CN102776191A - MicroRNA (micro ribonucleic acid) for regulating gene expression of CD86 (cluster of differentiation 86) - Google Patents

Abstract

The invention discloses microRNA (micro ribonucleic acid) for regulating gene expression of CD86 (cluster of differentiation 86). The microRNA is nucleic acid, functional segment or variant including a sequence of 5'-aggcaagaugcuggcauagcu-3'. The microRNA is capable of inhibiting gene expression of the CD86 by bonding with 3'-UTR (untranslated regions) of the CD86 gene. Performed in-vitro biological function tests show that hsa-miR-31 is capable of inhibiting molecular expression of the CD86 by bonding with 3'-UTR of the CD86 gene, and antitumor effect can be achieved by regulating a signal path of the CD86 and/or expression and functions of the miR-31.

Description

A kind of Microrna is used to regulate and control the genetic expression of CD86

Technical field

the invention belongs to biotechnology and medicine technology field, specifically, the present invention relates to the gene expression regulation technical field, and particularly a kind of Microrna is used to regulate and control CD86 genetic expression.

Background technology

Human beings'health and life in tumour serious threat always, and traditional treatment is not fully up to expectations.Immunotherapy induces body to produce specific anti tumor immune response through improving the immunogenicity of tumour, reaches the purpose of treatment tumour, is a kind of biotherapy method of changing from passive to active.By the cell-mediated cellular immunization of T is the principal mode of antineoplastic immune, and body is through the specific recognition to tumour antigen, and activated T cell produces corresponding immunologic cytotoxicity effect.

Effective activation of cell not only needs the T cell to combine to provide the 1st signal with the specificity of antigen peptide-MHC mixture, also needs costimulatory molecules and its receptors bind on antigen presenting cell (APC) surface that the 2nd signal is provided.The most basic costimulatory signal is that the corresponding acceptor of expressing on CD80 (B7-1), CD86 (B7-2) molecule and the T cell by the antigen presenting cell expression provides.CD86 has only with after the CD28 molecule of silent oscillation T cell surface combines, and just can make the T cell activation, stimulates the propagation and the differentiation of T cell; Induce ctl response; In body is antitumor, play keying action (David MS, Claire NM, Zheng Y. What ' s the difference between CD80 and CD86. Trends in Immunology; 2003,24 (6): 313-318).If lack this costimulatory signal, the T cell causes immunological unresponsiveness with anergy, makes tumour cell generation immunologic escape.

molecule is expressed in the APC surface with monomeric form.Do not receive to express the CD86 molecule hardly among the APC of antigenic stimulation, but activated back its express significantly and raise.All express high-level CD86 on activated B cell, monocyte, BMDC, scavenger cell and the T cell.CD86 also can be low expression level on immobilized monocyte and B cell.In 24 h, the CD86 developed by molecule explains that to the peak CD86 possibly play a crucial role at the T cell co-stimulatory in early days to the B cell after activation, and decision T cell is activation or reactionless.

BMDC is the strongest antigen presenting cell of function in the present known body; Have unique immunologic function, can directly activate quiescent stage T cell in vivo and in vitro, promote the generation of t helper cell and cytotoxic T cell (CTL); In the inducing antitumor reaction, play crucial regulating and controlling effect (Jacques B; Ralph MS. Dendritic cells and the control of immunity. Nature, 1998,392 (6673): 245-252).Discover that the expression of CD86 is lower than healthy tissues on the dendritic cell in colorectal cancer tissue and the regional lymph nodes, cancer is all organizes and inflammatory tissue, the expression decline just because of CD86 in the tumor tissues makes effectively inducing antitumor immunity of dendritic cell.Therefore; CD86 expresses and will become a kind of new antineoplaston approach on the regulation and control dendritic cell; Has potential using value (Le TT; Gardner J, Hoang-Le D. Immunostimulatory cancer chemotherapy using local ingenol-3-angelate and synergy with immunotherapies. Vaccine 2009,27 (23): 3053-62).

