CN102776180B - Sheep disease resistance related molecular marker of ISG15 gene and application thereof - Google Patents
Sheep disease resistance related molecular marker of ISG15 gene and application thereof Download PDFInfo
- Publication number
- CN102776180B CN102776180B CN201210176815.6A CN201210176815A CN102776180B CN 102776180 B CN102776180 B CN 102776180B CN 201210176815 A CN201210176815 A CN 201210176815A CN 102776180 B CN102776180 B CN 102776180B
- Authority
- CN
- China
- Prior art keywords
- sheep
- gene
- isg15
- disease resistance
- molecular marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a sheep disease resistance related molecular marker of ISG15 gene and application thereof. A sheep disease resistance related gene segment applied as a molecular marker is obtained through cloning from sheep ISG15 gene, and the nucleotide sequence is shown in SEQ ID NO: 1 in the sequence table; and the gene has a base transversion of A235-C235 at the SEQ ID NO: 1. The sheep disease resistance related molecular marker of ISG15 gene has the following beneficial effect that three gene types of wild isozygoty AA, mutation heterozygosity AC and mutation isozygoty CC are discovered in the hu-sheep flock. The invention also discloses a primer for amplifying the intron region of the ISG15 gene part and a detection method for the molecular marker. The invention provides a new molecular marker for marker assisted-selection of the sheep.
Description
Technical field
The present invention relates to the Molecular Marker Assisted Selection Technology field of sheep, especially a kind of ISG15 gene is as the relevant molecule marker of sheep disease resistance and application thereof.
Background technology
Disease is one of important factor affecting Production of Livestock and Poultry benefit.The feeding manner of modernization industryization not only damages animal welfare, and animal is increased the susceptibility of disease; Also because of the close contact of the mankind and domestic animal, increased the possibility of zoonosis mutual inductance simultaneously; And the global trade of livestock and poultry and product circulation and traffic is fluent fast, more increased the popular frequency of infectious diseases common to human beings and animals, expanded range of infection.Although biological products and antibiotic application can be alleviated animal epidemics to a certain extent, the use of vaccine and medicine can only prevent, control disease and can not eradicate disease, and the fundamental way addressing this problem is to cultivate the livestock and poultry species of high disease resistance.
Interferon-stimulated gene 15(IFN-stimulated gene 15, ISG15) is the ubiquitin-like albumen of current first discovery, and Interferon, rabbit stimulates and virus infection all can its expression of induced strong.Interferon, rabbit, in conjunction with cell-membrane receptor, activates the expression of ISG15 by JAK-STAT signal path, and then coding antiviral protein, reaches ntiviral characteristic.ISG15 and can effective stimulus cell proliferation and NK cell maturation to the covalent modification of protein, produce IFN-γ albumen, activate neutrophilic granulocyte, promote dendritic cell ripe, strengthen cell anti-virus effect, thereby play an important role in the process of Interferon, rabbit regulation and control.
Research finds that ISG15 has broad-spectrum disease resistance toxic action, and it all has antivirus action to I type HIV (human immunodeficiency virus), A/rWSN type influenza virus, B/Lee type influenza virus, I-herpes simplex virus type, hepatitis B virus, japanese encephalitis virus, respiratory syncytial virus, vaccinia virus, restructuring Sindbis virus, hepatitis C virus, Ebola VP40 virus, bovine viral diarrhea virus.Meanwhile, ISG15 also has important effect aspect bacterium infection, acquired immunity.
As the distinctive valuable sheep variety resource of China, sheep collection early sexual maturity, early growth is fast, reproductivity is strong, the four seasons oestrus, milk performance is good, and gives up all the year round the multiple excellent specific properties such as word, disease resistance are strong in one.In addition, the extremely strong adaptive capacity to environment that sheep has, northwest in hot moist He Ganhan desert, the south of the River, can keep the good characteristics such as fast growth, breeding potential is high, resistance against diseases is strong, therefore, applicant carried out sheep ISG15 gene order clone, SNP examination and detection and with the association analysis of sheep disease resistance.
Summary of the invention
Object of the present invention will solve the deficiency that above-mentioned technology exists just, and provide a kind of ISG15 gene as the relevant molecule marker of sheep disease resistance and application thereof, as clone and the application of sheep marker assisted selection, relevant to sheep disease resistance molecule marker, molecule marker of the present invention is relevant with ISG15 gene.
