CN102775494A - CD3 resistance/CD133 resistance bi-specific antibody and CIK (cytokine-induced killer) cells loaded by CD3 resistance/CD133 resistance bi-specific antibody - Google Patents
CD3 resistance/CD133 resistance bi-specific antibody and CIK (cytokine-induced killer) cells loaded by CD3 resistance/CD133 resistance bi-specific antibody Download PDFInfo
- Publication number
- CN102775494A CN102775494A CN2012102385279A CN201210238527A CN102775494A CN 102775494 A CN102775494 A CN 102775494A CN 2012102385279 A CN2012102385279 A CN 2012102385279A CN 201210238527 A CN201210238527 A CN 201210238527A CN 102775494 A CN102775494 A CN 102775494A
- Authority
- CN
- China
- Prior art keywords
- cell
- cik
- specific antibody
- resistance
- monoclonal antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a bi-specific antibody, in particular to a CD3 resistance/CD133 resistance bi-specific antibody, CIK (cytokine-induced killer) cells loaded by the CD3 resistance/CD133 resistance bi-specific antibody and a preparation method of the CD3 resistance/CD133 resistance bi-specific antibody. The CD3 resistance/CD133 resistance bi-specific antibody comprises a monoclonal antibody resisting to CD3 and a monoclonal antibody resisting to CD133. The CIK cells loaded by CD3 resistance/CD133 resistance bi-specific antibody can kill and wound overexpression CD133 cancer cells in target direction and have strong effects on restraining tumor growth.
Description
Technical field
The present invention relates to a kind of bi-specific antibody, specifically, relate to the anti-CIK cell that loads of the anti-CD133 bi-specific antibody of a kind of anti-CD3/ and this pair.
Background technology
More and more evidences shows that tumor stem cell is escaped in tumour immunity, opposing is put, played most important effect in chemotherapy and the relapse and metastasis; Therefore treat tumour and need create efficient targeting and kill the New Policy of tumor stem cell and just might effect a radical cure tumour, the immunotherapy of targeting tumor stem cells is being carried out positive exploration aspect monoclonal antibody and the stem cell vaccine research.Up to the present; The tumor stem cell specificity marker thing of being found is very rare; CD133 then is present one of the modal mark in the tumor stem cell of finding; In kinds of tumors stem cells such as brain tumor, white blood disease, melanoma, kidney, large bowel cancer, carcinoma of the pancreas, lung cancer, liver cancer and ovarian cancer, exist, the low survival rate of its high expression level and tumour patient is closely related.
The present invention selects CD133 as the novel targets to the research of CD133 positive tumor stem-cell therapy thus, has made up the anti-CD133 bi-specific antibody of anti-CD3/ of target CD133 target spot.
In the adoptive immunotherapy; CIK is as the T lymphocyte that cell of new generation had concurrently powerful tumor activity extremely and the restricted knurl characteristic of killing of the non-MHC of NK cell; Obtained very big progress clinical, but result of treatment is still limited, its reason is a CIK cell lack of specific targeting killing effect.The present invention has made up the CIK cell of the anti-CD133 bi-specific antibody equipment of anti-CD3/.
Summary of the invention
Primary and foremost purpose of the present invention is to propose the anti-CD133 bi-specific antibody of a kind of anti-CD3/;
Second goal of the invention of the present invention is to propose to be equipped with the anti-CIK cell of this pair.
In order to accomplish the object of the invention, the technical scheme of employing is:
The present invention relates to the anti-CD133 bi-specific antibody of a kind of anti-CD3/, it is characterized in that, described bi-specific antibody contains the monoclonal antibody of anti-CD3 and the monoclonal antibody of anti-CD133.
The preparation method of the anti-CD133 bi-specific antibody of anti-CD3/ among the present invention may further comprise the steps:
(1) will resist the monoclonal antibody of CD3 to be dissolved in Traut's reagent, 15～25 ℃ act on 1～2 hour down; Filter with the PD-10 post, remove uncrosslinked monoclonal antibody;
(2) the CD133/1 monoclonal antibody is dissolved in crosslinking aid S ulfo-SMCC, and 15～25 ℃ act on 1～2 hour down; Filter with the PD-10 post, remove uncrosslinked monoclonal antibody;
(3) with step (1) step (2) obtain crosslinked after monoclonal antibody mix 1～4 ℃ of effect 12～18 hours down.
The invention still further relates to the CIK cell that the anti-CD133 bi-specific antibody of a kind of anti-CD3/ loads.
The preparation method of the CIK cell that the anti-CD133 bi-specific antibody of this anti-CD3/ loads may further comprise the steps:
(1) cultivation of CIK cell:
Get healthy peripheric venous blood 10ml, anticoagulant heparin after saline water 1:1 dilution, adds to the lymphocyte separation medium upper strata, centrifugal collection mononuclearcell, and using the RPMI1640 nutrient solution adjustment cell density that contains 5% foetal calf serum is 2 * 10
6Individual/ml, place 37 ℃, 5%CO
2Cultivate 12～24h in the incubator, add rhIL-1 α 100U/ml, mouse-anti people CD3McAb50ng/ml then, rhIL-21000U/ml added rhIL-21000U/ml in per two days, was cultivating inspection CD3, CD4, CD8 and CD56 results CIK cell the 14th day;
(2) detection of CIK cell phenotype:
The CIK cell concn that 0 day and 14 days are cultivated in adjustment is 5 * 10
6Individual/ml, respectively get 200 μ l and add in the centrifuge tube, add mouse-anti people CD3-Percp, CD4-FITC, CD8-PE, CD56-APC four labeling antibodies and each 5 μ l of homotype contrast IgG1 monoclonal antibody; Mixing; Behind 4 ℃ of darkroom reaction 20～40min, PBS washing 1～3 time, flow cytometer detects CD3 positive cell>=85% in the CIK cell; The two positive cells of CD3 and CD8>=60%, the two positive cells of CD3 and CD56>=20%;
(3) the anti-CD133 bi-specific antibody of anti-CD3/ loads the CIK cell:
Centrifugal collection cultivation 14 days and the CIK cell that detects through phenotype, PBS washing 1～3 time is by 1 * 10
6The two anti-concentration of CIK/50ng add the anti-CD133 bi-specific antibody of anti-CD3/, and room temperature left standstill 40～80 minutes behind the mixing, PBS washing 1～3 time.
