice or WT mice again, represent) with WT: available from Beijing Vital River Experimental Animals Technology Co., Ltd., the SPF level.

PloxPI plasmid and pBluescript SK (+) plasmid: list of references (document simultaneously also is to describe the document that targeting vector makes up in detail) as follows: the originate gene targeting of critical function gene such as PACT of Li Li thesis for the doctorate people tire liver; 2005, institute of military medicine section of the Chinese People's Liberation Army.

Mouse embryo stem cell: list of references: LiL, Deng B, Xing G, Teng Y, Tian C, Cheng X, Yin X, Yang J, Gao X, Zhu Y, Sun Q, Zhang L, Yang X, He F. Proc Natl Acad Sci US A.PACT is a negative regulator of p53and essential for cell growth and embryonic development.2007May 8; 104 (19): 7951-6.Epub 2007Apr 30.

PJG/ALPHA MHC plasmid: list of references: Gulick J, Robbins J.Cell-type-specific transgenesis in the mouse.Methods Mol Biol.2009; 561:91-104..

CKIP-1 expression plasmid (pCMV-Myc-CKIP-1 plasmid): list of references: Lu K, Yin X, Weng T; Xi S, Li L, Xing G; Cheng X; Yang X, Zhang L, He F.Target ing ww domains linker of hect-type ubiquitin ligase smurf1 for activation by ckip-1.Nat Cell Biol.2008; 10:994-1002.

HDAC4 plasmid (Flag-epitope-tagged HDAC4 plasmid): list of references: Vega RB, Matsuda K, Oh J; Barbosa AC, Yang X, Meadows E; McAnally J, Pomajzl C, Shelton JM; Richardson JA, Karsenty G, Olson EN.Hi stone deacetylase 4controls chondrocyte hypertrophy during skeletogenesis.Cell.2004Nov 12; 119 (4): 555-66.

MEF2C plasmid (Myc-tagged MEF2C plasmid): list of references: Arnold MA, Kim Y, Czubryt MP; Phan D, McAnally J, Qi X; Shelton JM; Richardson JA, Bassel-Duby R, Olson EN.MEF2C transcription factor controls chondrocyte hypertrophy and bone development.Dev Cell.2007Mar; 12 (3): 377-89).

PRL-TK plasmid: available from Promega company (E2241).

293T cell: available from consonance medical university preclinical medicine cell centre cell bank.

C2C12 cell: available from consonance medical university preclinical medicine cell centre cell bank.

PEGFP-N1-HDAC4 plasmid: list of references: Wang AH; Kruhlak MJ, Wu J, Bertos NR; Vezmar M; Posner BI, Bazett-Jones DP, Yang XJ.Regulation of histone deacetylase 4by binding of 14-3-3proteins.Mol Cell Biol.2000Sep; 20 (18): 6904-12..

PIRES-DsRed-CKIP-1 plasmid: list of references: Zhang L, Xing G, Tie Y; Tang Y, Tian C, Li L; Sun L; Wei H, Zhu Y, He F.Role for the pleckstrin homologydomain-containing protein CKIP-1in AP-1 regulation and apoptosis.EMBO J.2005Feb 23; 24 (4): 766-78.

PIRES-DsRed plasmid and pEGFP-N1 plasmid are all available from Clontech.

The acquisition of embodiment 1, CKIP-1 knock out mice

One, the acquisition of CKIP-1 knock out mice

1, the structure of targeting vector

Mice CKIP-1 genome is a double chain DNA molecule shown in the GENBANK ACCESSION NO.67220 (Gene ID:67220, updated on11-May-2012).

(1), reclaims the fragment (fragment first) of about 1.4kb with restricted enzyme NotI and XhoI double digestion mice CKIP-1 genome.

(2), reclaim carrier framework with restricted enzyme NotI and XhoI double digestion ploxPI plasmid.

(3) fragment of step (1) recovery and the carrier framework of step (2) are connected, obtain recombiant plasmid.

(4), reclaim the fragment of about 9.6kb with restricted enzyme EcoR I and SspI double digestion mice CKIP-1 genome.

(5), reclaim carrier framework with restricted enzyme EcoR I and SspI double digestion pBluescript SK (+) plasmid.