The object of the invention is the molecule marker that clone is relevant to sheep disease resistance, utilizes this molecule marker as the application of sheep marker-assisted breeding.
The present invention solves the technical scheme that its technical problem adopts: this ISG15 gene is as the relevant molecule marker of sheep disease resistance, its nucleotide sequence, as shown in sequence table SEQ ID NO:1, has the transversion of an A235-C235 at the 235bp place of sequence table SEQ ID NO:1.
Further, the DNA sequence dna of the primer pair of clone sheep ISG15 gene is as shown in SEQ ID NO:2 and SEQ ID NO:3.
The application of described molecule marker in sheep molecular mark.
The application of described primer pair in sheep molecular mark.
A kind of method of preparing above-mentioned molecule marker and detecting above-mentioned molecule marker of the present invention, the step of the method is as follows:
With sheep ISG15 gene design primer, amplification obtains object fragment; From sheep peripheral blood, extract genomic dna, the sheep ISG15 gene DNA sequence of take is template design primer, pcr amplification, PCR product purification and cloning and sequencing, the nucleotide sequence of acquisition as shown in sequence table SEQ ID NO:1, application PCR-SSCP method detects the polymorphism of sheep ISG15 gene, and has tentatively carried out the application of the association analysis between its genotype and sheep disease resistance, for the molecular marker assisted selection of sheep provides a new molecule marker.
The effect that the present invention is useful is: in sheep colony, find wild homozygous AA, sudden change heterozygous AC and these the 3 kinds of genotype of homozygous CC of suddenling change.The invention also discloses that amplification ISG15 Gene Partial includes subarea primer used and for the detection method of molecule marker.The marker assisted selection that the present invention is sheep provides 1 new molecule marker.Clone the molecule marker relevant to sheep disease resistance, utilize this molecule marker as the application of sheep marker-assisted breeding.
Accompanying drawing explanation
Fig. 1: be techniqueflow chart of the present invention.
Fig. 2: be the electrophoretogram of sheep ISG15 gene amplification sequence in the present invention, clip size is that 313bp(agarose gel concentration is 1.5%).In figure, M is DNA molecular amount mark (DL2000plus).
Fig. 3: the individual sequence of the homozygous BB genotype of sheep ISG15 transgenation with the full genome database BLAST of ox comparison result.
Fig. 4: be that in the present invention, the homozygous individual order-checking of sheep ISG15 transgenation finds to have at the 235bp place of sequence table SEQ ID NO:1 the transversion of an A235-C235.
Fig. 5: 3 kinds of banding patterns (AA of 235bp place, AC and these 3 kinds of genotype of CC of the corresponding sequence table SEQ ID of AA, AB and BB NO:1 of being sheep ISG15 gene PCR-SSCP in the present invention.）
Embodiment
Below in conjunction with drawings and Examples, the invention will be further described:
Sequence table SEQ ID NO:1 is the DNA sequence dna of the present invention's sheep disease resistance genes involved ISG15 gene of cloning and detecting for PCR-SSCP.
Sequence table SEQ ID NO:2 is for the PCR-SSCP upstream primer of cloning and PCR-SSCP detection sheep disease resistance genes involved ISG15 gene DNA suddenlys change in the present invention.
Sequence table SEQ ID NO:3 is for the PCR-SSCP downstream primer of cloning and PCR-SSCP detection sheep disease resistance genes involved ISG15 gene DNA suddenlys change in the present invention.