Do further explanation and explanation in the face of content of the present invention down:
The present invention proposes and has made up the anti-CD133 bi-specific antibody of a kind of anti-CD3/; And the anti-CD133 bi-specific antibody of constructed anti-CD3/ is loaded into the CIK cell surface; Make its double antibody and the CIK cell performance targeting killing effect that combines together; The human pancreas cancer cell strain SW1990 that filters out high expression level CD133 positive cell is as target cell; In external and animal body, targeted therapy high expression level CD133 human pancreas cancer is tested; Experimental result confirms, compares with the treatment of simple CIK cell, and the CIK cell of the anti-CD133 bi-specific antibody equipment of anti-CD3/ can more effectively kill and wound high expression level CD133 male human pancreatic cancer cell.The loading that the present invention is prepared two anti-CIK cells; Bridging and target keying action through bifunctional antibody; Dual-target lethal effect at tumor by local performance antibody and CIK cell; Might eliminate the whole tumour cells that comprise CD133 positive tumor stem cell; Thereby solve the treatment of CIK cellular immunization effectively and can not eliminate the defective with relapse and metastasis seed-tumor stem cell, the novel immunotherapy that the present invention eliminates tumor stem cell for efficient target provides new scheme, for clinical experimental study is laid a good foundation.
Because directly acting on the method for the CTL cell therapy tumour of tumor stem cell does not also come out; And simple CIK cell can not the target killing tumor stem cell; So the present invention utilizes the targeting killing effect of monoclonal antibody and the restricted powerful characteristic of killing tumor activity of non-MHC that the CIK cell is had; Successfully make up the new antitumoral immune effector cell of the anti-CD133 bi-specific antibody equipment of anti-CD3/ CIK, in external and animal body, carried out the research of targeted therapy high expression level CD133 carcinoma of the pancreas.
Through with after the examination of anti-CD133 antibody to the CD133 antigen presentation of 10 kinds of human tumor cell lines; Selected two pairs of pairing tumor cell lines as target cell: a pair of is the human pancreatic cancer cell CAPAN-2 pairing of high expression level CD133 human pancreas cancer cell strain SW1990 and the low CD133 of expression; Another is to being high expression level CD133 human hepatoma cell strain Hep-3B and the low CD133 of expression human hepatoma cell strain HepG2 pairing; Relatively discovery through external fragmentation test; Under same effect target specific concentration; The anti-CD133 bi-specific antibody equipment of anti-CD3/ CIK cell will obviously be better than simple CIK groups of cells, p＜0.05 to the knurl effect extremely of high expression level CD133 target cell SW1990 cell and Hep-3B cell.And at low CD133 target cell Capan2 and the HepG2 cell of expressing, the knurl difference on effect is not remarkable extremely between anti-CD133 bi-specific antibody equipment CIK cell of anti-CD3/ and the simple CIK cell.
Pancreatic cancer cell through with the CIK cell therapy high expression level CD133 of the anti-CD133 bi-specific antibody of anti-CD3/ equipment is the nude mice subcutaneous transplantation knurl of SW1990 preparation; The CIK cell of finding the anti-CD133 bi-specific antibody of anti-CD3/ equipment has the effect of stronger inhibition tumor growth than simple CIK, and p < 0.05.
Above experimental result shows that the CIK cell is after having equipped the anti-CD133 bi-specific antibody of anti-CD3/; The CIK cell is not only brought into play the therapeutic action of wide spectrum direct killing tumour cell; And the bridge linking effect that utilizes bifunctional antibody organically combines the tumour target cell of effector cell and high expression level CD133; Formation kills and wounds molectron, has brought into play antibody target and has hit the effect of eliminating CD133 male tumor stem cell.Double antibody not only is enriched in the effector cell around the tumour; And can simulate the effect of native ligand; Combine with the cell surface trigger molecule; The activation effect cell is realized to the killing and wounding of the target property of tumour cell, because antibody does not need the expression of angtigen presentation and MHC to antigenic identification; Therefore the two anti-regimens of CIK equipment specificity not only can solve tumor stem cell effectively host immune is kept watch on the crucial difficult problem of escaping and affecting the treatment with resistance etc., and can repair CIK cellular immunization and treat the defective that can not eliminate the seed-tumor stem cell with relapse and metastasis.
The CIK cell of the anti-CD133 bi-specific antibody of anti-CD3/ of the present invention equipment not only can targeted therapy high expression level CD133 carcinoma of the pancreas; The Hep3B liver cancer cell that can also effectively suppress high expression level CD133, to combine cell toxicity medicament monomethyl auristatin F (MMAF) effectively to kill and wound the result of high expression level CD133Hep3B liver cancer cell and KATO-III stomach cancer cell consistent with using the CD133 monoclonal antibody for this result.The CIK cell of the anti-CD133 bi-specific antibody equipment of hence one can see that anti-CD3/ not only can hit the pancreatic cancer cell of CD133 high expression level, and might the stem cell cell subsets of the expression CD133 in the various tumours effectively be suppressed.
The contriver is that the gene chip expression spectral of SW1990 is analyzed to adding high expression level CD133 pancreatic cancer cell before and after two anti-equipment CIK or the simple CIK co-cultivation.Confirm that through quantitative fluorescent PCR the CIK cells of two anti-equipments can make S100P gene in the SW1990 cancer cells obviously be in harmonious proportion STAT1 down and significantly raise.The result shows that the change of these genetic expressions is closely related with the synergism of two anti-equipment CIK cells.