(6) fragment of step (4) recovery and the carrier framework of step (5) are connected, obtain recombiant plasmid.

(7) recombiant plasmid that obtains with restricted enzyme EcoRI and Clal double digestion step (6), the fragment (fragment second) of the about 9.6kb of recovery.

(8) recombiant plasmid that obtains with restricted enzyme EcoRI and Clal double digestion step (3) reclaims carrier framework.

(9) fragment of step (7) recovery and the carrier framework of step (8) are connected, obtain targeting vector pTV-CKIP-1.Fragment first on the targeting vector and fragment second can with mouse gene group DNA generation homologous recombination, thereby knock out the CKIP-1 gene.

2, targeting vector is transfected into mouse embryo stem cell

Targeting vector is after the linearisation of Not I, and electricity changes (600V, 25 μ F) and goes in the mouse embryo stem cell.Electricity changes after back 24 hours with target cell in 500 μ g/ml G418 and the screening of 300 μ g/ml HYGs.

Utilize the G418 screening can obtain containing the embryonic stem cell of neomycin gene (neomycin), the insertion of targeting vector has taken place in this cell, but the G418 screening can't be got rid of the cell that the targeting vector random integration is gone into genome and then obtained resistance; HYG then is used for screening the cell that does not contain thymidine kinase (tk), and killed cell is gone into genome for the targeting vector random integration and then obtained the cell of resistance.

4, middle target cell is carried out the blastaea injection, be transplanted to the embryo of the female Mus of WT mice then, the mice that female Mus produces is the allophenic mice (first filial generation) of CKIP-1.

5, with allophenic mice and the copulation of WT mice, the generation mice that obtains is heterozygote mice (second filial).

6,, obtain generation mice (F3) with the copulation of heterozygote mice.

Two, the genotype identification of CKIP-1 knock out mice

Every the F3 mice that respectively step 1 is obtained carries out following experimental procedure:

1, extracts the genomic DNA of mice Mus tail.

2, the genomic DNA that extracts with step 1 is a template, adopts primer that first and primer pair B are carried out pcr amplification respectively.If adopt primer that first has been obtained the target sequence of about 500bp and adopt primer pair B to obtain the target sequence of about 443bp, the genotype of mice to be measured be CKIP-1+/-.If adopt primer that first has been obtained the target sequence of about 500bp and adopt primer pair B not obtain the target sequence of about 443bp, the genotype of mice to be measured be CKIP-1-/-.If adopt primer that first is not obtained the target sequence of about 500bp and the target sequence that the employing primer pair B has obtained about 443bp, the genotype of mice to be measured be CKIP-1+ /+.

Primer is made up of primer KO-1 and primer KO-2 first, is used for identifying knocking out saltant mice, the about 500bp of target sequence.Primer pair B is made up of primer WT-1 and primer WT-2, is used to identify wild-type mice, the about 443bp of target sequence.

KO-1：5'-CCA?GAC?TGC?CTT?GGG?AAA?AGC?GCC?TCC?CCT?ACC-3'；

KO-2：5-Ttc?ccc?ctt?tgt?gaa?gcc?cca?act?ctt?gac?tc'-3'。

WT-1：5'-GTT?CTG?CTT?TTG?TCA?CTA?GAC?ACT?TGT?TTT?CTG?CC-3'；

WT-2：5'-tgg?ttt?ccc?ctc?gga?cct?gta?gga?ag-3'。

PCR reaction system (15 μ l): each 0.5 μ l of two primers (0.1 μ g/ μ l), 10 * Buffer, 1.5 μ l, dNTP (2.5mmol/L) 1.2 μ l, Taq DNA polymerase (5U/ μ l) 0.3 μ l, genomic DNA 1 μ l adds ddH ₂O supplies 15 μ l.

PCR response procedures: 94 ℃ of 3min; 94 ℃ of 1min, 61 ℃ of 50s, 72 ℃ of 1min circulate 38 times; 72 ℃ of 7min.

Choose genotype and be CKIP-1-/-mice, be homozygous CKIP-1 knock out mice (claim the KO mice again, represent) with KO.

Three, change the acquisition of empty carrier control mice

Replace targeting vector to carry out 2 of step 1 with the ploxPI plasmid, obtain changeing empty carrier control mice first.