The explanation of Fig. 3: Bos taurus breed Hereford chromosome 16genomic scaffold, Bos_taurus_UMD_3.1,
whole genome shotgun sequence
Length=16624581
Features flanking this part of subject sequence:
646 bp at 5'side:ubiquitin-like protein ISG15
8248bp at 3'side:transcription factor HES-4 isoform 1
Score=492bits(266),Expect=1e-136
Identities=299/315(95%),Gaps=2/315(1%)
Strand=Plus/Minus
Query 1 CATAATTTCACAAtcccatcagcaatgtatgaagATTCCAtttttttgacatcttcacca 60
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 6095038 CATCATTTCACAATCCCATCAGCAATGTATGAAGATTCCATTTTTTTGACATCTTCACCA 6094979
Query 61 acacttattattctttttttaattattattatattcatgCTAGTGGGTGTGACATAGTAc 120
||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||||
Sbjct 6094978 ACACTTATTATTCACTTTTTAATTATTATTATATTCATGCTAGGGGGTGTGACACAGTAC 6094919
Query 121 atctggttttgatttgcatttccctggttcCCATCATTTCCaatgatgttgaatatattt 180
||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||
Sbjct 6094918 ATCTGGTTTTGATTTGCATTTCCCTGGTTCCCATCATTTCCAAAGATGTTGAACATCTTT 6094859
Query 181 tcatgtggCTGTTGgccatttatgtattttctattttaaaatgtctatttaagtaatttg 240
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct 6094858 TCATGTGGCTCTTGGCCATTTATGTATTTTCTATTTTAAAATGTCTATTTAAGTCATTTG 6094799
Query 241 cccaactTTTAATTGAGTTGCTTATCTTTTAGTTGTTGAGTTGTAAAAGTTCC--AGACG 298
||||||||||||||||||||||||||||||||||||| ||||||||||||||| | | |
Sbjct 6094798 CCCAACTTTTAATTGAGTTGCTTATCTTTTAGTTGTTAAGTTGTAAAAGTTCCTTATATG 6094739
Query 299 ATGCAGATACTAGAC 313
||||||||||||||
Sbjct 6094738 TTGCAGATACTAGAC 6094724
Clone's (Preparation Example) of embodiment 1:ISG15 gene order
1. design of primers
Utilize (the GenBank number of including: AC_000173.1) designed a pair of primer for the sheep ISG15 gene DNA sequence that increases of ox ISG15 gene DNA sequence.Primer is synthetic by Shanghai office of American I nvitrogen hero life technology company limited, and the DNA sequence dna of primer pair is as follows
Forward primer: 5 '-CATAATTTCACAATCCCATCAGCAA-3 ' (corresponding SEQ ID NO:2),
Reverse primer: 5 '-GTCTAGTATCTGCATCGTCTGGAA-3 ' (corresponding SEQ ID NO:3).
The amplification of 2.PCR product, purifying and order-checking
(1) pcr amplification
The DNA profiling 2 μ L that add 50ng/ μ L in the reaction system of 25 μ L, 10 * PCR Buffer, 2.5 μ L, 2.5mMdNTP 1 μ L, each 0.1 μ L of the forward and reverse primer of 10mM, Taq enzyme 1U, distilled water to 25 μ L.PCR response procedures is as follows: 94 ℃ of denaturation 5min; 94 ℃ of sex change 10sec, 58 ℃ of renaturation 10sec, 72 ℃ are extended 20sec, 35 circulations; 72 ℃ of 10min; 4 ℃ of preservations.PCR product detects (Fig. 2) through 1.5% agarose gel electrophoresis.
(2) purifying of PCR product and order-checking
Enough PCR products are after 1.5% agarose gel electrophoresis separation, and the object fragment that molecular weight cut off is 313bp in sepharose, utilizes E.Z.N.
glue reclaims test kit (Omega) to carry out after purifying, send Shanghai office of American I nvitrogen hero life technology company limited to check order.
(3) evaluation of DNA sequence dna homology search and mutational site determines
By NCBI-BLAST (Basic Local Alignment Search Tool) instrument, the data of announcing in the sequence obtaining after order-checking and the full genome database of GenBank ox are compared, and result shows that clone's sequence is positioned at ox ISG15 upstream region of gene 5 ' flanking region (Fig. 3).And this gene is at the transversion of locating an A235-C235 (Fig. 4) of SEQ ID NO:1.In sheep colony, find wild homozygous AA, sudden change heterozygous AC and these the 3 kinds of genotype of homozygous CC of suddenling change.
The foundation of embodiment 2:ISG15PCR-SSCP genotype detection method
Get the pcr amplification product of the forward and reverse primer of 5 μ L, mix with 10 μ L sample-loading buffers (98% methane amide, 0.025% dimethylbenzene cyanogen, 2% glycerine, 0.01mmolL-1EDTA), instantaneously be put in 99 ℃ of sex change 10min in PCR instrument after centrifugal, and be placed in immediately on ice, after ice bath 30min, be splined on 15% non-denaturing polyacrylamide gel, 4 ℃, electrophoresis 12～15h under 180V, 200mA condition.After electrophoresis finishes, get glue and carry out silver staining, judge genotype.