Two anti-equipment CIK cell of the present invention, after SW199024 hour, S100P genetic expression is obviously reduced in this cell at effect high expression level CD133 pancreatic cancer cell, is 0.26 times of parent's tumour cell of being untreated, 0.18 times of simple CIK group (p 0.01).Because the downward modulation of this gene is significant difference between simple CIK cell and the cell of having equipped two anti-CIK, therefore in the targeting killing effect of the anti-CD133 bi-specific antibody of anti-CD3/ and the pancreatic cancer cell S100P gene level remarkable reduce closely related.The S100P gene is the regulating cell gene of proliferating cycle; Come into one's own about the unconventionality expression of S100P in tumor tissues in recent years; S100P all has tangible high expression level in the kinds of tumors tissue; Like carcinoma of the pancreas, adenocarcinoma of lung, mammary cancer, prostate cancer, colorectal cancer, ovarian cancer, cervical cancer etc., and certain dependency is arranged with part stage of tumor, prognosis, treatment etc.S100P all has expression in about 90% pancreas tumor, knock out through SiRNA after the expression of S100P in the carcinoma of the pancreas, has proved S100P in the external effect that the promotion tumor growth is arranged, delay apoptosis of tumor cells, promotion tumor migration and invasion and attack.With transfection the pancreatic cancer cell inoculation nude mice of S100P gene, 5 times of tumor growths are greater than control group; And after having knocked out the tumor cell inoculation nude mice of S100P gene, gross tumor volume not only is significantly less than control group, and the also obviously minimizing of probability of metastasis occurs.These researchs have proved growth, the infiltration of S100P and tumour cell and have shifted closely related.The present invention proves that the two anti-associating CIK immunity targeted therapy mechanisms of action of target CD133 positive pancreatic cancer cell have directly related to the promotion pancreatic cancer cell molecular mechanism of growing, delaying apoptosis, promote the key gene S100P of migration and invasion and attack, the remarkable downward modulation of this gene and this scheme antitumous effect direct correlation in the carcinoma of the pancreas target cell.
The CIK cell that the present invention also finds bi-specific antibody equipment obviously strengthens the lethal effect of pancreatic cancer cell, increases with the secretory volume of IFN-γ, and it is the highest to organize numerical value with two anti-equipment CIK, and comparing difference is remarkable between three groups.Immune effector cell can play crucial effects through the secretion Interferon, rabbit in anti tumor immune response; The present invention finds that two anti-equipment CIK cells not only have more powerful targeting killing effect to carcinoma of the pancreas and the liver cancer cell of high expression level CD133; Simultaneously; When BsAb-CIK effector cell and tumour neuron target cell interaction, immune effector cell can be secreted more IFN-γ, thereby has realized the powerful lethal effect that hits the tumour target cell of BsAb-CIK immunocyte.
The present invention also finds significantly to raise through the STAT1 genetic expression of the tumour target cell self of BsAb-CIK effector cell's effect; Confirm through chip gene expression profile analysis and fluorescence quantitative PCR detection; Pancreatic cancer cell is adjusted to 11.91 times in the STAT1 genetic expression significantly after simple CIK handles, and is adjusted to 17.11 times in the tumour cell STAT1 genetic expression significantly after the CIK effect of bi-specific antibody equipment; Two treatment group significant differences, p < 0.05.Signal transduction and activating transcription factor STATs are transcription factor families, are the receptor signals of the necessary pivotal regulatory cell factor of on cell proliferation, survival and differentiation and growth factor.STAT1 can stop the propagation and the cell death inducing of breast epithelium effectively in cell; Research checking to different mouse transplantation models; Be ErbB2/>HER2 positive or negative mouse model and STAT1-/-confirmed that all STAT1 has the effect that mouse interior tumor forms that suppresses in the mouse, and confirmed further that the allelic mouse of floxed stat1 STAT1 suppresses the effect that tumour forms and realizes through cell is autonomous.Therefore think that at present STAT1 is a universal tumor suppressor gene or antioncogene.The tumour cell of discovering forfeiture STAT1 can lose the growth-inhibiting reaction to the Interferon, rabbit mediation, and possibly cause the MHC down-regulated expression, thereby the tumour immunity of escaping the CTL mediation is kept watch on.Discover that the STAT1 activated is low-level relatively poor in close relations with prognosis in the tumour patient cell.And our invention has confirmed that remarkable rise of targeting killing effect and tumour target cell self the STAT1 genetic expression of BsAb-CIK be consistent.
The present invention has confirmed vicious transformation gene S100P gene that anti-CD3/anti-CD133BsAb equipment powerful targeting killing effect of CIK cell and CD133 high expression level carcinoma of the pancreas target cell self taken place first from the therapeutic angle of immunocyte, and obviously the mechanism of action of the remarkable rise of mediation stat1 antioncogene is closely related down, thereby makes this treatment obtain better targeted therapy effect.This method not only is applicable to the carcinoma of the pancreas of CD133 high expression level; And possibly have curative effect to the tumour target cell of other high expression level CD133; And antioncogene stat1 also possibly be worth further furtheing investigate as the level of signification of this immunocyte treatment of monitoring with S100P gene Changing Pattern in immune effector cell secretion of gamma-IFN cytokine levels and the tumour target cell.
The present invention research show the CIK cell through the Anti-CD133xAnti-CD3BsAb equipment can be in vivo and in vitro the effective tumour cell of target killing high expression level CD133; Eliminate novel immunotherapy strategy and the scheme of CD133 positive tumor stem cell important science argument is provided for creating efficient target, kill the knurl mechanism of action and lay a good foundation for deeply inquiring into synergy.