Cardiac shape of embodiment 2, KO mice and WT mice and the isoparametric comparison of cardiac function

One, the variation of heart tissue form

Get the heart of the KO mice and the WT mice of 2 months (or 8 months) respectively, carry out utilizing HE dyeing, WGA dyeing and MTT dyeing to detect myocardial structural and fibrosis behind the tissue slice.

The result sees Fig. 1.Figure 1A is the painted photo of HE, and Figure 1B is the partial enlarged drawing of Figure 1A, and Fig. 1 C is the painted photo of MTT, and Fig. 1 D is the painted photo of WGA.Compare with the WT mice, heart size of KO mice and myocardial cell obviously increase in the time of 2 months, and the KO mice shows myocardial fibrosis in the time of 8 months.

The cardiac shape of changeing empty carrier control mice first changes consistent with the WT mice.

Two, the variation of cardiac index

Get 3 of the WT mices of 2 months 3 of 3,2 months WT mices of 3,8 months KO mice of KO mice and 8 months; Weigh (measurement unit is g); Core dirty then and take by weighing weight (measurement unit is mg), calculate cardiac index, the i.e. ratio of cardiac weight and body weight (mg/g).

The result sees Fig. 2 (meansigma methodss of 3 mices), and ##P < 0.01.The result shows, compares with the WT mice, and KO mouse heart index enlarges markedly.

The cardiac index of changeing empty carrier control mice first is consistent with the WT mice.

Three, myocardial hypertrophy Expression of Related Genes

Get 3 of the WT mices of 2 months 3 of 3,2 months WT mices of 3,8 months KO mice of KO mice and 8 months, carry out following steps respectively:

1, the dirty tissue of coring, and extract total RNA.

2, be template with total RNA, carry out RT-PCR, detect each period of embryo's gene (expression of ANP gene, BNP gene or β-MHC).

RT-PCR reaction system: 5 * Reaction buffer, 5 μ l, substrate dNTP (10mmol/l) 0.5 μ l, MgSO4 (25mmol/l) 1 μ l; AMV reverse transcription (5U/ μ l) 0.5 μ l; Tfl archaeal dna polymerase (5U/ μ l) 0.5 μ l, forward primer (25pmol/ μ l) 1 μ l, downstream primer (25pmol/ μ l) 1 μ l; Total about 100ng of RNA adds RNase water to 25 μ l.

The RT-PCR response procedures is seen Figure 17.

The primer that is used to detect atrial natriuretic peptide gene (ANP gene) is to (target sequence is 142bp) as follows:

Forward primer: 5'-TTCGGGGGTAGGATTGACAG-3';

Downstream primer: 5'-CACACCACAAGGGCTTAGGA-3'.

The primer that is used to detect brain natriuretic peptide gene (BNP gene) is to (target sequence is 185bp) as follows:

Forward primer 5'-TGTTTCTGCTTTTCCTTTATCTG-3';

Downstream primer 5'-TCTTTTTGGGTGTTCTTTTGTGA-3'.

The primer that is used to detect myoglobulin heavy chain gene (β-mhc gene) is to (target sequence is 110bp) as follows:

Forward primer 5'-TCCCCAACCGCATTCTCTAT-3';

Downstream primer 5'-CAGTTTCTCAGCCCCTTTCC-3'.

With expression of gene amount in the WT mice in identical month is 1, calculates the relative expression quantity of each period of embryo's gene of the KO mice in each month, and the result sees Fig. 3.The result shows, compare with the WT mice, in the time of 2 months in the heart tissue of KO mice the expression of ANF gene, BNP gene and β-mhc gene present trend of rising, this species diversity is more obvious in the time of 8 months.

It is consistent with the WT mice to change each expression of gene amount of empty carrier control mice first.

Four, the ultrasonic cardiography of cardiac function detects

Get 5 of the WT mices of 2 months 9 of 4,2 months WT mices of 8,8 months KO mice of KO mice and 8 months, carry out following experimental procedure respectively:

Mouse peritoneal injection chloral hydrate (450mg/kg); (probe is 15W, and it is 14.0MHz that Doppler detects frequency, and instrument gain is fixed as 65dB in the test to use diasonograph; Picture depth transfers to 30mm; Probe places the breastbone left side, becomes 10 °-30 ° with midsternal line, in left chamber major axis and the M-scan of minor axis tangent plane chordae tendineae horizontal line) measuring left ventricular function index of correlation.

The result sees table 1.

The ultrasonic cardiography testing result (mean+SD) of table 1 cardiac function

Compare with the WT mice, ^AP<0.05, ^BP<0.01.

IVSd interventricular septum end-diastolicthickness; IVSs interventricular septum end-systole thickness; Chamber, LVPWd left side posterior wall thickness at end-diastole; Wall thickness behind the end-systole of chamber, a LVPWs left side; The LVDd LVED; Chamber, LVDs left side end systolic diameter; EF represents the left ventricular ejection mark, and FS represents left LVSF.

The result shows that the CKIP-1 gene knockout can cause that mice interventricular septum and chamber wall thickness increase and the cardiac systolic function compensatory strengthens in the time of 2 months, and left LVSF of KO mice and left ventricular ejection mark are starkly lower than the WT mice in the time of 8 months.

Each index of correlation of changeing empty carrier control mice first is consistent with the WT mice.

Five, the location of histogenic immunity Fluirescence observation HDAC4 changes

Get the heart of 8 months KO mice and WT mice respectively; Carry out tissue freezing section, behind air drying, in-20 ℃ of freezing acetone, soaked 5 minutes; Then with 37 ℃ of sealings of 5% hyclone 30 minutes; Use the antibody (Santa Cruz) of HDAC4 and the antibody (Cell Signaling) of CKIP-1 to hatch then respectively, respectively with two anti-detections of the anti-sheep of two anti-and the rhodamine labellings of the anti-rabbit of FITC labelling, laser confocal microscope is observed then.

The result sees Fig. 4.The result shows that in the myocardial cell of WT mice, HDAC4 is positioned in Cytoplasm and the nucleus, and in the myocardial cell of KO mice, HDAC4 mainly is positioned in the Cytoplasm.

Six, Western Blotting experiment detects in the cardiac muscular tissue variation with the phosphorylation level of myocardial hypertrophy function associated protein

Extract cardiac muscular tissue's albumen of 8 months KO mice and WT mice respectively; Add protease and inhibitors of phosphatases, electrophoresis in 10% PAAG is transferred to nitrocellulose membrane; Use different antibody incubations respectively; As after the confidential reference items hybridization, two anti-hatching of reuse horseradish peroxidase-labeled are detected with chemical luminescence reagent kit with GAPDH.

The result sees Fig. 5 and Fig. 6.In the cardiac muscular tissue of KO mice, the phosphorylation level of HDAC4 is apparently higher than the WT mice, and the phosphorylation level of Akt/mTOR/S6K is apparently higher than the WT mice.

The result of step 1 to step 6 shows: compare with wild-type mice; 2 months CKIP-1 knock out mice myocardial cell obviously increases; Cardiac index obviously increases; Period of fetus gene in the heart tissue (ANP gene, BNP gene and β-mhc gene) expression significantly raises, the enhancing of heart left chamber functional compensation property, and ejection fraction and left LVSF increase; Compare with wild-type mice; 8 months CKIP-1 knock out mice myocardial cell further increases; Cardiac index further increases; The period of fetus expression of gene further significantly raises, yet ejection fraction and heart shortening fraction present obvious decline, and above index meets the symptom of pathologic myocardial hypertrophy; The phosphorylation level of HDAC4, AKT, mTOR and S6K significantly raises in the CKIP-1 knock out mice cardiac muscle; Above result shows that the CKIP-1 knock out mice along with the increasing of age, shows the generation of spontaneous myocardial hypertrophy.

Embodiment 3, the effect (KO mice and WT mice) through the loose model validation CKIP-1 of mouse cardiac muscle gene

One, makes the loose model (aortic arch Constriction) of mouse cardiac muscle

Respectively KO mice and WT mice are tested as follows:

Model group (the loose model of mouse cardiac muscle is represented with TAC): get the mice in 8 ages in week, after tribromoethanol anesthesia; Be connected with the toy respirator through tracheal intubation, carry out artificial ventilation, the 2-3 intercostal is opened the thoracic cavity in the chest left side; Separate aortic arch and under it, wear a silk thread; (Transverse aortic constriction TAC), closes the thoracic cavity to make coarctation of aorta by unified standard.

Sham operated rats (representing with Sham): except not carrying out the TAC, all the other OPs are fully identical with model group.

The aortic arch Constriction is a conventional method, and the document of describing the aortic arch Constriction is: deAlmeida, A.C.; Van Oort, R.J., Wehrens; X.H.Transverse Aortic Constriction in Mice.J.Vis.Exp. (38), e1729, DOI:10.3791/1729 (2010).

Two, the variation of heart tissue form

Get KO mice and the heart of WT mice after 4 weeks of operation of step 1 respectively, take pictures, carry out tissue slice then and carry out HE dyeing respectively and dye with MTT.

The result sees Fig. 7.Fig. 7 A is the heart photo, and Fig. 7 B is the painted photo of HE, and Fig. 7 C is the partial enlarged drawing of Fig. 7 B, and Fig. 7 D is the painted photo of MTT.The result shows, the CKIP-1 gene knockout has aggravated the generation of the myocardial hypertrophy that the aortic arch Constriction causes, the obvious increase of performance cardiac muscle, and with serious Fibrotic generation.

Three, the variation of cardiac index

Get the WT mice (sham operated rats) after 4 weeks of operation of the WT mice (model group) after 4 weeks of operation of the KO mice (sham operated rats) after 4 weeks of operation of the KO mice (model group) after 4 weeks of operation of 3 step 1,3 step 1,3 step 1,3 step 1; Weigh (measurement unit is g); Core dirty then and take by weighing weight (measurement unit is mg); Calculate cardiac index, the i.e. ratio of cardiac weight and body weight (mg/g).

The result sees Fig. 8 (meansigma methodss of 3 mices), compares with sham-operation, * * P 0.01, and comparing with the WT mice, < 0.05, ##P < 0.01 for #P.The result shows that behind the aortic arch Constriction, the cardiac index of KO mice is significantly greater than the WT mice.

Four, myocardial hypertrophy Expression of Related Genes

Get the WT mice (sham operated rats) after 4 weeks of operation of the WT mice (model group) after 4 weeks of operation of the KO mice (sham operated rats) after 4 weeks of operation of the KO mice (model group) after 4 weeks of operation of 3 step 1,3 step 1,3 step 1,3 step 1, carry out the test of the step 3 of embodiment 2 respectively.

The result sees Fig. 9, and TAC-represents sham operated rats, TAC+ representative model group.The result finds that after the operation, the expression increase ratio of ANF gene, BNP gene and β-mhc gene is significantly higher than the WT mice in the KO mouse cardiac muscle tissue.

Five, the ultrasonic cardiography of cardiac function detects

Get the WT mice (sham operated rats) after 4 weeks of operation of the WT mice (model group) after 4 weeks of operation of the KO mice (sham operated rats) after 4 weeks of operation of the KO mice (model group) after 4 weeks of operation of the WT mice (sham operated rats) after 2 weeks of operation of the WT mice (model group) after 2 weeks of operation of the KO mice (sham operated rats) after 2 weeks of operation of the KO mice (model group) after 2 weeks of operation of 9 step 1,9 step 1,9 step 1,9 step 1,9 step 1,9 step 1,9 step 1,9 step 1, carry out the test of the step 4 of embodiment 2 respectively.

The ultrasonic cardiography testing result of the cardiac function of WT mice and KO mice is seen table 2 after 4 weeks of operation.

The ultrasonic cardiography testing result of the cardiac function of 2 weeks of operation or 4 week back model group KO mices and model group WT mice see Figure 10 ( ^*P<0.05, ^*P<0.01, ^{* *}P<0.001, compare with sham operated rats; ^#P<0.05, ^##P<0.01, ^###P<0.001, compare with the WT mice).

Please check, epimere is mentioned in describing, and table 2 is the result of WT mice and KO mice

The result shows that the KO mice shows tangible heart failure.

The acquisition of embodiment 4, commentaries on classics CKIP-1 dna murine

One, the structure of myocardium specific expression carrier

1, the CKIP-1 gene shown in the sequence 2 of composition sequence table is a template with the CKIP-1 gene, and the primer of forming with F1 and R1 obtains pcr amplification product to carrying out pcr amplification.

F1:5'-CCC AAGCTTATGGACTACAAAGACGATGACGACAAGATGAAGAAGAGCGGCTCCGGCAAG-3',

R1：5'-CCC AAGCTTTCACATCAGGCTCTTCCGGTATT-3'。

Introduced the Flag label among the F1.

2, with the pcr amplification product of restricted enzyme HindIII enzyme action step 1, reclaim the enzyme action product.

3,, reclaim carrier framework (about 4500bp) with restricted enzyme HindIII enzyme action pJG/ALPHA MHC plasmid.

4, the enzyme action product of step 2 and the carrier framework of step 3 are connected, obtain recombiant plasmid α-MHC-CKIP-1 (myocardium specific expression carrier).

Two, change the acquisition of CKIP-1 dna murine

1,, reclaims linearization plasmid with restricted enzyme NotI enzyme action recombiant plasmid α-MHC-CKIP-1.

2, WT mouse fertilized egg male-pronucleus is gone in the linearization plasmid microinjection, and with the fallopian tube of great-hearted zygote transplation to WT replace-conceive mice.

3, after the replace-conceive mice produces, the generation mice that obtains (first filial generation), the primer that adopts F2 and R2 to form identifies that to carrying out PCR the mice with about 330bp purpose band is that PCR identifies positive mice.

F1：5'–GACTAACTAGAAGCTTATGGACTA-3'；

R2：5'-CCAGGGTGAACTTGCTGTGAT-3'。

4, the PCR that step 3 is obtained identifies positive mice and the copulation of WT mice and obtains generation mice (second filial) that the primer that adopts F2 and R2 to form identifies that to carrying out PCR the mice with about 330bp purpose band is that PCR identifies positive mice.

5, the PCR that step 4 is obtained identifies positive mice and the copulation of WT mice and obtains generation mice (F3); The primer that adopts F2 and R2 to form is identified carrying out PCR; Mice with about 330bp purpose band is that PCR identifies positive mice, promptly is used for the TG mice of embodiment 5.

Three, change the acquisition of empty carrier control mice second

Replace recombiant plasmid α-MHC-CKIP-1 to carry out the test of step 2 with pJG/ALPHA MHC plasmid, obtain changeing empty carrier control mice second.

Embodiment 5, the effect (TG mice and WT mice) through the loose model validation CKIP-1 of mouse cardiac muscle gene

One, makes the loose model (aortic arch Constriction) of mouse cardiac muscle

Replace the KO mice with the TG mice, other is with the step 1 of embodiment 3.

Two, the variation of heart tissue form

Replace the KO mice with the TG mice, other is with the step 2 of embodiment 3.

The result sees Figure 11.Figure 11 A is the heart photo, and Figure 11 B is the painted photo of HE, and Figure 11 C is the partial enlarged drawing of Figure 11 B, and Figure 11 D is the painted photo of MTT.The result shows, the CKIP-1 gene overexpression has weakened the generation of the myocardial hypertrophy that the aortic arch Constriction causes, compares with the WT mice, and the TG mice shows as that cardiac muscle reduces, fibrosis weakens.The cardiac shape of changeing empty carrier control mice second changes consistent with the WT mice.

Three, the variation of cardiac index

Get the WT mice (sham operated rats) after 4 weeks of operation of the WT mice (model group) after 4 weeks of operation of the TG mice (sham operated rats) after 4 weeks of operation of the TG mice (model group) after 4 weeks of operation of 5 step 1,6 step 1,6 step 1,8 step 1; Weigh (measurement unit is g); Core dirty then and take by weighing weight (measurement unit is mg), get left ventricle and take by weighing weight (measurement unit is mg).Calculate cardiac index, the i.e. ratio of cardiac weight and body weight (mg/g).Calculate the left ventricle index, i.e. the ratio of left ventricular mass and body weight (mg/g).

The result sees Figure 12 (meansigma methodss of 3 mices), compares with sham-operation, * * P 0.01, and comparing with the WT mice, < 0.05, ##P < 0.01 for #P.The result shows that behind the aortic arch Constriction, cardiac index of TG mice and left ventricle index are all significantly less than the WT mice.The cardiac index of changeing empty carrier control mice second changes consistent with the WT mice.

Four, myocardial hypertrophy Expression of Related Genes

Get the WT mice (sham operated rats) after 4 weeks of operation of the WT mice (model group) after 4 weeks of operation of the TG mice (sham operated rats) after 4 weeks of operation of the TG mice (model group) after 4 weeks of operation of 4 step 1,4 step 1,5 step 1,5 step 1, carry out the test of the step 3 of embodiment 2 respectively.

The result sees Figure 13.The result finds that after the operation, the expression ratio of ANF gene, BNP gene and β-mhc gene significantly is lower than the WT mice in the TG mouse cardiac muscle tissue.It is consistent with the WT mice to change each Expression of Related Genes situation of empty carrier control mice second.

Five, the ultrasonic cardiography of cardiac function detects

Get the WT mice (sham operated rats) after 4 weeks of operation of the WT mice (model group) after 4 weeks of operation of the TG mice (sham operated rats) after 4 weeks of operation of the TG mice (model group) after 4 weeks of operation of 5 step 1,6 step 1,6 step 1,8 step 1; Carry out the test of the step 3 of embodiment 2 respectively, carry out the test of the step 4 of embodiment 2 respectively.

The result sees Figure 14.The result shows that ejection fraction of TG mice and ventricle shortening fraction are significantly higher than the WT mice.The ejection fraction that changes empty carrier control mice second is consistent with the WT mice with the ventricle shortening fraction.

The two report of embodiment 6 fluorescence experiment confirm CKIP-1 is to the inhibitory action of MEF2C

The 293T cell culture in the DMEM that contains 10%FBS, is cultivated in 24 orifice plates, and cell density reaches at 60% o'clock carries out following several groups of parallel transfections processing respectively:

First group: the blank group;

Second group: cotransfection MEF2C luciferase reporting plasmid and pRL-TK plasmid, transfection dosage are every hole transfection 0.4 microgram MEF2C luciferase reporting plasmid and 0.4 microgram pRL-TK plasmid;

The 3rd group: transfection CKIP-1 expression plasmid, transfection dosage are every hole transfection 0.4 microgram CKIP-1 expression plasmid;

The 4th group: cotransfection MEF2C luciferase reporting plasmid, pRL-TK and CKIP-1 expression plasmid, transfection dosage are every hole transfection 0.4 microgram MEF2C luciferase reporting plasmid, 0.4 microgram pRL-TK plasmid and 0.4 microgram CKIP-1 expression plasmid;

The 5th group: cotransfection MEF2C luciferase reporting plasmid, pRL-TK and CKIP-1 expression plasmid, transfection dosage are every hole transfection 0.4 microgram MEF2C luciferase reporting plasmid, 0.4 microgram pRL-TK plasmid and 0.4 microgram CKIP-1 expression plasmid;

The 6th group: cotransfection MEF2C luciferase reporting plasmid, pRL-TK and CKIP-1 expression plasmid, transfection dosage are every hole transfection 0.4 microgram MEF2C luciferase reporting plasmid, 0.4 microgram pRL-TK plasmid and 0.4 microgram CKIP-1 expression plasmid.

Transfection was observed under fluorescence microscope after 18 hours, and the result sees Figure 15.The reporter gene experimental result shows that the transfection of CKIP-1 gene external source can significantly suppress the transcriptional activity of MEF2C with dose-dependent mode.

Embodiment 6, external cotransfection experiments detect CKIP-1 to location influence in the HDAC4 cell

The C2C12 cell is carried out following several groups of parallel transfections respectively in 6 orifice plates handle:

First group: transfection pEGFP-N1-HDAC4 plasmid, transfection dosage are every hole transfection 2 microgram pEGFP-N1-HDAC4 plasmids;

Second group: transfection pIRES-DsRed-CKIP-1, transfection dosage are every hole transfection 2 microgram pIRES-DsRed-CKIP-1 plasmids;

The 3rd group: cotransfection pGFP-N1-HDAC4 and pIRES-DsRed, transfection dosage are every hole transfection 2 microgram pEGFP-N1-HDAC4 plasmids and 2 microgram pIRES-DsRed plasmids;

The 4th group: cotransfection pEGFP-N1 and pIRES-DsRed-CKIP-1, transfection dosage are every hole transfection 2 microgram pEGFP-N1 plasmids and 2 microgram pIRES-DsRed-CKIP-1 plasmids;

The 5th group: cotransfection pEGFP-N1-HDAC4 and pIRES-DsRed-CKIP-1, transfection dosage are every hole transfection 2 microgram pEGFP-N1-HDAC4 plasmids and 2 microgram pIRES-DsRed-CKIP-1 plasmids.

The expression of observing CKIP-1 through laser confocal microscope is to the HDAC4 location influence, and the result sees Figure 16.In the C2C12 cell, the CKIP-1 albumen of the band RFP label of external source transfection mainly is positioned in the Cytoplasm, and the HDAC4 of band GFP label mainly is positioned in the Cytoplasm.When the two common transfection, CKIP-1 has influenced the location of HDAC4, and it mainly is positioned in the nucleus.The result shows that CKIP-1 can promote that HDAC4 gets into karyon by kytoplasm, strengthens the inhibitory action of the interior HDAC4 of cell to MEF2C.

Claims (7)

1.CKIP-1 albumen, the proteic encoding gene of said CKIP-1 or the plasmid that contains the proteic encoding gene of said CKIP-1 prevent and/or treat the application in the medicine of myocardial hypertrophy in preparation; Said CKIP-1 albumen is shown in the sequence 1 of sequence table.

2. application as claimed in claim 1 is characterized in that: the proteic encoding gene of said CKIP-1 is following 1)-4) in arbitrary described dna molecular:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' terminal the 43rd to 1266 nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the dna molecular of encoding said proteins;

4) with 1) or 2) or 3) gene have homology and the dna molecular of encoding said proteins more than 90%.

3. according to claim 1 or claim 2 application is characterized in that: said CKIP-1 albumen, the proteic encoding gene of said CKIP-1 or the plasmid that contains the proteic encoding gene of said CKIP-1 are presented as as follows at least a in (a) to (e) to the effect that prevents and/or treats of myocardial hypertrophy:

(a) impelling myocardial cell to diminish weakens with the myocardial fibrosis degree;

(b) reduce cardiac index;

(c) reduce the left ventricle index;

(d) reduce period of fetus expression of gene level in the heart tissue;

(e) increase left ventricular ejection fraction and ventricle shortening fraction.

4.CKIP-1 albumen, the proteic encoding gene of said CKIP-1 or contain the application of plasmid in preparing product of the proteic encoding gene of said CKIP-1; Said CKIP-1 albumen is shown in the sequence 1 of sequence table; The product of said product for having as follows at least a function in (a) to (e):

(a) impelling myocardial cell to diminish weakens with the myocardial fibrosis degree;

(b) reduce cardiac index;

(c) reduce the left ventricle index;

(d) reduce period of fetus expression of gene level in the heart tissue;

(e) increase left ventricular ejection fraction and ventricle shortening fraction.

5. application as claimed in claim 4 is characterized in that: the proteic encoding gene of said CKIP-1 is following 1)-4) in arbitrary described dna molecular:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' terminal the 43rd to 1266 nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the dna molecular of encoding said proteins;

4) with 1) or 2) or 3) gene have homology and the dna molecular of encoding said proteins more than 90%.

6. be used for suppressing of the application of the material of the proteic encoding gene expression of CKIP-1 at preparing product; Said CKIP-1 albumen is shown in the sequence 1 of sequence table; The product of said product for having as follows at least a function in (1) to (4):

(1) makes the myocardial hypertrophy animal model;

(2) impel the big and myocardial fibrosis generation of myocardial cell change;

(3) increase cardiac index;

(4) increase period of fetus expression of gene level in the heart tissue.

7. application as claimed in claim 6 is characterized in that: the proteic encoding gene of said CKIP-1 is following 1)-4) in arbitrary described dna molecular:

1) in the sequence table sequence 2 from the dna molecular shown in 5 ' terminal the 43rd to 1266 nucleotide;

2) dna molecular shown in the sequence 2 in the sequence table;

3) under stringent condition with 1) or 2) shown in dna molecule hybridize and the dna molecular of encoding said proteins;

4) with 1) or 2) or 3) gene have homology and the dna molecular of encoding said proteins more than 90%.

Images