The sscp analysis of pcr amplification product is found AA, AB and 3 kinds of banding patterns of BB, and wherein AA type is wild homozygous, corresponding A A genotype; BB type is homozygous for suddenling change, corresponding CC genotype; AB is sudden change heterozygous, corresponding A C genotype (Fig. 5).
The distribution of embodiment 3:ISG15PCR-SSCP polymorphism in sheep detects
Utilize PCR-SSCP to detect genotype and the gene frequency of sheep ISG15 sudden change.Result shows, the sudden change that detects ISG15 gene 5 ' flanking region in sheep colony be take allele C (being saltant type 235C) and, as main, reached 0.5306, and allelotrope A(is wild-type 235A) gene frequency be 0.4694(table 1).ISG15 gene 5 ' flanking region SNP polymorphism information content is 0.3741, belongs to moderate polymorphic, shows that the heritable variation of ISG15 gene 5 ' flanking region SNP is larger, is expected to obtain more selection effect.SNPs χ 2 comptibility test results show, sheep colony not yet reaches Hardy-Weinberg equilibrium state (P<0.05) in this site.
Genotype and the gene frequency of the sudden change of table 1 sheep ISG15 gene 5 ' flanking region
A represents adenylic acid (AMP); C represents cytosine(Cyt).
Embodiment 4: the application (Application Example) of the present invention clone's molecule marker in the association analysis of sheep disease resistance
(1) genotype scanning
30 sheep ear tissue samples for disease resistance character analysis all pick up from periphery slaughterhouse, Hangzhou, Zhejiang province city.With shaver gently scraping gather fresh sheep ear tissue and adopt the hair on sheep ear tissue surface, retain sample inside the ear tissue that muscle tissue is many, and be cut into 1cm with the clipper of sterilizing
3the muscle masses of size.The tissue block shearing with the ophthalmic tweezers gripping of sterilizing is put into 75% alcohol and is cleaned after 1 time, is transferred to pH and is in 8 PBS to clean 1 time.Tissue block after cleaning is put into the vial of sterilizing, with the ophthalmologic operation of sterilizing, cut ear tissue is trimmed to 1mm
3the fritter of left and right.In the process of shearing, can suitably on ear tissue, drip 1 ~ 2 nutrient solution, to keep the moistening of ear tissue in pruning process.With eye scissors, the little block organization after shearing is placed in to culture dish, then with dental explorer or elbow straw, tissue block is evenly separated on culture dish with the spacing of 0.5cm left and right, until be paved with whole culture dish.Tissue block laid good after, by culture dish upset, bottom surface is placed 30min upward gently.Afterwards, in culture dish, add a small amount of nutrient solution to cover tissue block, build culture dish lid, be placed in 37 ℃ of CO
2in incubator, cultivate.After 2 ~ 4h, after tissue block adherent, in culture dish, add 5mL substratum, and be placed in 37 ℃ of CO
2in incubator, cultivate, notice that every 24h changes fresh substratum 1 time.
Until at the bottom of inoblast confluent culture ware time, can utilize inoblast different to tryptic tolerance with epithelioid cell to the primary cell cultivation of going down to posterity simultaneously, inoblast is carried out to purifying.Nutrient solution with in aseptic rifle head exhaustion culture dish, adds the PBS that the pre-temperature of 2 ~ 3mL is 8 to 37 ℃ of pH, and wave and culture ware flows through behind all cells surface PBS gently, absorbs the PBS adding.In cleaned cell, add again the pre-temperature of 2 ~ 3mL to 0.125% trypsinase of 37 ℃, wave and culture ware makes Digestive system flow through all cells surface gently, under inverted microscope, observe turning culture dish while finding inoblast kytoplasm retraction, intercellular substance increase, make Digestive system leave cell, with suction pipe, absorb Digestive system.Get aseptic rifle head and draw the cell in nutrient solution piping and druming ware, make the de-wall of cell form cell suspension, and cell suspension is transferred in a new culture dish, and the nutrient solution in ware is added to 5mL, with suction pipe piping and druming evenly, be seeded in the 15mL culture dish of 4 sterilizations, be placed in 37 ℃, 5%CO of saturated humidity
2in incubator, cultivate.Under phase microscope, observe former culture dish, ware planted agent leaves epithelioid cell and a small amount of fibroblast-like cells.Repeat aforesaid operations 2 ~ 3 times, can inoblast is separated, purifying.