To sum up; The CIK cell that the anti-CD133 bi-specific antibody of anti-CD3/ of the present invention loads can be applicable to prepare the preparation of the cancer cells of treating target killing high expression level CD133; Also can be applicable to prepare the preparation of the tumor stem cell of treating target killing high expression level CD133, also can use the preparation that preparation suppresses tumor growth.The CIK cell that the anti-CD133 bi-specific antibody of anti-CD3/ of the present invention loads also can reduce the S100P genetic expression in the cancer cells; Application in the medicine of the STAT1 genetic expression in the increase cancer cells, cancer cells comprises pancreatic cancer cell, liver cancer cell, lung carcinoma cell, breast cancer cell, glioma cell, prostate cancer cell, colorectal cancer cell, ovarian cancer cell, cervical cancer cell.
Description of drawings:
Fig. 1 is the anti-CD133 bi-specific antibody of anti-CD3/ product 8% a non-reduced sex change SDS-polypropylene amine gel electrophoresis figure;
Fig. 2 cultivated the 1st day for FACS detects CIK cell phenotype figure as a result;
Fig. 3 cultivated the 14th day for FACS detects CIK cell phenotype figure as a result;
Fig. 4 is the anti-CD133 bi-specific antibody equipment of anti-CD3/ CIK cell fluorescence microscopic examination result;
Fig. 5 is that normal people's the CIK cells of two anti-equipments are to SW1990 cell killing experimental result picture;
Fig. 6 is that the CIK cells of two anti-equipments of tumour patient are to SW1990 cell killing experimental result picture;
Fig. 7 is that normal people's the CIK cell of two anti-equipments is to Capan-2 killing experiments figure as a result;
Fig. 8 is that normal people's the CIK cell of two anti-equipments is to Hep3B killing experiments figure as a result;
Fig. 9 is that normal people's the CIK cell of two anti-equipments is to HepG2 killing experiments figure as a result;
The cell culture supernatant IFN-gamma excretory of Figure 10 cell killing experiment is figure as a result;
Figure 11 is a nude mice tumorigenesis result of experiment statistical graph;
Figure 12 is the figure as a result that the CIK cell therapy of two anti-equipments is analyzed the fluorescence quantitative RT-RCR of gene, and left side figure is that S100P, right figure are STAT1.
Embodiment of the present invention only limits to the present invention is further explained and explains, content of the present invention is not constituted restriction.
Embodiment
Main agents and instrument
RPMI1640 available from GIBCO company (Grand Island, NY);
Foetal calf serum buying order clonal antibody is purchased the company in Ortho Biotech, Tokyo, and Japan mouse-anti people CD133/1 (AC133) monoclonal antibody is purchased the company in Miltenyi Biotech, Bergisch Gladbach, Germany; Mouse-anti people CD3-Percp, CD4-FITC, CD8-PE, CD56-APC four labeling antibodies and homotype contrast IgG1 are available from BDpharmingen company;
Mouse-anti people CD133-PE antibody is available from Miltenyi Biotec company;
The human lymphocyte parting liquid is available from Tianjin Hao ocean biological products science and technology limited Company;
(Cell Counting Kit-8 CCK-8) purchases in DOJINDO WST to the cell counting test kit
RCompany;
People IFN-γ ELISA test kit is available from R&D pharmingen;
Flow cytometer is available from R&D pharmingen.
Embodiment 1: the preparation of bi-specific antibody
1. get linking agent Traut's reagent (the 2-iminothiolane HCl that mouse-anti people CD3 monoclonal antibody OKT3 antibody (1mg) is dissolved in 5 times of volumetric molar concentrations; Pierce, Rockford, IL) 500 μ l, effect is 1 hour under the room temperature; With the PD-10 post (Pharmacia, Uppsala Sweden) filter, and remove uncrosslinked monoclonal antibody,
2. get crosslinking aid S ulfo-SMCC (sulfosuccinimidyl4-(N-maleimidomethyl) cyclohexane-1-carboxylate) the 500 μ l that mouse-anti people CD133/1 monoclonal antibody (1mg) is dissolved in 4 times of volumetric molar concentrations; Effect is after 1 hour under the room temperature; With PD-10 post (Pharmacia; Uppsala Sweden) filters, and removes uncrosslinked monoclonal antibody;
3. OKT3 that will be crosslinked and mouse-anti people CD133/1 monoclonal antibody mix back 4 ℃ and spend the night, and prepare the anti-CD133 bi-specific antibody of anti-CD3/.
The anti-CD133 double antibody of anti-CD3/ protein product is through 8% non-reduced, sex change SDS-polypropylene amine gel electrophoresis figure, and coomassie brilliant blue staining detects.Experimental result is as shown in Figure 1; Wherein the 1st electrophoresis band is albumen marker, and 2 is the OKT3 monoclonal antibody of 10ug, and 3 is the CD133/1 monoclonal antibody of 10ug, and 4 is the anti-CD133 bi-specific antibody of anti-CD3/ of 30ug.Detect through protein electrophoresis, confirm that two kinds of antibody linked binary protein bands of the anti-CD133 of anti-CD3/ are 300KD, and monomer is 150KD.
Protein quantification is with BCA (Pierce) test kit, and by specification requires operation, detects two anti-protein contents.
Embodiment 2: the anti-CD133 bi-specific antibody equipment of anti-CD3/ CIK cell
1.CIK the cultivation of cell
Get healthy volunteer's peripheric venous blood 10ml, anticoagulant heparin after saline water dilution in 1: 1, adds to the lymphocyte separation medium upper strata, centrifugal collection mononuclearcell (PBMC), and using the RPMI1640 nutrient solution adjustment cell density that contains 5% foetal calf serum is 2 * 10
5Individual/ml, and adding IFN-γ final concentration is 1,000 unit/mL; Place 37 ℃, behind the cultivation 24h, adding rhIL-1 α final concentration is that 1000U/ml, mouse-anti people CD3McAb final concentration are 50ng/ml in the 5%CO2 incubator; The rhIL-2 final concentration is 1000U/ml, and every 2d liquid feeding replenishes rhIL-2, is cultivating the 14th day; Flow cytometer inspection culturing cell CD3, CD4, CD8 and CD56 phenotype, results CIK cell.
2.CIK the detection of cell phenotype
To adjust concentration with 14 days CIK cell in 1 day be 5 * 10 with cultivating
6Individual/ml, respectively get 200 μ l and add in the Falcon pipe, add mouse-anti people CD3-Percp, CD4-FITC, CD8-PE, CD56-APC four labeling antibodies and each 5 μ l of homotype contrast IgG1 monoclonal antibody; Mixing; Behind 4 ℃ of darkroom reaction 30min, PBS washing 2 times, the upflowing cell instrument detects.Experimental result such as Fig. 2, shown in Figure 3.
3. the anti-CD133 bi-specific antibody of the anti-CD3/ of specific antibody is equipped the CIK cell
Centrifugal collection cultivation 14 days and the CIK cell that detects through phenotype, the PBS washed twice is by 1 * 10
6The two anti-concentration of CIK/50ng add the anti-CD133 bi-specific antibody of anti-CD3/ of embodiment 1 preparation; Room temperature left standstill 60 minutes behind the mixing; Free antibodies on PBS washing CIK cell does not have to combine, centrifugal after fluorescent microscope detects the state that bi-specific antibody loads the CIK cell.
4. fluorescent microscope detects the two anti-equipment CIK cell of fluorescence antibody mark
Double label method: the centrifugal back of CIK cell PBS washing that will resist the anti-CD133 bi-specific antibody of CD3/ to load adds anti-mouse FITC-IgG2a monoclonal antibody, and (anti-mouse IgG2a monoclonal antibody is to the Anti-CD3 monoclonal antibody;) and anti-mouse PE-IgG1 monoclonal antibody (anti-mouse IgG1 monoclonal antibody; To the Anti-CD133 monoclonal antibody) after 4 ℃ of lucifuges hatch 30 minutes; PBS washed twice, fluorescent microscope be inspection cell fluorescence color down.Adopt 1 * 10 simultaneously
6The CIK cell is done contrast.
Experimental result is as shown in Figure 4, and in figure B, CD133 antibody presents red fluorescence under fluorescent microscope; In figure C, CD3 antibody presents green fluorescence under fluorescent microscope; In figure D, the red green color of the cell of two anti-loadings overlaps and under fluorescent microscope, presents fluorescent orange.
Embodiment 3: detect the CDCC of the CIK cell of bi-specific antibody equipment to SW1990
With the CIK cell is the effector cell, as target cell, detects the lethal effect of the CIK cell of the anti-CD133 bi-specific antibody equipment of the anti-CD3/ of contrast with human pancreatic cancer cell SW1990.
The peripheric venous blood of getting 10 parts of normal peoples and 10 parts of tumour patients respectively prepares the CIK cell; And each routine CIK cell is loaded the anti-CD133 bi-specific antibody of anti-CD3/, respectively comparison and detection CIK cell with loaded the killing experiments of the CIK cell of the anti-CD133 bi-specific antibody of anti-CD3/ to the SW1990 cell.
Experimental procedure is: the tumour cell in vegetative period of taking the logarithm, 5000 cells/well are spread 96 porocyte culture plates, add the CIK cell of the anti-CD133 bi-specific antibody equipment of anti-CD3/ of CIK cell, embodiment 2 preparations in second day respectively, 50ng/1 * 10
6The CIK cell is to imitate the concentration co-cultivation 72h of target than 2:1,10:1 and 50:1,3 parallel holes of each concentration; Abandon supernatant; Behind twice in the PBS rinsing cell; Application liquid continues to cultivate 4 hours in the adding Cell counting Kit CCK-8 cell counting test kit, and 96 porocyte culture plates are put into enzyme couplet appearance and detected at the 450nm place absorbancy OD value, by formula calculate the cell killing rate:
Kill rate (%)=[1-(experimental group OD value)/CIK contrast OD value+target cell contrast OD value] * 100%.
Simple CIK cell control group, target cell control group and blank control group are established in experiment simultaneously.
The detection of CDCC: each experimental group is adopted the t check, and < 0.05 is that difference has statistical significance with P.
Shown in CIK cell killing experimental result Fig. 5 of normal people.
Patient CIK cell killing experimental result as shown in Figure 6.
The result find no matter be different effects targets at 2:1,10:1 and 50:1 than under the condition, under same effect target specific concentration, the CIK cell of the anti-CD133 bi-specific antibody equipment of anti-CD3/ is all organized greater than simple CIK the lethal effect of carcinoma of the pancreas target cell.
Show it no matter is the normal people's or patient's CIK through statistical analysis, through the CIK cells of two anti-equipments to the pancreatic cancer cell of high expression level CD133 be the lethal effect of SW1990 to obviously greater than simple CIK group, p < 0.05.The CIK cell of CIK cell and two anti-equipments kills and wounds effect of target cell and effector cell's concentration and is proportionate, and concentration is big more, and the knurl effect is strong more extremely.
Embodiment 4: detect the CDCC of the CIK cell of bi-specific antibody equipment to human pancreatic cancer cell Capan-2
With the CIK cell is the effector cell, as target cell, detects the lethal effect that the CIK cell of the anti-CD133 bi-specific antibody of anti-CD3/ has been equipped in contrast with the low human pancreatic cancer cell Capan-2 that expresses CD133.
CIK cell with the preparation of normal people's peripheric venous blood has been done 10 person-times to the Capan-2 killing experiments respectively:
Experimental technique is with embodiment 3: experimental result is as shown in Figure 7.
The result finds it no matter is that different effect targets at 2:1,10:1 and 50:1 are than under the condition; Under same effect target specific concentration; The CIK of two anti-equipments is that the effect of Capan2 cell killing is all greater than simple CIK group to low pancreatic cancer cell of expressing D133; But the lethal effect difference through two groups of statistical analysis is not remarkable, p>0.05.
Experimental example 5: detect the CDCC of the CIK cell of bi-specific antibody equipment to Bel7402 Hep3B and HepG2
With the CIK cell is the effector cell, as target cell, detects the lethal effect of the CIK cell of the anti-CD133 bi-specific antibody equipment of the anti-CD3/ of contrast with Bel7402 Hep3B and HepG2.
CIK cell with the preparation of normal people's peripheric venous blood has been done 20 person-times to Hep3B and HepG2 killing experiments respectively:
Experimental technique is with embodiment 3: experimental result is like Fig. 8, shown in 9.
The result find no matter be different effects targets at 2:1,10:1 and 50:1 than under the condition, under same effect target specific concentration, the CIK cell of two anti-equipments is that the lethal effect of target cell is all organized greater than simple CIK to liver cancer.CIK cell through the anti-CD133 bi-specific antibody equipment of anti-CD3/ has stronger lethal effect to high expression level CD133 SMMC-7721 Hep3B; Compare with simple CIK cell that there were significant differences; P < 0.05; And not remarkable to the lethal effect difference of low expression CD133 SMMC-7721 HepG2, p>0.05.
CIK cell and the CIK cell of having equipped the anti-CD133 bi-specific antibody of anti-CD3/, it kills and wounds the effect of target cell and effector cell's concentration is proportionate, and concentration is big, and the knurl effect is strong more extremely.
Experimental example 6: cytokines measurement
The vegetative period human pancreatic cancer cell SW1990 of taking the logarithm spreads 96 holes with 5000 cells/well; The CIK that added the anti-CD133 bi-specific antibody equipment of CIK cell or anti-CD3/ in second day; To imitate target, collect supernatant, with ELISA Kit Human IFN-γ (R&D pharmingen (San Diege than the concentration co-cultivation of 2:1,10:1 and 50:1 72 hours; U.S.A)) detect cell IFN-γ secretion level, experimental result is shown in figure 10.
The CIK cell of the two anti-equipments target cell co-cultivation different with four kinds detected cell culture supernatant after 72 hours, all obviously increased with the gamma-interferon secretion level, and remarkable with simple CIK group comparing difference, p < 0.05.
Also detect the secretion level of TNF-a, IL-12, IL-4, IL-10 and TGF-B simultaneously, with the control group no significant difference, do not had visible positive test result between still each is organized.The result shows that the CIK cell of the anti-CD133 bi-specific antibody equipment of anti-CD3/ is closely related to lethal effect and the INF-γ secretion level of target cell.
Experimental example 7: the CIK cell therapy nude mice subcutaneous transplantation knurl experiment of two anti-equipments
Get 8 ages in week 33 of female nude mices, every right oxter subcutaneous injection 2 * 10 of nude mice
6Human pancreatic cancer cell SW1990 cell, tumour is long to the 0.3cm size after 10 days, is divided into 3 groups at random: control group, the CIK group of the anti-CD133 equipment of simple CIK group and anti-CD3/, simple CIK group intraperitoneal injection CIK cell 1 * 10
7Inferior/week, 2 times weekly; Two anti-equipment CIK group intraperitoneal injection BsAb+CIK1 * 10
7Inferior/week, 2 times weekly; 200ul time/week of control group intraperitoneal injection saline water, 2 times weekly.
Put to death mouse in 40 days; Statistics is respectively organized the heavy MV of knurl and SD is: control group 0.4592 ± 0.046 gram, CIK group 0.2683 ± 0.0733, two anti-equipment groups 0.1197 ± 0.074; Show through statistical analysis; Compare with simple CIK treatment group, more remarkable to the growth-inhibiting effect of mouse high expression level CD133SW1990 cell subcutaneous transplantation knurl through the CIK cells of two anti-equipments, control group and CIK organize relatively p=0.01; Control group compares p=0.003 with the CIK groups of cells of two anti-equipments, CIK group and two anti-CIK groups of cells p=0.013 that equip.The statistical experiment data are shown in figure 11.
Experimental result shows, is equipped with two anti-CIK cells the growth of tumor phase is arrived very obvious suppression effect.
Experimental example 8: fluorescence quantitative RT-RCR
Human pancreatic cancer cell SW1990 is with 2 * 10
6Individual cell kind is gone in the culturing bottle, adds 2 * 10 respectively in second day
7The CIK of the anti-CD133 equipment of CIK cell or anti-CD3/ (imitating target specific concentration 10:1) stays one bottle of untreated tumour cell to do blank, co-cultivation 24 hours; Abandon supernatant; PBS rinsing cell twice adds TRIZOL1ml, the collecting cell lysate; Extracting total RNA with total RNA test kit, is template rt cDNA with total RNA.
Use ABI-Prism7000Sequence Detector system to do fluorescence quantitative PCR detection;
The synthetic primer sequence:
S100P upstream primer: SEQ ID NO:1GCAGCACGCAGACCCTGACCAA;
S100P downstream primer: SEQ ID NO:2GCAGCCACGAACACGATGAAC;
STAT1 upstream primer: SEQ ID NO:3GTTAGGCTATTCACAACCACTC;
STAT1 downstream primer: SEQ ID NO:4ACTTCACGAAACATCATCCAC;
β-actin upstream primer: SEQ ID NO:5AGCGAGCATCCCCCAAAGTT;
β-actin downstream primer: SEQ ID NO:6GGGCACGAAGGCTCATCATT;
Above-mentioned primer sequence is synthetic by the biological invitrogen of hundred dimension letters company.
Reaction system: 10 * Buffer1ul, dNTP (10mM) 0.25ul, primer2ul, Taq enzyme 0.1ul, SYBR Green I0.5ul, template cDNA1ul, ddH
2O5.15ul, TV 10ul.
Response procedures: preparatory 95 ℃ of 2mi of sex change, 94 ℃ of 30 circulation sex change, 10sec anneal 55 ℃, 72 ℃ of 10sec extensions, 30sec.
Data processing: calculate Folds=2-
△ △ Ct, △ △ Ct=(Ct1-Ct2)-(Ct3-Ct4),
Ct1: the Ct that handles the sample testing gene; Ct2: the Ct that handles the sample house-keeping gene; Ct3: the Ct of control sample testing gene; Ct4: control sample.
Statistical analysis
Experimental data is represented with
; Use SPSS11.5 statistics software and carry out variance analysis, correlation analysis and t check; Inspection level α=0.05 is that difference has statistical significance with p ﹤ 0.05.Analytical results (* p＜0.05, #p＜0.01) shown in figure 12, wherein, left side figure is that S100P, right figure are STAT1.
Claims (4)
1. the anti-CD133 bi-specific antibody of anti-CD3/ is characterized in that described bi-specific antibody contains the monoclonal antibody of anti-CD3 and the monoclonal antibody of anti-CD133.
2. the preparation method of the anti-CD133 bi-specific antibody of anti-CD3/ according to claim 1 is characterized in that, may further comprise the steps:
(1) will resist the monoclonal antibody 1mg of CD3 to be dissolved in Traut ' s reagent, 15～25 ℃ act on 1～2 hour down; Filter with the PD-10 post, remove uncrosslinked monoclonal antibody;
(2) CD133/1 monoclonal antibody 1mg is dissolved in crosslinking aid S ulfo-SMCC, and 15～25 ℃ act on 1～2 hour down; Filter with the PD-10 post, remove uncrosslinked monoclonal antibody;
(3) with step (1) step (2) obtain crosslinked after monoclonal antibody mix 1～4 ℃ of effect 12～18 hours down.
3. the CIK cell that loads of the anti-CD133 bi-specific antibody of the described anti-CD3/ of claim 1.
4. the preparation method of the CIK cell of the anti-CD133 bi-specific antibody of the anti-CD3/ of fusion according to claim 3 is characterized in that, may further comprise the steps:
(1) cultivation of CIK cell:
Get healthy peripheric venous blood 10ml, anticoagulant heparin after saline water 1:1 dilution, adds to the lymphocyte separation medium upper strata, centrifugal collection mononuclearcell, and using the RPMI1640 nutrient solution adjustment cell density that contains 5% foetal calf serum is 2 * 10
6Individual/ml, place 37 ℃, 5%CO
2Cultivate 12～24h in the incubator, add rhIL-1 α 100U/ml, mouse-anti people CD3 McAb 50ng/ml then, rhIL-2 1000U/ml; Added rhIL-2 1000U/ml in per two days; Cultivating inspection CD3, CD4, CD8 and CD56, results CIK cell the 14th day;
(2) detection of CIK cell phenotype:
The CIK cell concn that 0 day and 14 days are cultivated in adjustment is 5 * 10
6Individual/ml, respectively get 200 μ l and add in the centrifuge tube, add mouse-anti people CD3-Percp, CD4-FITC, CD8-PE, CD56-APC four labeling antibodies and each 5 μ l of homotype contrast IgG1 monoclonal antibody; Mixing; Behind 4 ℃ of darkroom reaction 20～40min, PBS washing 1～3 time, flow cytometer detects CD3 positive cell>=85% in the CIK cell; The two positive cells of CD3 and CD8>=60%, the two positive cells of CD3 and CD56>=20%;
(3) the anti-CD133 bi-specific antibody equipment of anti-CD3/ CIK cell:
Centrifugal collection cultivation 14 days and the CIK cell that detects through phenotype, PBS washing 1～3 time is by 1 * 10
6The two anti-concentration of CIK/50ng add the anti-CD133 bi-specific antibody of anti-CD3/, and room temperature left standstill 40～80 minutes behind the mixing, PBS washing 1～3 time.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102385279A CN102775494A (en) | 2012-07-10 | 2012-07-10 | CD3 resistance/CD133 resistance bi-specific antibody and CIK (cytokine-induced killer) cells loaded by CD3 resistance/CD133 resistance bi-specific antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102385279A CN102775494A (en) | 2012-07-10 | 2012-07-10 | CD3 resistance/CD133 resistance bi-specific antibody and CIK (cytokine-induced killer) cells loaded by CD3 resistance/CD133 resistance bi-specific antibody |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102775494A true CN102775494A (en) | 2012-11-14 |
Family
ID=47120622
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012102385279A Pending CN102775494A (en) | 2012-07-10 | 2012-07-10 | CD3 resistance/CD133 resistance bi-specific antibody and CIK (cytokine-induced killer) cells loaded by CD3 resistance/CD133 resistance bi-specific antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102775494A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925410A (en) * | 2012-11-19 | 2013-02-13 | 昆明理工大学附属医院 | Method for preparing CIK cell by using heparin anticoagulant plasma |
| CN104450615A (en) * | 2013-09-25 | 2015-03-25 | 深圳市北科生物科技有限公司 | Cell CTL (BiAT) with bispecific antibody as well as preparation method and application thereof |
| CN104829725A (en) * | 2015-01-21 | 2015-08-12 | 武汉友芝友生物制药有限公司 | Construction and application of bispecific antibody CD133*CD3 |
| WO2016011571A1 (en) * | 2014-07-21 | 2016-01-28 | Wuhan Yzy Biopharma Co., Ltd. | Bispecific antibody-mediated cancer therapy with cytokine-induced killer cell |
| CN107286222A (en) * | 2017-06-20 | 2017-10-24 | 国家纳米科学中心 | The polypeptide of targeting tumor stem cells mark CD133 a kind of and its application |
| CN111826400A (en) * | 2020-07-21 | 2020-10-27 | 中科宝承生物医学科技有限公司 | Preparation method of bispecific antibody NK cell, cell and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN202107707U (en) * | 2011-06-30 | 2012-01-11 | 苏州市立医院（东区） | CIK (cytokine induced killer) cell induction activating reagent kit |
-
2012
- 2012-07-10 CN CN2012102385279A patent/CN102775494A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN202107707U (en) * | 2011-06-30 | 2012-01-11 | 苏州市立医院（东区） | CIK (cytokine induced killer) cell induction activating reagent kit |
Non-Patent Citations (5)
| Title |
|---|
| 《Clin Cancer Res》 20061231 John K. Chan et al. Enhanced Killing of Primary Ovarian Cancer by Retargeting Autologous Cytokine-Induced Killer Cells with Bispecific Antibodies: A Preclinical Study 第12卷, * |
| JOHN K. CHAN ET AL.: "Enhanced Killing of Primary Ovarian Cancer by Retargeting Autologous Cytokine-Induced Killer Cells with Bispecific Antibodies: A Preclinical Study", 《CLIN CANCER RES》, vol. 12, 31 December 2006 (2006-12-31) * |
| LM SMITH ET AL.: "CD133/prominin-1 is a potential therapeutic target for antibody-drug conjugates in hepatocellular and gastric cancers", 《BRITISH JOURNAL OF CANCER》, vol. 99, 10 June 2008 (2008-06-10) * |
| 张林 等: "双功能抗体介导CIK 细胞杀伤胃癌细胞的实验研究", 《胃肠病学和肝病学杂志》, vol. 19, no. 11, 30 November 2010 (2010-11-30) * |
| 王文红 等: "三种外周血扩增CIK细胞方法的比较研究", 《江苏大学学报(医学版)》, vol. 13, no. 5, 31 October 2003 (2003-10-31) * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925410A (en) * | 2012-11-19 | 2013-02-13 | 昆明理工大学附属医院 | Method for preparing CIK cell by using heparin anticoagulant plasma |
| CN104450615A (en) * | 2013-09-25 | 2015-03-25 | 深圳市北科生物科技有限公司 | Cell CTL (BiAT) with bispecific antibody as well as preparation method and application thereof |
| WO2016011571A1 (en) * | 2014-07-21 | 2016-01-28 | Wuhan Yzy Biopharma Co., Ltd. | Bispecific antibody-mediated cancer therapy with cytokine-induced killer cell |
| CN106999556A (en) * | 2014-07-21 | 2017-08-01 | 武汉友芝友生物制药有限公司 | The treatment of cancer of the Mediated by Bi-specific Antibodies of cytokine induced kill cell |
| CN104829725A (en) * | 2015-01-21 | 2015-08-12 | 武汉友芝友生物制药有限公司 | Construction and application of bispecific antibody CD133*CD3 |
| CN107286222A (en) * | 2017-06-20 | 2017-10-24 | 国家纳米科学中心 | The polypeptide of targeting tumor stem cells mark CD133 a kind of and its application |
| CN107286222B (en) * | 2017-06-20 | 2020-05-19 | 国家纳米科学中心 | Polypeptide of targeted tumor stem cell marker CD133 and application thereof |
| CN111826400A (en) * | 2020-07-21 | 2020-10-27 | 中科宝承生物医学科技有限公司 | Preparation method of bispecific antibody NK cell, cell and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102727524B (en) | Application of CIK (cytokine induced killer) cell loaded by anti-CD3/anti-CD133 bispecific antibody | |
| Karlitepe et al. | New approaches for cancer immunotherapy | |
| CN102775494A (en) | CD3 resistance/CD133 resistance bi-specific antibody and CIK (cytokine-induced killer) cells loaded by CD3 resistance/CD133 resistance bi-specific antibody | |
| Liu et al. | Safety and antitumor activity of GD2-Specific 4SCAR-T cells in patients with glioblastoma | |
| CN110520438A (en) | Oncolytic viral therapy | |
| CN108392633A (en) | Application of the PCSK9 inhibitor in malignant tumour immunization therapy | |
| CN103113470A (en) | Genetically engineered lymphocyte targeting Human EGFR (Epidermal Growth Factor Receptor), preparation method and application of genetically engineered lymphocyte | |
| CN105949325A (en) | Chimeric antigen receptor containing CD27 intracellular domain, lentiviral vector and application thereof | |
| CN105176927A (en) | Preparation method of cytotoxicity-enhanced efficient target killing NK/CIK (Natural Killer)/( Cytokine Induced Killer) cells | |
| CN106222141B (en) | NK cell culture fluids and cell culture processes | |
| CN104262459B (en) | Acute monocytic leukemia-associated antigen MLAA-34 epitope polypeptide, and vaccine and pharmaceutical application of acute monocytic leukemia-associated antigen MLAA-34 epitope polypeptide | |
| CN110343665A (en) | A kind of novel C AR-T cell and its application | |
| Tong et al. | Adoptive natural killer cell therapy is effective in reducing pulmonary metastasis of Ewing sarcoma | |
| CN107557337A (en) | A kind of immunocyte of safety-type Chimeric antigen receptor modifications of anti-ROR1 and its application | |
| Li et al. | Sorafenib attenuated the function of natural killer cells infiltrated in HCC through inhibiting ERK1/2 | |
| Samadani et al. | CAR T-cells profiling in carcinogenesis and tumorigenesis: an overview of CAR T-cells cancer therapy | |
| CN103396992A (en) | Culture and application of oligoclonal tumor-infiltrating lymphocytes for liver cancer | |
| Demuytere et al. | The tumor immune microenvironment in peritoneal carcinomatosis | |
| Wang et al. | Preconditioning of radiotherapy enhances efficacy of B7-H3-CAR-T in treating solid tumor models | |
| CN104906575A (en) | Application of LSECtin as melanoma immunotherapy target | |
| CN107158367A (en) | Colorectal cancer stem cells vaccine preparation method and application | |
| CN104017770B (en) | Method for preparing CIK cell by using glycolipid | |
| CN103239479A (en) | Animal model establishment method of human primary skin squamous epithelial cell cancer stem cell | |
| Tian et al. | TRIM59: a membrane protein expressed on bacillus Calmette-Guerin-activated macrophages that induces apoptosis of fibrosarcoma cells by direct contact | |
| CN106479973A (en) | A kind of external IAK immunocyte cultural method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20121114 |