are the one type endogenous non-coding small molecule RNA that be about 22 Nucleotide of discovered in recent years in eukaryotic cell; Can be combined in post-transcriptional level through 3'-UTR complementation and make its degraded with said target mrna; It is synthetic that perhaps incomplete with it complementation is combined in the translation skill arrestin, thereby in genetic expression, bring into play important regulatory role.Increasing research confirms that miRNA is abnormal expression in tumor tissues, and is closely related with tumor development and patient treatment reaction; Like hsa-miR-21 up-regulated in the colorectal cancer tissue; Reach closely related (the Schetter AJ of prognosis of patients with colorectal cancer TNM by stages; Leung SY; Sohn JJ, et al. MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma. JAMA 2008,299 (4): 425-36).It is this that the miRNA of abnormal expression has in tumor tissues is proved [the Thorsen SB that has notable antitumor activity; Et al. The Therapeutic Potential of MicroRNAs in Cancer. Cancer J 2012; 18 (3): 275-84.]; Growth [the Ibrahim AF that can suppress HCT-116 colorectal cancer Transplanted cells knurl like miR-145 and miR-33a; Et al. MicroRNA replacement therapy for miR-145 and miR-33a is efficacious in a model of colon carcinoma. Cancer Res 2011,71:5214-5224.].In addition; MiR-122 is owing to can regulate and control the abundance of HCV RNA, and its complementary sequence is used to treat the infection with hepatitis C virus patient and has got into II clinical trial phase [Janssen HL, ReesinkHW; Zeuzem S; Et al. A randomized, double-blind, placebo (plb) controlled safety and anti-viral proof of concept study of miravirsen (MIR); An oligonucleotide targeting miR-122; In treatment naBve patients with genotype 1 (gt1) chronic HCV infection. Hepatology. 2011:1430A.], demonstrate miRNA as a kind of extremely important gene expression regulation factor and action target, have potential therapeutic action and actual application value.

though in this area known some Microrna and tumour have certain dependency; But miRNA as known in the art is of a great variety; Function is different, therefrom filter out specific miRNA relevant with tumour and that can be used as selection and the prognosis of morbidity, regimen and have big difficulty.At present, the report that does not still have miR-31 and CD86 gene-correlation property in this area.

Summary of the invention

technical problem to be solved by this invention is to provide a kind of Microrna to be used to regulate and control CD86 genetic expression.

the objective of the invention is to realize in the following manner: a kind of Microrna is used to regulate and control the genetic expression of CD86; It is characterized in that described Microrna is nucleic acid or function fragment or variant: the 5 '-aggcaagaugcuggcauagcu-3 ' that comprises following sequence.

preferably, said Microrna can combine with CD86 gene 3 '-UTR, suppresses CD86 genetic expression.

preferably, said Microrna is miR-31.

Preferably, said Microrna obtains through chemosynthesis .

preferably, said Microrna comprises tissue, cell and peripheral blood from the organism sample.

The source that obtains of Microrna of the present invention can be from chemosynthesis and the cell, the tissue that have this gene order; Tissue can be selected from cast, the pathological tissues of peripheral blood, body fluid, cavity, and paraffin mass, the paraffin section processed with these tissues.

in this article, term " sample " refers to the potential stripped circulation blood sample that possibly contain Microrna miR-31, preferably from people's sample.Although the purification of samples with the hemorrhage total RNA of extracting also can use in the present invention,, sample of the present invention is preferably without the cracking liquid sample of purifying, contain the total RNA of blood.Those skilled in the art know the cracking of solid nucleated blood cell or extracting, purifying and the cellular elements biology techniques that keeps miRNA composition wherein not to be degraded.Sample of the present invention can be treated sample, like dilution process, hemocyte cracking processing and pcr amplification etc., also can be undressed sample.Treated sample can be further purified, with enrichment miRNA.

in this article, term " miR-31 " refers to the Microrna that comprises sequence " aggcaagaugcuggcauagcu " or its homologous sequence.The miR-31 in known various sources in this area, for example people, chimpanzee, horse, chicken etc., these homologous sequences all are included in the term of the present invention " miR-31 ".Also comprise process replacement in the above-mentioned naturally occurring miR-31 sequence in the term of the present invention, lack or add one or several Nucleotide, or modify, and still have the RNA that derives of BA through biological chemistry.

The expression of miRNA in inventor has adopted the real-time fluorescence quantitative PCR technical measurement 6 routine colorectal cancer tissues and the cancer beside organism; Statistic analysis result confirms that the expression of hsa-miR-31 in the colorectal cancer tissue is significantly higher than healthy tissues, and the result is as shown in Figure 1.The inventor adopts information biology software miRanda prediction to find that hsa-miR-31 possibly combine with CD86 gene 3 '-UTR, and the result is as shown in Figure 2.Subsequently, the inventor adopts the extracorporeal biology functional experiment to confirm that hsa-miR-31 can combine with CD86 gene 3 '-UTR, thereby suppresses the CD86 developed by molecule, can be through regulating and control CD86 signal path and/or miR-31 expression and function with the performance antitumor action.

Description of drawings

Below in conjunction with accompanying drawing and embodiment the present invention is further described:

In Fig. 1 colorectal cancer tissue with healthy tissues in the miR-31 expression amount measure the result;

Fig. 2 miRanda software prediction result;

The pcr amplification result of Fig. 3 CD86 gene 3 '-UTR;

Fig. 4 CD86/3 '-UTR/pGEM-T recombinant vectors enzyme is cut the checking result;

Fig. 5 CD86/3 '-UTR/pGEM-T recombinant vectors sequence verification result;

Fig. 6 CD86/3 '-UTR/ pGL-3 recombinant vectors enzyme is cut the checking result;

Fig. 7 CD86/3 '-UTR/ pGL-3 recombinant vectors sequence verification result;

Fig. 8 hsa-miR-31 is to the restraining effect of CD86/3 '-UTR/pGL-3 recombinant vectors expression activity.

Embodiment

further specify such scheme below in conjunction with specific embodiment.Should be understood that these embodiment are used to the present invention is described and do not limit the scope of the invention.The implementation condition that adopts among the embodiment can be done further adjustment according to the condition of concrete producer, and not marked implementation condition is generally the condition in the normal experiment.

One, reagent and material

1, reagent

Foetal calf serum (Hyclone, the U.S.); Perfect medium: among every liter of RPMI1640 (Hyclone, the U.S.), add foetal calf serum 100ml, L-glutaminate 0.15g, 2 mercapto ethanol 10.0 ml (5 * 10 ^-3 Mol/L); Liposome 2000 (Invitrogen, the U.S.); Penicillium mould, Streptomycin sulphate (worker Bioisystech Co., Ltd is given birth in Shanghai); TRIzol (Invitrogen, the U.S.); Agarose (LP0028A, Oxoid Ltd, Britain); Gel electrophoresis application of sample liquid and ethidium bromide (EtBr) (worker Bioisystech Co., Ltd is given birth in Shanghai); Glue reclaims DNA test kit and plasmid extraction test kit (Axygen, the U.S.); Sucrose, Triton-100, MgCl ₂ 6H ₂ Experiment agents useful for same such as O, three (methylol) aminomethane (Tris), hydrochloric acid, EDTA, NaCl, phenol, chloroform, primary isoamyl alcohol, sodium laurylsulfonate (SDS) and absolute ethyl alcohol be analytical pure or top grade pure; Two luciferase detection kit (Promega, the U.S.).Hsa-miR-31 and real time fluorescent quantitative test kit (Shanghai JiMa pharmacy Technology Co., Ltd) thereof; Taq DNA polysaccharase, M-MuLV ThermoScript II, XbaI restriction enzyme (MBI, the U.S.); T ₄ Dna ligase (Takara, Japan); PCR primer (Invitrogen, PAGE level).PGEM-T, pGL-3, pRL-TK carrier (Promega, the U.S.).

, tissue samples

The fresh surgical tissue samples of 6 routine colorectal cancer patients is collected in , comprises cancerous tissue and far-end normal bowel tissue (from cancer edge 5cm).All patients confirm as colorectal cancer through HE dyeing, pathological diagnosis; Do not accept chemotherapy or radiotherapy before the art.

, cell strain

Chinese hamster ovary cell strain CHO (ATCC, the U.S.); Intestinal bacteria TP10 (Novagen, the U.S.).Cell strain is through detecting no mycoplasma contamination.

, instrument

CO ₂ Incubator, low-temperature and high-speed whizzer, normal speed centrifuge (Thermo, Germany); Inverted microscope (Olympus, Japan); Weak-luminescence survey meter (BPCL-K, biophysics institute of the Chinese Academy of Sciences); PCR appearance (S1000, Bio-Rad, the U.S.); Electrophoresis apparatus (Bio-Rad, the U.S.); Micro quantitative determination spectrophotometer (Alpha Innotech, the U.S.); Gel imaging system (GeneGenius, SYNGENE, Britain).

Two, experimental technique

1, cell cultures

Employing contains RPMI 1640 substratum of 10% FCS cultivates, and contains 100kU/L penicillium mould, 100mg/L Streptomycin sulphate in the nutrient solution, and culture condition is 37 ° of C, 5% CO ₂ , saturated humidity.Chinese hamster ovary celI strain adherent growth is used 0.25% trysinization when going down to posterity.Changed fresh culture at interval in 2-3 days.

, real time fluorescent quantitative analyzes the hsa-miR-31 expression amount

adopt Trizol reagent from 6 pairs of colorectal cancers and healthy tissues sample, to extract total RNA according to working instructions.The expression amount of hsa-miR-31 in the real-time fluorescence quantitative PCR kit measurement RNA sample; With U6 RNA is internal reference.Get 5 μ M RT primer working fluids, 1 μ L, add 79 μ L RNsae-free water, be configured to 62.5nM RT primer working fluid.50 μ L RT reaction systems add 2 μ L RNA samples, and each 4 μ L of primer working fluid add RNsae-free water to 19 μ L.Behind the above system mixing, instantaneous centrifugal, 70 ° of C place 10min, and ice is educated 2min, add following reagent again and carry out the RT reaction: 1 * RT buffer, and 1 μ L dNTP (10mM), 40U RNase inhibitor, 200U RT enzyme adds RNsae-free water to 50 μ L.RT response procedures: 42 ° of C 60min, 70 ° of C 10min.Immediately the cDNA product is taken out after the RT reaction finishes, put cooled on ice fast, follow-up institute all carries out on ice in steps.Then carry out qRT-PCR reaction quantitatively determined hsa-miR-31 expression amount, 20 μ L reaction systems: 10 μ L SYBR Green Mix, 2 μ L RT reaction product, Bulge-Loop ^TM Each 2 μ L of miR-31 forward primer and reverse primer (5 μ M) add RNsae-free water to 20 μ L.Response procedures: 95 ° of preparatory sex change 20sec of C; Then carry out 40 circulations (95 ° of C sex change 10sec; 60 ° of C annealing 20sec; 70 ° of C extend 5sec).

, miRNA target site point prediction

adopt information biology software miRanda (www.microRNA.org) prediction maybe with CD86 gene 3 '-UTR bonded miRNA.

, make up and to contain the segmental luciferase expression carrier of CD86 gene 3'-UTR

adopt Trizol reagent from the MDA-MB-435 cell, to extract total RNA according to working instructions, are reverse transcriptase primer with Oligo (dT), use the M-MuLV ThermoScript II that the RNA reverse transcription is cDNA.

Contain 2 μ L cDNA templates in the μ L PCR reaction system, 1.25U Taq archaeal dna polymerase, 1 * damping fluid, 0.2 mmol/L dNTPs, 0.4 μ mol/L forward primer, 5 '-GGC TAG TCT AGATAA GGA GTT CTC ATC CCT CTG-3 ' and reverse primer 5 '-GGC TAG TCT AGA(the underscore base is a restriction endonuclease to AAG CTT GTC TAG CAT GGC AG-3 ' XbaThe I recognition sequence).Thermal cycle conditions is: 94 ° of preparatory sex change 5min of C; Then with 94 ° of C sex change 20sec, 60 ° of C annealing 30sec, 72 ° of C extend 1.5min, 35 circulations of increasing; Last 72 ° of C extension 7min makes and reacts completely.After reaction was accomplished, negate answered product 3 μ L on 1.5% sepharose, to carry out electrophoresis (1 * TAE electrophoretic buffer, voltage 200V, constant voltage electrophoresis 5min), and gel imaging system is taken electrophoretogram.The product that increases successful adopts Sanger ' s PCR sequencing PCR to measure dna sequence dna (Invitrogen); Other gets 30 μ L reaction product and on 2.0% sepharose, carries out electrophoresis (1 * TAE electrophoretic buffer; Voltage 100V; Constant voltage electrophoresis 10min), adopt glue to reclaim test kit then and reclaim the purifying target DNA fragment, and measure its concentration with micro-ultraviolet spectrophotometer.

reference product specification sheets, with CD86 gene 3 '-UTR fragment cloning of purifying to the pGEM-T carrier; Thermal transition intestinal bacteria TP10 competent cell carries out blue hickie screening.The picking hickie shakes bacterium, the extracting plasmid; Pcr amplification and enzyme carry out sequence verification after cutting evaluation again.The recon that order-checking is correct is used XbaAfter the I enzyme is cut, reclaim 3 '-UTR fragment.

transform the conventional intestinal bacteria TP10 competent cell for preparing with pGL-3 and pRL-TK vector plasmid, increase in a large number; The test kit extraction process prepares pGL-3 and pRL-TK plasmid, the purity of electrophoresis detection plasmid and content in a large number.Use restriction enzyme XbaI carries out enzyme to the pGL-3 plasmid that extracts and cuts, and test kit directly reclaims big segmental enzyme and cuts product.The reference product specification sheets is received CD86 gene 3 '-UTR fragment behind the purifying by suitable proportion and pGL-3 carrier with the enzyme switchback XbaThe I endonuclease bamhi carries out ligation, and 16 ° of C enzymes even spend the night.Get 10 μ L and connect directly conversion 100 μ L intestinal bacteria TP10 competent cells of product.Cultivate through selecting in the LB flat-plate solid substratum that contains penbritin.10 bacterium colonies of picking at random from the flat board of transformant are through containing the LB liquid nutrient medium amplification cultivation of penbritin; Through pcr amplification, enzyme cut and check order identify after, subsequent use with test kit extracting plasmid.

, cell transfecting

At first, with being incubated at cell strain in the RPMI1640 perfect medium that contains 10% FCS, 100kU/L penicillium mould, 100mg/L Streptomycin sulphate, by 1 * 10 ⁴ The amount of individual cells/well is inoculated the cell of exponential phase of growth in 24 orifice plates, overnight cultures is up to cell 80% remittance sheet.

Then, a certain amount of hsa-miR-31, CD86/3 '-UTR/pGL3 recombinant plasmid and confidential reference items plasmid pRL-TK are diluted to 50 μ L do not contain in serum and the antibiotic Opti-MEM I substratum, mix with liquid-transfering gun; Then 1 μ L liposome, 2000 suspensions are added 50 μ L and do not contain serum and antibiotic Opti-MEM In the I substratum, at incubated at room 5min; At last both are mixed, fully mixing leaves standstill 20min, and hsa-miR-31, recombinant plasmid and confidential reference items plasmid are fully combined with liposome.With the hole that only adds liposome as negative control.

At last, inhale and to remove to be inoculated into the nutrient solution in 24 orifice plates,, in each hole, add 100 μ L said mixtures, cultivation 3h with not containing serum and antibiotic Opti-MEM I substratum is washed once; The transfection nutrient solution in the culture plate is abandoned in suction, adds the Opti-MEM that 100 μ L have the serum antibiotic-free to each hole The I substratum detects after continuing to cultivate 24h.

, two luciferase reporting system gene activity measures

have transfection the Chinese hamster ovary celI of pGL-3 and pRL-TK to cultivate the back collection through 24h, inhale and abandon substratum, wash 1 time with PBS.Add lysate 20 μ L/ holes, room temperature is shaken 15 min.According to the process specifications of two luciferase detection kit, get 100 μ L luciferase analysis buffer II in the 1.5ml centrifuge tube, to set Chemiluminescence Apparatus and postpone 2sec, light-emitting appearance is surveyed and is read 10sec; Whole cell pyrolysis liquids are joined in the centrifuge tube, aspirate 2-3 mixing (not vortex vibration) gently with liquid-transfering gun; Centrifuge tube is put into the Chemiluminescence Apparatus survey read Photinus pyralis LUC luminous value F1; Centrifuge tube is shifted out light-emitting appearance, add 100 μ L Stop& Glo reagent fast behind the vortex mixing, is read renilla luciferase luminous value F2 with the centrifuge tube survey of resetting back in the light-emitting appearance.The chi square test analysis of using the SPSS.10 statistical software receives the F1/F2 ratio difference of examination group and blank group, to judge the regulating and controlling effect of hsa-miR-31.

Three, result

1. the expression of hsa-miR-31 in the colorectal cancer tissue is significantly higher than healthy tissues

The expression of miRNA in 6 routine colorectal cancer tissues that adopted the real-time fluorescence quantitative PCR technical measurement and the healthy tissues; Statistical study finds that the expression of hsa-miR-31 in the colorectal cancer tissue is significantly higher than healthy tissues, and the result is as shown in Figure 1.

3 '-UTR combines with the CD86 gene

we adopt information biology software miRanda prediction to find that hsa-miR-31 possibly combine with CD86 gene 3 '-UTR, and the result is as shown in Figure 2.

Make up CD86/3'-UTR/pGL-3 luciferase expression carrier

pcr amplification obtains CD86 gene 3 '-UTR sequence (Fig. 3) that length is 949bp, after cutting glue purification and reclaiming, fragment is inserted the pGEM-T carrier, the transformed competence colibacillus intestinal bacteria.Extract DNA after choosing clonal expansion at random.Process XbaThe I enzyme is cut evaluation, the gene fragment that confirms to obtain after enzyme is cut with expect big or small 937bp conform to (Fig. 4).Sequencing result shows that the CD86 gene 3'-UTR fragment sequence that inserts the pGEM-T carrier is correct, as shown in Figure 5.Extracting pGEM-T carrier, enzyme are cut and are obtained CD86 gene 3'-UTR fragment; Be inserted into the pGL-3 carrier, then the transformed competence colibacillus intestinal bacteria.Gene fragment that obtains after enzyme is cut and the big or small 937bp of expection conform to (Fig. 6); Sequencing result confirms insertion sequence correct (Fig. 7).

, that hsa-miR-31 suppresses the reorganization luciferase expression is active

with 200ng recombinant C D86/3'-UTR/pGL-3 luciferase expression carrier, 20ng confidential reference items plasmid pRL-TK and the common transfection CHO cell of 10pmol hsa-miR-31 after, adopt the uciferase activity detection kit to detect the activity that luciferase in the Chinese hamster ovary celI of back is cultivated in transfection.The result shows that behind the adding hsa-miR-31, the active ratio (pGL-3/pRL-TK) of luciferase significantly is lower than the cell (Fig. 8) that does not add hsa-miR-31 in Chinese hamster ovary celI.Show that thus hsa-miR-31 combines through going up target sequence with CD86 gene 3'-UTR, has suppressed the expression of luciferase.

above-mentioned instance only is explanation technical conceive of the present invention and characteristics, and its purpose is to let the people who is familiar with this technology can understand content of the present invention and enforcement according to this, can not limit protection scope of the present invention with this.All equivalent transformations that spirit is done according to the present invention or modification all should be encompassed within protection scope of the present invention.

Claims (5)

1. a Microrna is used to regulate and control the genetic expression of CD86, and said Microrna is nucleic acid or function fragment or variant: the 5 '-aggcaagaugcuggcauagcu-3 ' that comprises following sequence.

2. purposes according to claim 1 is characterized in that, said Microrna can combine with CD86 gene 3 '-UTR, suppresses CD86 genetic expression.

3. purposes according to claim 1 is characterized in that, said Microrna is miR-31.

4. purposes according to claim 1 is characterized in that said Microrna obtains through chemosynthesis.

5. purposes according to claim 1 is characterized in that, said Microrna comprises tissue, cell and peripheral blood from the organism sample.

Images