Take pH as 8 according to the dilution proportion Poly I:C pulvis of 1:100, after the filter bacteriological filtration of the Poly I:C after dilution with 0.22 μ m, be sub-packed in the 1.5mL centrifuge tube of sterilizing.After at the bottom of the cell in 4 ear tissue inoblast culture dish of same individual packing is paved with ware, get 3 dish cells wherein, with the ratio of the cell culture fluid of 50 μ L Poly I:C/5mL, adding Poly I:C stimulates inoblast to express interferon alpha and interferon beta albumen, then excites the expression of ISG15mRNA.At the post-stimulatory 3h of Poly I:C, 12h and 24h, in turn the culture dish that adds Poly I:C is taken out, after exhaustion substratum, carry out fibroblastic RNA extraction.
In 200 μ L PCR pipes of nuclease free, add successively following reagent:
Total RNA sample 16 μ L of 0.8 μ g
Oligo（dT）25（20μM） 1μL
dNTP Mix（10mM ofeach dNTP） 2μL
Above-mentioned solution inhaled to beat mix and of short duration centrifugal, make the solution of PCR pipe lid and inwall concentrate on PCR manage bottom after, PCR pipe is placed on 70 ℃ of airbaths or PCR instrument and hatches 5min, immediately ice bath 5min; The following component of of short duration centrifugal rear interpolation:
5×First-Strand Reaction Buffer 5μL
RevertAid
TM H Minus Reverse Transcriptase 1μL
RNase Inhibitor（TaKaRa） 1μL
Inhale to beat and mix, of short durationly centrifugal PCR pipe is placed on the airbath of 42 ℃ or PCR instrument and hatches 90min; 72 ℃ of insulation 15min, are cooled to after 4 ℃, and product is the first chain cDNA, in-20 ℃ of preservations.
In real-time quantitative PCR pipe, add following component:
Inhale to beat and mix, the of short duration amplification of carrying out real-time quantitative PCR after centrifugal, pcr amplification condition is 94 ℃ of denaturation 3min; Then 94 ℃ of sex change 30sec, 55.3 ℃ of renaturation 30sec, 72 ℃ are extended 20sec, 40 circulations; 72 ℃ are extended 10min, 10 ℃ of preservations.
Application PopGen32 computed in software ISG15 mutator gene type frequency, gene frequency, polymorphism information content.General linear model between the relative expression quantity of the Generalized Linear Models structure sheep ISG15 mutational site in use statistical package SPSS17.0 and the lower inoblast ISG15 gene of Poly I:C induction:
Yij=μi+Mj+eijk①
Wherein Yij is the relative expression quantity measured value of sheep inoblast ISG15 gene under Poly I:C induction; μ i is colony's least square average; Mj is the fixed effect of genotype (3 level: AA, AC and CC); Eijk is residual error effect.Because the individuality for genotype effect analysis all comes from same kind, so do not comprise variety effect in model.
With model, 1. analyze the sudden change of the ISG15 of sheep colony gene intron 5 ' flanking region and show with the association analysis result of the relative expression quantity of the lower inoblast ISG15 gene of Poly I:C induction, each genotype presents remarkable associated (P<0.05) with the relative expression quantity of the lower sheep inoblast ISG15 gene of Poly I:C induction
The mutator gene type pair of table 2ISG15 gene 5 ' flanking region
The impact of the relative expression quantity of the lower sheep inoblast ISG15 gene of Poly I:C induction
Note: after same column data, the different lowercases of marking represent P<0.05, and different capitalizations represent P<0.01, institute's marking-up parent phase is with representing difference not remarkable (P>0.05).
In addition to the implementation, the present invention can also have other embodiments.All employings are equal to the technical scheme of replacement or equivalent transformation formation, all drop on the protection domain of requirement of the present invention.
<110> Zhejiang Academy of Agricultural Science
<120> ISG15 gene is as the relevant molecule marker of sheep disease resistance and application thereof
<160>3
<170>PatentIn version 3.1
<210>1
<211>313
<212>DNA
<213> sheep (Ovis aries)
<220>
<221>gene
<222>（1）..（313）
cataatttca caatcccatc agcaatgtat gaagattcca tttttttgac atcttcacca 60
acacttatta ttcttttttt aattattatt atattcatgc tagtgggtgt gacatagtac 120
atctggtttt gatttgcatt tccctggttc ccatcatttc caatgatgtt gaatatattt 180
tcatgtggct gttggccatt tatgtatttt ctattttaaa atgtctattt aagtaatttg 240
cccaactttt aattgagttg cttatctttt agttgttgag ttgtaaaagt tccagacgat 300
gcagatacta gac
<223>
<220>
<221>mutation
<222>（235）..（235）
<223>
<210>（2）
<211>25
<212>DNA
<213> artificial sequence
<220>
<223> designs with reference to known array, synthetic by Shanghai office of American I nvitrogen hero life technology company limited, the upstream primer detecting as ISG15 sudden change
<400>（2）
cataatttca caatcccatc agcaa 25
<210>（3）
<211>24
<212>DNA
<213> artificial sequence
<220>
<223> designs with reference to known array, synthetic by Shanghai office of American I nvitrogen hero life technology company limited, the downstream primer detecting as ISG15 sudden change
<400>（3）
gtctagtatc tgcatcgtct ggaa 24
Claims (4)
1. a molecule marker of sheep disease resistance genes involved ISG15, is characterized in that: its nucleotide sequence, as shown in sequence table SEQ ID NO:1, has the transversion of an A235-C235 at the 235bp place of sequence table SEQ ID NO:1.
2. the molecule marker of sheep disease resistance genes involved ISG15 according to claim 1, is characterized in that: the primer pair of the described molecule marker that increases, its DNA sequence dna is as shown in SEQ ID NO:2 and SEQ ID NO:3.
3. the molecule marker of sheep disease resistance genes involved ISG15 according to claim 1, is characterized in that: the application of described molecule marker in sheep molecular mark.
4. the molecule marker of sheep disease resistance genes involved ISG15 according to claim 2, is characterized in that: the application of described primer pair in sheep molecular mark.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210176815.6A CN102776180B (en) | 2012-05-29 | 2012-05-29 | Sheep disease resistance related molecular marker of ISG15 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210176815.6A CN102776180B (en) | 2012-05-29 | 2012-05-29 | Sheep disease resistance related molecular marker of ISG15 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102776180A CN102776180A (en) | 2012-11-14 |
| CN102776180B true CN102776180B (en) | 2014-03-12 |
Family
ID=47121288
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210176815.6A Active CN102776180B (en) | 2012-05-29 | 2012-05-29 | Sheep disease resistance related molecular marker of ISG15 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102776180B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103374577B (en) * | 2013-07-12 | 2015-02-11 | 石河子大学 | Sheep ISG (immune serum globulin) 15 recombinant protein as well as coding gene and application thereof |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002088184A1 (en) * | 2001-05-02 | 2002-11-07 | Murdoch Childrens Research Institute | A molecular marker |
| CN1743461A (en) * | 2004-08-30 | 2006-03-08 | 中国农业科学院畜牧研究所 | A kind of method of utilizing single nucleotide polymorphism prediction mean lambing number of sheep brood |
| CN101434998A (en) * | 2008-12-23 | 2009-05-20 | 华中农业大学 | Molecular marker ISG15 related to pig immune and reproductive traits |
| CN101532061A (en) * | 2009-04-10 | 2009-09-16 | 甘肃农业大学 | Special amplimer for detecting tibetan sheep foot rot resistance allele, detecting agent case and method thereof |
| CN201381325Y (en) * | 2009-04-10 | 2010-01-13 | 甘肃农业大学 | Kit for detecting foot rot resistance allelic gene PCR-SSCP of Tibetan sheep |
| CN101705297A (en) * | 2009-11-18 | 2010-05-12 | 江苏省农业科学院 | Hu sheep and Poll Dorset sheep identifying method based on microsatellite fingerprint |
| CN102051411A (en) * | 2010-10-25 | 2011-05-11 | 新疆维吾尔自治区畜牧科学院中国—澳大利亚绵羊育种研究中心 | Method for effectively and quickly detecting high reproductive trait of sheep through BMP15 gene |
-
2012
- 2012-05-29 CN CN201210176815.6A patent/CN102776180B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002088184A1 (en) * | 2001-05-02 | 2002-11-07 | Murdoch Childrens Research Institute | A molecular marker |
| CN1743461A (en) * | 2004-08-30 | 2006-03-08 | 中国农业科学院畜牧研究所 | A kind of method of utilizing single nucleotide polymorphism prediction mean lambing number of sheep brood |
| CN101434998A (en) * | 2008-12-23 | 2009-05-20 | 华中农业大学 | Molecular marker ISG15 related to pig immune and reproductive traits |
| CN101532061A (en) * | 2009-04-10 | 2009-09-16 | 甘肃农业大学 | Special amplimer for detecting tibetan sheep foot rot resistance allele, detecting agent case and method thereof |
| CN201381325Y (en) * | 2009-04-10 | 2010-01-13 | 甘肃农业大学 | Kit for detecting foot rot resistance allelic gene PCR-SSCP of Tibetan sheep |
| CN101705297A (en) * | 2009-11-18 | 2010-05-12 | 江苏省农业科学院 | Hu sheep and Poll Dorset sheep identifying method based on microsatellite fingerprint |
| CN102051411A (en) * | 2010-10-25 | 2011-05-11 | 新疆维吾尔自治区畜牧科学院中国—澳大利亚绵羊育种研究中心 | Method for effectively and quickly detecting high reproductive trait of sheep through BMP15 gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102776180A (en) | 2012-11-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Soliva et al. | Molecular phylogenetics of the sexually deceptive orchid genus Ophrys (Orchidaceae) based on nuclear and chloroplast DNA sequences | |
| CN108315439B (en) | SNP molecular marker related to growth of pelteobagrus vachelli and application thereof | |
| CN101142481A (en) | Method of detecting pork quality and carcass traits | |
| Liu et al. | Genetic variability of mtDNA sequences in Chinese native chicken breeds | |
| CN108998541B (en) | SNP (Single nucleotide polymorphism) marker primer pair related to hip circumference traits of Suhuai pig legs and application thereof | |
| Samollow et al. | First-generation linkage map of the gray, short-tailed opossum, Monodelphis domestica, reveals genome-wide reduction in female recombination rates | |
| CN110643716A (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| Sun et al. | Genetic variation in eight Chinese cattle breeds based on the analysis of microsatellite markers | |
| Wang et al. | Cloning and SNP screening of the TLR4 gene and the association between its polymorphism and somatic cell score in dairy cattle | |
| CN102776180B (en) | Sheep disease resistance related molecular marker of ISG15 gene and application thereof | |
| CN110564867B (en) | SNP molecular marker of Qinchuan cattle CFL1 gene and detection method thereof | |
| CN101880663B (en) | Molecular markers related to swine production properties and preparation and application | |
| CN113249497B (en) | SNP molecular marker related to growth traits of mandarin fish, primer and application | |
| Erdoğan et al. | Associations of SNPs in GHR gene with growth and milk yield of Anatolian buffaloes | |
| CN101701262B (en) | Molecular marker relative to pig meat quality traits and application | |
| CN104498590B (en) | Molecular marker LSdCAP8 developed on basis of maize head smut resistance candidate gene ZmNL and application thereof | |
| CN103725688A (en) | Molecular markers related with antibody level of newcastle disease virus as well as identification method and application of molecular markers | |
| CN104109669A (en) | SNP in promoter region of pig AMPD1 gene as genetic marker of pig carcass characteristics and applications thereof | |
| De Qin et al. | Analysis on the polymorphism and the genetic effects on some economic traits of mx gene S631N mutation site in chicken | |
| CN108841971B (en) | Method for detecting cattle SH3PXD2B gene insertion/deletion marker | |
| CN112410463A (en) | Molecular marker for resisting bacterial wilt of tomatoes and application of molecular marker | |
| CN104278094B (en) | The detection method of one boar FTO gene coding region A227G single base mutation and application | |
| CN101358244B (en) | Cloning and application of molecular marker relative with pig meat quality traits | |
| CN101235419A (en) | Clone and application of swine mark auxiliary selection molecule mark RNASE6 correlated with immunity | |
| Lin et al. | Characterization of the intergenic spacer rDNAs of two pig nodule worms, Oesophagostomum dentatum and O. quadrispinulatum |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |