CN102775490A - Secretory protein with migration activity and application thereof - Google Patents
Secretory protein with migration activity and application thereof Download PDFInfo
- Publication number
- CN102775490A CN102775490A CN2011104186862A CN201110418686A CN102775490A CN 102775490 A CN102775490 A CN 102775490A CN 2011104186862 A CN2011104186862 A CN 2011104186862A CN 201110418686 A CN201110418686 A CN 201110418686A CN 102775490 A CN102775490 A CN 102775490A
- Authority
- CN
- China
- Prior art keywords
- polynucleotide
- fam19a5
- albumen
- protein
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides a chemotactic leucocyte and an FAM19A5 secretory protein of amino acid sequence as shown in SEQ ID NO: 1 of tumor, a polynucleotide coding the protein, and a polynucleotide-containing genetic engineering carrier. The invention further relates to a drug composite, the protein or polynucleotide-containing genetic engineering carrier and/or host cell, and a pharmaceutically acceptable salt, carrier or excipient. The invention further relates to a method for detecting the expression level change of the protein or the polynucleotide in vitro. Furthermore, the protein or the polynucleotide can be used for preventing and/or curing the virus infection, the allergic diseases, the inflammatory response, the transplant rejection, the cerebral disease, the autoimmunity disease, the tumor metastasis, the immune adjustment, the proliferation and differentiation of stem cells, the osteoporosis, the obesity, the insulin resistance and the cardiovascular disease such as the arteriosclerosis, the angiosteosis and the like, and can be used for commercialized agent to research the symptoms. The protein or the polynucleotide can be further taken as a target to develop the compound, the antibody, the polypeptide drug and the commercialized reagent.
Description
Technical field
The present invention relates to the genetically engineered field; Especially; The present invention relates to have the albumen of multiple function and encode its polynucleotide, the engineering carrier that comprises polynucleotide and corresponding pharmaceutical compositions, the invention still further relates to the application of said albumen and polynucleotide and pharmaceutical composition thereof.
Background technology
Cytokine is the small molecules soluble protein with multiple physiologically active and participation pathologic reaction by the various cell synthesis secretions of body.Chemokine is one type of cytokine with chemotaxis, in processes such as cardiovascular disorder such as virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and the insulin resistant of body, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure, plays a significant role.At present, chemokine has become one of focus of domestic and international research.
The human genome frame diagram accomplished for 10 anniversaries; Present task is to illustrate the function of ten hundreds of gene and product thereof; Deeply be familiar with the genes involved and the molecule mechanism of disease development; Find diseases predisposing gene, disease-resistant gene, drug sensitive gene, find new drug target and new biotech drug.These work will spend more than gene sequencing more times, bigger input and more heavy work amount, and will be also more challenging.
The chemokine superfamily member has certain homologous structure; Arrangement mode according to preceding 2 Cys of 4,6 conservative in primary structure Cys; Can the chemokine superfamily be divided into CXC, CC, C and four subfamilies of CX3C; Their function also has various biological effects such as cell activation except that chemotactic activity.These chemokines and stride the g protein coupled receptor specific combination of film for seven times to cell, are brought into play its BA through G protein transduction signal.Up to now, about 50 kinds of chemokines and 20 kinds of Chemokine Receptors come to light, and wherein multiple chemokine can be through same Chemokine Receptors performance chemotaxis, and same chemokine also can be through acting on several kinds of Chemokine Receptors performance chemotaxiss.
In recent years, variation has taken place in immunotherapy, becomes even more important approach from the basis to the clinical drug development that is transformed into.How to be organized in physiology and the pathology activity and to play a role through describing relevant chemokine of immunity system and part thereof, the hint chemokine has powerful potential applicability in clinical practice, can be as the treatment target of immunotherapy or auxiliary therapeutical agent or main therapy.
The inventor utilizes human functional genomics DB; Bioinformatic analysis; Molecular biology, cytobiology and immunological technique; From the Human genome DB, excavate new gene, for pathogenesis, discovery disease marker, genomic drug target (exploitation compound, antibody, polypeptide drugs) or the genetically engineered drug of illustrating disease provides the basis with important physiological, pathology sense.
The detection method of genetic expression and coded product protein expression thereof comprises detection methods such as reverse transcription-polymerase chain reaction, western blotting, ELISA, FACS, immunofluorescence, immunohistochemical methods, immunocytochemistry.Can be applied to cell and the genetic expression of tissue and the detection of coded product protein expression thereof in experimental study and clinical physiological and the pathologic conditions (cardiovascular disordeies such as virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure).
Gene and coded product protein thereof with important physiological, pathology sense; Can be used as drug targets; Compound, antibody, polypeptide drugs or genetically engineered drug and the commercialization reagent of exploitation target this a part itself and interacting molecule thereof; Be applied to pathogenesis research, the research of disease marker and clinical detection, and the treatment of research and clinical medicine.
Summary of the invention
Utilize bioinformatics technique, the present invention has successfully filtered out the new cytokine with chemotactic activity first from new gene, i.e. FAM19A5 (Family with sequence similarity 19, member A5), and its nucleotide sequence is at Gen-bank
TMNumber of registration be BC039396.1; NM_001082967.1; NM_015381.5.Wherein, BC039396.1, NM_001082967.1 and NM_015381.5 114,132 and 125 amino acid of encoding respectively have a chemotactic activity external.The present invention has chemotactic activity through the experiment proof FAM19A5 of protein expression, purifying, the order-checking of N end and chemotactic Function detection secretory protein is 89 aminoacid sequences of its C end.The present invention also is included in some other the new albumen that obtains successively on the basis of FAM19A5.
The present invention provides a kind of albumen with chemotactic activity on the one hand.
The present invention provides a kind of coding proteic polynucleotide of the present invention on the other hand.
The present invention provides a kind of engineering carrier that contains polynucleotide of the present invention on the other hand.
The present invention provides a kind of pharmaceutical composition on the other hand, and this pharmaceutical composition contains albumen of the present invention, polynucleotide and/or engineering carrier, and the acceptable salt of one or more medicines or pharmaceutically acceptable carrier or vehicle.
The present invention provides the application in albumen of the present invention or polynucleotide prevent and/or treat cardiovascular disordeies such as virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure in preparation the medicine on the other hand.
The method whether the present invention provides the expression level that detects albumen of the present invention in the testing sample or polynucleotide to change on the other hand.
The present invention on the other hand the application of albumen of the present invention or polynucleotide in cardiovascular disordeies such as preparation commercialization reagent research virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failures.
The present invention provides the application of developing compound, antibody, polypeptide drugs and commercialization reagent as target with albumen of the present invention or polynucleotide or the proteic interacting molecule of the present invention on the other hand.
According to certain embodiments of the present invention, the present invention provides a kind of albumen, and this albumen comprises:
(1) albumen of the aminoacid sequence shown in SEQ ID NO:1; Or
(2) aminoacid sequence that has (1) said albumen at least 80% homology, its function and the same or similar or different biological function of (1) said proteic function.
Wherein, the albumen of the aminoacid sequence shown in SEQ ID NO:1, (the proteic nucleotide sequence of FAM19A5 is at Gen-bank for 89 aminoacid sequences of the proteic C-terminal of FAM19A5
TMNumber of registration be BC039396.1; NM_001082967.1; NM_015381.5); Be called the FAM19A5 secretory protein in the present invention.
Albumen of the present invention also comprises having and aminoacid sequence at least 80% shown in the SEQ ID NO:1; Preferably at least 85%, more preferably at least 90%, further preferably at least 95%; Especially preferably at least 98%, the more especially preferred sequence of at least 99% homology (sequences match).These sequences can have identical, similar or different biological functions with the sequence shown in the SEQ ID NO:1 of the present invention, preferably have same or analogous function.
In preferred implementations more of the present invention, albumen of the present invention is:
(1) albumen of the aminoacid sequence shown in SEQ ID NO:1; Or
(2) aminoacid sequence that has (1) said albumen at least 90% homology, its function and the same or similar or different biological function of (1) said proteic function.
Moreover according to certain embodiments of the present invention, the present invention also provides a kind of polynucleotide, and these polynucleotide comprise:
(1) polynucleotide of aminoacid sequence shown in the coding SEQ ID NO:1; Or
(2) polynucleotide sequence that has (1) said polynucleotide at least 80% homology, its encoded protein has same or similar or different biological functions with the albumen of (1) said polynucleotide encoding.
Aminoacid sequence shown in SEQ ID NO:1 is 89 aminoacid sequences of FAM19A5 secretory protein.The polynucleotide sequence of the present invention FAM19A5 secretory protein of can only encoding also can increase non-coding sequence on the basis of above-mentioned proteic encoding sequence, for example intron, encoding sequence 5 ' or the non-coding sequence of 3 ' end etc.Polynucleotide sequence of the present invention preferably provides with unpack format.Polynucleotide of the present invention are " separation " forms, and it not only separates with the protein of in cell, following it, and the sequence that under native state, has been arranged in its both sides is separated.
In embodiments more of the present invention; The present invention also comprises having and coding FAM19A5 secretory protein or its segmental polynucleotide at least 70%, preferably at least 80%, more preferably at least 85%; Further preferably at least 90%, especially preferably at least 95%, the polynucleotide sequence of preferred more especially at least 98% homology.Preferably; Polynucleotide of the present invention are and the polynucleotide sequence of aminoacid sequence shown in the coding SEQ ID NO:1 or the polynucleotide that its fragment has at least 80% homology that the albumen of this polynucleotide encoding has same or similar or different biological functions with the albumen shown in the SEQ ID NO:1.
Also have, according to certain embodiments of the present invention, the invention still further relates to a kind of engineering carrier, this engineering carrier contains the polynucleotide of the secretory protein of the present invention of encoding.Said engineering carrier can be general carrier, expression vector etc.
In addition; According to certain embodiments of the present invention, the present invention also provides the application in said FAM19A5 secretory protein prevents and/or treats cardiovascular disordeies such as virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure in preparation the medicine.
The present invention is through the experiment proof; FAM19A5 secretory protein of the present invention has the chemotactic activity suitable with chemokine; And its derive from human itself, so the FAM19A5 secretory protein has broad application prospects aspect the preventing and/or treating of multiple disease.
In addition; According to certain embodiments of the present invention, the present invention also provides the application of said FAM19A5 secretory protein in cardiovascular disordeies such as preparation commercialization reagent research virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failures.
In addition; According to certain embodiments of the present invention; The present invention also provides the method for the expression level of albumen of the present invention in the sample of a kind of vitro detection from person to be measured or polynucleotide, and this method is reverse transcription-polymerase chain reaction, western blotting or ELISA, FACS, immunofluorescence, immunohistochemical methods, immunocytochemistry detection method.
Description of drawings
Fig. 1 shows the expression of results of utilizing Western Blotting to detect the FAM19A5 secretory protein.After adding the effect of Anti-c-myc antibody, add the anti-mouse IgG two anti-reactions of IRDyeTM 800 marks again, scan through Odyssey Imaging System.Wherein: A is that FAM19A5 (BC039396.1)-myc-his crosses the supernatant of expression, and two clear bands are arranged at the 22kd place; B is that FAM19A5 (NM_001082967)-myc-his crosses the supernatant of expression, and two clear bands are arranged at the 22kd place; C is that FAM19A5 (NM_015381.5)-myc-his crosses the supernatant of expression, and a clear band is arranged at the 22kd place.
Fig. 2 shows the chemotaxis of FAM19A5 secretory protein supernatant.Wherein: A-1, A-2 and A-3 show that respectively FAM19A5 (BC039396.1), FAM19A5 (NM_001082967.1) and FAM19A5 (NM_015381.5) are to the PBMC chemotaxis; And pcDB expresses supernatant for contrasting, and visible FAM19A5 has tangible chemotaxis; B shows FAM19A5 to the chemotaxis of cavy neutrophil leucocyte, and pcDB expresses supernatant for contrasting, and visible FAM19A5 has tangible chemotaxis; C shows FAM19A5 to the U937 chemotaxis, and pcDB expresses supernatant and is contrast, and FAM19A5 has tangible chemotaxis; D shows FAM19A5 to the Jurkat chemotaxis, and pcDB expresses supernatant and is contrast, and FAM19A5 has tangible chemotaxis; E shows FAM19A5 to the THP-1 chemotaxis, and pcDB expresses supernatant and is contrast, and FAM19A5 has tangible chemotaxis.
Fig. 3 A shows FAM19A5-myc-his6 eukaryotic protein N end sequencing result, shows 10 amino acid whose results of the N end order-checking of FAM19A5 (BC039396.1)-myc-his clear band at the 22kd place particularly.
Fig. 3 B1 shows FAM19A5-myc-his6 eukaryotic protein N end sequencing result, shows 10 amino acid whose results of the N end order-checking of FAM19A5 (NM_001082967)-myc-his two clear bands at the 22kd place particularly.
Fig. 3 B2 with Fig. 3 B1, also shows FAM19A5-myc-his6 eukaryotic protein N end sequencing result, shows 10 amino acid whose results of the N end order-checking of FAM19A5 (NM_001082967)-myc-his two clear bands at the 22kd place particularly.
Fig. 3 C shows 10 amino acid whose results of the N end order-checking of FAM19A5 (NM_015381.5)-myc-his clear band at the 22kd place.
Fig. 4 shows that RT-PCR identifies PBMC FAM19A5 changes in mRNA transcription level under different concns LPS (Lipopolysaccharides) stimulates.Among the figure, the 1st swimming lane is a molecular weight standard; 2nd, 3,4,5,6,7,8 swimming lanes are to use LPS 10ng/ml respectively with PBMC respectively, and it is template that 1 μ g/ml, 5 μ g/ml stimulate the rt cDNA of 6h, 24h respectively.Wherein, A shows that (F1, the electrophoresis result of R1) taking turns for primer amplification 40 are not seen any specific band with FAM19A5isoform1; B shows (F1, the electrophoresis result of R1) taking turns for primer amplification 35, visible clear band at the 353bp place with FAM19A5isoform2; C shows that (visible clear band is internal standard at the 496bp place for F1, the electrophoresis result of R1) taking turns for primer amplification 22 with GAPDH.
Fig. 5 shows FAM19A5 protokaryon protein sample behind the purifying through the 12.5%SDS-PAGE electrophoresis, directly coomassie brilliant blue staining.Among the figure, the arrow indication is the former nucleoprotein of FAM19A5-his6.The 1st swimming lane is that FAM19A5 goes up appearance 30 μ l; The 2nd swimming lane is BSA 100 μ g; The 3rd swimming lane is BSA500 μ g; The 4th swimming lane is BSA 1000 μ g; The 5th swimming lane is that FAM19A5 goes up appearance 5 μ l.
Fig. 6 A and 6B show the chemotaxis of the former nucleoprotein of FAM19A5 to the THP-1 cell.It is the most obvious wherein to be illustrated in FAM19A5 protokaryon protein 10 0ng/ml chemotaxis.
Fig. 7 shows the express spectra of FAM19A5 at each tissue of the mankind.Among the figure, the 1st swimming lane is a molecular weight standard; 2nd, 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17 swimming lanes are respectively people's the heart, brain, placenta, lung, liver, Skelettmuskel, kidney, pancreas, spleen, thymus gland, prostate gland, testis, ovary, small intestine, colon, the cDNA library of peripheral blood lymphocyte.Wherein, A shows (F1, the electrophoresis result of R1) taking turns for primer amplification 40, visible clear band at the 311bp place with FAM19A5isoform1; B shows (F1, the electrophoresis result of R1) taking turns for primer amplification 40, visible clear band at the 353bp place with FAM19A5isoform2; C shows that (visible clear band is internal standard at the 496bp place for F1, the electrophoresis result of R1) taking turns for primer amplification 25 with GAPDH.The result shows: FAM19A5isoform1 expresses in brain, lung, liver, Skelettmuskel, kidney, thymus gland, testis, ovary, small intestine, colon, and surplus organizing do not seen expression; FAM19A5isoform2 expresses in brain, kidney, pancreas, testis, ovary, small intestine, colon, and surplus organizing do not seen expression.
Fig. 8 A and 8B show FAM19A5 endogenous location in MCF-7 MCF7: A, B are the painted result of cellular immunofluorescence.C, D are the result of cellular immunization cytochemical staining.A shows that homotype control rats IgG detects endogenous FAM19A5 location; The FAM19A5 monoclonal antibody that shows B detects the location of endogenous FAM19A5 at the MCF7 cell; C is shown as homotype control rats IgG and detects the location of endogenous FAM19A5 at the MCF7 cell; The FAM19A5 monoclonal antibody that shows D detects the location of endogenous FAM19A5 at the MCF7 cell.
Fig. 9 A and 9B show the result of FAM19A5 at the aorta immunohistochemical staining of rat aorta balloon injury model.A, B, C, D are respectively that 4 different rats are individual.Caption 200 * and 400 * be respectively the opticmicroscope magnification, "+" expression balloon injured group rat, "-" expression does not damage control rats.
Figure 10 shows the result of FAM19A5 at atherosclerotic's atherosclerotic plaque immunohistochemical staining.A, B are respectively 2 different cases.Caption 200 * and 400 * being respectively the opticmicroscope magnification, Rat IgG is the homotype contrast of antibody, Rat anti 19A5 representes to detect the positive signal of FAM19A5 in tissue with the FAM19A5 monoclonal antibody.
Figure 11 A to 11D shows the result of FAM19A5 at the fatty tissue immunohistochemical staining.Picture A is the immunohistochemical staining result of mouse lung tissue.B is the result of breast tumor immunohistochemical staining.C is the result of ovarian tumor immunohistochemical staining.D is the result of normal parathyroid gland immunohistochemical staining.Caption 200 * with 400 * be respectively opticmicroscope magnification.
Embodiment
Below carry out comparatively detailed explanation with regard to some embodiments to aforesaid subject matter.Yet should be appreciated that these explanations and the listed embodiment in back are not the scopes that is used for limiting claim of the present invention.
The present invention has made up FAM19A5 eukaryon expression plasmid pCDNA3.1-FAM19A5 (BC039396.1; NM_001082967.1; NM_015381.5)-and MYC-HIS6 and 293T eukaryotic expression system, through expression, purifying, obtain the FAM19A5 recombinant protein of secreting, expressing.The FAM19A5 supernatant of secreting, expressing has chemotaxis to human peripheral blood mononuclear cell, cavy neutrophil leucocyte and U937, Jurkat, THP-1 cell.Further separate to obtain the FAM19A5 protein band, carry out the order-checking of N end, obtain a kind of FAM19A5 secretory protein, be the mature form of the FAM19A5 secretory protein found first in the world in the experiment of the present invention through SDS-PAGE.Simultaneously, the present invention has made up the prokaryotic expression plasmid of this secretory protein, and carries out prokaryotic expression and obtain the former nucleoprotein of FAM19A5.This albumen is to having chemotaxis to the THP-1 cell.
In albumen provided by the present invention, the albumen of the aminoacid sequence shown in the SEQ ID NO:1, (the proteic nucleotide sequence of FAM19A5 is at Gen-bank for 89 aminoacid sequences of the proteic C-terminal of FAM19A5
TMNumber of registration be BC039396.1; NM_001082967.1; NM_015381.5); Be called the FAM19A5 secretory protein in the present invention.Albumen of the present invention comprises that also the homology (sequences match) with the aminoacid sequence shown in the SEQ ID NO:1 surpasses 80%; Preferably surpass 85%, more preferably surpass 90%, further preferably surpass 95%; Especially preferably surpass 98%, more especially preferably surpass 99% sequence.These sequences can have identical, similar or different biological functions with the sequence shown in the SEQ ID NO:1 of the present invention, preferably have same or analogous function.
FAM19A5 secretory protein of the present invention or its fragment can be natural, synthetic, semisynthetic, or reorganization produce.FAM19A5 secretory protein of the present invention can be according to Steward and Young (Steward, J.M.andYoung, J.D.; Solid Phase Peptide Synthesis; 2nd Ed., Pierce Chemical Company, Rockford; I11., (1984)) method described is with Applied Biosystem synthesizer or Pioneer
TMIt is synthetic that peptide synthesizer is pressed the solid state chemistry technology.Generally, these methods comprise the amino acid that on the peptide chain of growing up, adds one or more amino acid or due care successively.Usually; First amino group of amino acids or carboxyl are protected with the proper protection base; Amino acid with protection is connected on the inertia solid phase carrier then, under being suitable for forming the condition of amido linkage, adds corresponding amino or carboxyl subsequently by the next amino acid in the sequence of due care.Remove the protection base from initiate amino-acid residue then, add the next amino acid of due care in case of necessity again, so repetitive operation.After all amino acid are with correct being linked in sequence, remove any remaining protection base and solid support in succession or simultaneously, obtain final albumen.Through this standard program of simple modification, maybe be once to becoming long-chain to add more than one amino acid.In a preferred implementation of the present invention, use automatic DNA synthesizer DNA to prepare albumen of the present invention.Wherein use α amino by the amino acid of acid or the protection of alkali sensitive groups.This protection base should be stablized under the peptide bond formation condition, removes easily again and does not destroy the peptide chain of growth, can not cause any chiral centre racemize wherein.The proper protection base has 9-fluorenyl methoxy carbonyl (Fmoc), tertbutyloxycarbonyl (Boc), carbobenzoxy-(Cbz) (Cbz), 2-cyanic acid tertbutyloxycarbonyl etc.9-fluorenyl methoxy carbonyl (Fmoc) is that synthetic peptide of the present invention is preferred especially.Also can produce albumen of the present invention (specifically referring to embodiment 1-4) by the coding of the recombinant DNA sequence in the host cell by the biological engineering method of routine.In embodiment 1-4, the FAM19A5 encoding sequence is inserted expression system, through expression, purifying, obtain the FAM19A5 recombinant protein of secreting, expressing, further separate obtaining the FAM19A5 protein band through SDS-PAGE, carry out N and hold order-checking, obtain albumen of the present invention.Those skilled in the art can know; Can directly use coding proteic polynucleotide sequence of the present invention to produce FAM19A5 secretory protein of the present invention; The proteic polynucleotide sequence of the present invention (sequence shown in SEQ ID NO:1 or its fragment) of for example will encoding directly inserts expression system; Through expression, purifying, obtain albumen of the present invention.Perhaps can use the mRNA that is derived from DNA construct of the present invention, in cell free translation system, produce required albumen.
Those of ordinary skills can know that albumen of the present invention or its fragment can form fusion rotein with other albumen or its fragment.Other albumen or its fragment generally are known, and some can be bought with carrier format and obtain, and perhaps can synthesize or from the known organism body, clone by ordinary method to obtain.
Aminoacid sequence shown in SEQ ID NO:1 is 89 aminoacid sequences of FAM19A5 secretory protein.The polynucleotide sequence of the present invention FAM19A5 secretory protein of can only encoding also can increase non-coding sequence on the basis of above-mentioned proteic encoding sequence, for example intron, encoding sequence 5 ' or the non-coding sequence of 3 ' end etc.Polynucleotide sequence of the present invention preferably provides with unpack format.Polynucleotide of the present invention are " separation " forms, and it not only separates with the protein of in cell, following it, and the sequence that under native state, has been arranged in its both sides is separated.
The present invention also comprises having and coding FAM19A5 secretory protein or its segmental polynucleotide at least 70%, preferably at least 80%, more preferably at least 85%; Further preferably at least 90%, especially preferably at least 95%, the polynucleotide sequence of preferred more especially at least 98% homology.Be particularly related under stringent condition the polynucleotide with the multi-nucleotide hybrid of FAM19A5 secretory protein, said " stringent condition " means the prerequisite that hybridization takes place is 95% the homology that possesses FAM19A5 between sequence at least.Such sequence can be natural existence or artificial the generation, can comprise the allelic variation body of the polynucleotide sequence of FAM19A5 secretory protein, also can comprise disappearance, insertion and the displacement of base in the FAM19A5 secretory protein polynucleotide sequence.The albumen of such sequence encoding can be identical, similar or different with FAM19A5 secretory protein of the present invention on function, but the preferably coding and the essentially identical albumen of BA of FAM19A5 secretory protein.Therefore; Preferably; Polynucleotide of the present invention are to have and the polynucleotide sequence of aminoacid sequence shown in the coding SEQ IDNO:1 or the polynucleotide of its fragment at least 80% homology, and the albumen of this polynucleotide encoding has same or similar or different biological functions with the albumen shown in the SEQ ID NO:1.
Polynucleotide sequence of the present invention can be DNA or RNA, and wherein DNA comprises cDNA, genomic dna and synthetic DNA, and DNA can be two strands or single stranded form, and single stranded DNA can be coding strand or noncoding strand (antisense strand).Antisense strand of the present invention can be the complementary sequence of the sequence shown in SEQ ID NO:1.Those of ordinary skills are known, and antisense strand or its part (antisense oligonucleotide) can be used for suppressing the expression of FAM19A5 secretory protein of the present invention in the cell.The nucleotide sequence of FAM19A5 secretory protein of the present invention can comprise ox, sheep, pig, mouse, horse from any species, particularly Mammals, and is preferred human.
Polynucleotide sequence shown in SEQ ID NO:1 is that a kind of code book is invented proteic polynucleotide, and it is from the mankind.So preferred polynucleotide of the present invention comprise polynucleotide or its complementary sequence shown in SEQ ID NO:1.
Engineering carrier involved in the present invention contains the polynucleotide of the secretory protein of the present invention of encoding.Said engineering carrier can be general carrier, expression vector etc.Wherein general carrier is mainly used in the foundation in range gene group library and cDNA library; They contain two or more marker gene usually; One of them gene is used to select transformant (transformant), and another gene then is to be used for checking whether carrier has foreign DNA to insert.Expression vector is mainly used in the research expression of gene or is used for mass production some useful transcription product or protein, the foundation that also can be used for the cDNA library that has.This type carrier also should contain suitable promotor, ribosome bind site, terminator etc. except that the characteristic with coventional type carrier.Locate in cell for the ease of expression product, can add suitable leader sequence at the albumen coded sequence upper reaches.
The those of ordinary skills that are chosen as of suitable carrier and promotor know.Those of ordinary skills will be appreciated that to be used to make up contains that polynucleotide of the present invention and suitable are transcribed and the method for the carrier of translational control element.Specifically, but be applicable to that the commercially available expression vector of prokaryotic cell prokaryocyte generally all has selection marker and cellular replication initial point, have bacterium promotors such as lacI, T7, λ PL and trp, and other genetic elements of known cloning vector pBR322 (ATCC 37017).Commercially available carrier like this comprises pGEM (Promega) and pKK223-3 (Pharmacia).Can select to be derived from the suitable carrier of pBR322 according to suitable promotor of being selected for use and structural gene sequence to be expressed.The GST prokaryotic expression system also can be used for the present invention.Be applicable to that eukaryotic carrier has eukaryotic cell promotor such as CMV, SV40 etc.; Such carrier comprises pMT-hIL-3 (horse big dragon; Di Chunhui; Pang Jian etc., hi-tech communication 11:26-29 (1991)), pQE-9 (Qiagen), pD10, pNH18A (Stratagene), pKK233-3, pDR540, pRIT5 (Pharmacia), and pcDNA3, pCI, pWLNEO, pSG (Stratagene), pSVL (Pharmacia).The FAM19A5 encoding sequence inserts pCDNA3.1-myc-his6 (Invitrogen company) expression vector in embodiments of the invention 1, makes up the pCDNA3.1-FAM19A5-myc-his6 expression plasmid.
Pharmaceutical composition provided by the present invention; Can comprise engineering carrier and/or host cell that albumen of the present invention, code book are invented proteic polynucleotide, contained said polynucleotide; In addition; Except above-mentioned activeconstituents, can also comprise the acceptable salt of one or more medicines or pharmaceutically acceptable carrier or vehicle.Acceptable salt of these medicines or selecting for use of pharmaceutically acceptable carrier or vehicle depend on, for example the route of administration of medicine.
The present invention can be used in the medicine that preparation prevents and/or treats cardiovascular disordeies such as virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure through experiment showed, FAM19A5 secretory protein of the present invention.
Discover that in early days chemokine and Chemokine Receptors play an important role in mediation acute and chronic proof procedure.Recent research shows that chemokine and Chemokine Receptors are growing; Keeping of stable state; Osteoporosis; Obesity and insulin resistant; Cardiovascular disordeies such as atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure; Virus infection; Immunne response; Important effect takes place in the pathophysiological processes such as the migration of marrow chief cell and autoimmune disease.Research in recent years also shows, plays the part of important role in the process that chemokine and Chemokine Receptors take place, develop and shift in tumour.
Cardiovascular system diseases such as virus infection, anaphylactic disease, inflammation, transplant rejection, encephalopathy, autoimmune disease or metastases, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure and chemokine and acceptor thereof are closely related; The desensitization of agonist, neutralizing antibody etc. are the main treatment meanss to drug targets.The present invention is through the experiment proof; FAM19A5 secretory protein of the present invention has the chemotactic activity suitable with chemokine; And its derive from human itself, so the FAM19A5 secretory protein has broad application prospects aspect the preventing and/or treating of multiple disease.
The present invention also provides the application of FAM19A5 secretory protein of the present invention in cardiovascular disordeies such as preparation commercialization reagent research virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failures.
The present invention also provides the method for the expression level of albumen of the present invention in the sample of a kind of vitro detection from person to be measured or polynucleotide, and this method is reverse transcription-polymerase chain reaction, western blotting or ELISA, FACS, immunofluorescence, immunohistochemical methods, immunocytochemistry detection method.
Can adopt any method known in the art to detect the expression level of albumen of the present invention or polynucleotide.Preferably utilize reverse transcription-polymerase chain reaction (RT-PCR) to detect the expression level of said polynucleotide in nucleic acid level; Or utilize specific monoclonal or polyclonal antibody to detect the expression level of said polynucleotide at protein level, for example or western blotting (Western blotting) or ELISA, FACS, immunofluorescence, immunohistochemical methods, immunocytochemistry detection method.Said testing sample can obtain Tathagata autoblood, urine, saliva, gastric juice, hair, the cell of examination of living tissue and necrotomy material from various cells or the body fluid from the experimenter.PT-PCR mainly may further comprise the steps: extract total RNA, add one and mRNA3 ' end complementary primer, synthetic cDNA under the effect of ThermoScript II; And be template with cDNA, add again with another primer of cDNA complementary (two primers are positioned on the different exons, to avoid the genomic dna pollution) and carry out pcr amplification.Western blotting is mainly in three stages: the fs is that protein samples such as antigen carry out the SDS-polyacrylamide gel electrophoresis; Subordinate phase is an electrotransfer: will in gel, transfer on the nitrocellulose filter by isolating band; Phase III is a color developing detection: nitrocellulose filter (being equivalent to encapsulate antigenic solid phase carrier), successively with the effect of specific antibody and enzyme mark SA after, add the enzyme reaction substrate that can form the thing that develops the color, band is dyeed.The anti-enzymes of mark two comprise horseradish peroxidase (horseradish Peroxidase, HRP) and SEAP (alkaline phosphatease, AP).Also can use P-FAD, beta-D-galactosidase and urase etc.In an embodiment of the present invention, adopt the horseradish peroxidase two anti-enzymes that serve as a mark.Those of ordinary skills are known, to different enzymes, can use different substrates, and the substrate of HRP effect includes, but are not limited to face phenylenediamine (OPD), TMB (TMB) and ABTS.The substrate of SEAP generally adopts p-nitrophenyl SULPHOSUCCINIC ACID ESTER (p-NPP), the AP substrate (phosphatase 24-methyl umbrella ketone) that also fluoresces.Enzyme mark SA commonly used is existing commercially available.
The present invention also provide FAM19A5 secretory protein of the present invention or the application of developing compound, antibody, polypeptide drugs and commercialization reagent as target of the interacting molecule of polynucleotide or FAM19A5.
Embodiment
Make up the pcDNA3.1-FAM19A5-myc-his6 plasmid, be used to express the FAM19A5-myc-his6 fusion rotein.
One, method:
With FAM19A5 encoding sequence (SEQ ID NO:2; 3; 4) insert pcDNA3.1-myc-his6 (Invitrogen company) expression vector respectively, make up the pcDNA3.1-FAM19A5-myc-his6 expression plasmid.After the exactness of sequence verification plasmid, carry out plasmid amplification, extract plasmid, be used for cell transfecting with the big extraction reagent kit of Axygen company plasmid.
Two, result:
Correct through the dna sequencing coding region sequence.
One, method:
HEK 293T cell furnishing 6 * 10
5Cell/2ml concentration is 37 ℃ of 5%CO in 6 orifice plates
2Cultivate and carried out transfection, pcDNA3.1-FAM19A5 (BC039396.1 in 24 hours; Or NM_001082967.1; Or NM_015381.5)-myc-his6DNA 2 μ g; Vigofect (prestige lattice Lars Bioisystech Co., Ltd) 2 μ l; Mixed solution slowly splashes in the ready cell, establishes the contrast of pcDNA3.1-myc-his6 empty carrier transfectional cell simultaneously, changes serum free medium HEKG after 6 hours; Cultivated 48 hours the supernatant after the results transfection for 37 ℃.
Utilize the expression of Western Blotting inspection target protein:
Through the 12.5%SDS-PAGE electrophoresis; Changeing liquid with Tris-glycocoll electricity is transferred to albumen on the nitrocellulose filter; After adding Anti-c-myc antibody (MBL company) effect; The anti-mouse IgG (LICOR Bioscience) that adds IRDyeTM 800 marks again adopts Odyssey Imaging System detection system directly to detect.
Two, result:
Utilize the expression of Western Blot inspection target protein:
The result sees also shown in Figure 1.After adding the effect of Anti-c-myc antibody, add the anti-mouse IgG two anti-reactions of IRDyeTM 800 marks again, through Odyssey Imaging System scanning, have at the 22kd place clearly band (Fig. 1, A-C).
The separation of embodiment 3, human peripheral blood single nucleus cell
One, method:
White Blood Cells Concentrate is provided by Beijing's Blood Center, adopts lymphocyte separation medium (Shanghai smart biological High Seience Technology Co., Ltd. of China) to obtain human peripheral blood single nucleus cell.(Life Technologies Inc.) cultivates with the RPMI 1640 that contains 10% heat-inactivated foetal calf serum, 100U/ml penicillium mould, 100 μ g/ml Streptomycin sulphates.
Two, result:
Obtain human peripheral blood single nucleus cell, it is subsequent use to carry out vitro culture.
The preparation of embodiment 4, cavy neutrophilic granulocyte
One, method:
Get 1 of adult cavy, abdominal injection contains the saline water of 0.17% glycogen, after 13 hours, with PBS damping fluid flushing abdominal cavity, collects peritoneal fluid, and 1500rpm/min 10min abandons supernatant.With 37 ℃ of 3-5ml PH 7.2 warm in advance (Tris-NH
4Cl) blood cytolysate splits redly, adds serum-free RPMI1640 again, from washing twice.Neutrophilic granulocyte behind the purifying is dissolved among the serum-free RPMI 1640, cell counting, the adjustment cell concn is 5 * 10
5/ ml, subsequent use.
Two, result:
Obtain the cavy neutrophilic granulocyte, purity can reach more than 97%.
The chemotactic function of embodiment 5, FAM19A5 supernatant
One, method:
The chemotactic Function detection of FAM19A5 supernatant: the chemotactic experiment is at the chemotactic cell (Neutroprobe in 48 holes; Cabin John, MD carries out in U.S.A.).The supernatant that detects as chemotactic is added in the following hole of cell (28 μ l/ hole), and using the same substratum in Hepes RPMI 1640 dilution backs resuspended then is 1 * 10
6Individual cell/ml is added in the last hole of cell (55 μ l/ hole), and the hole is separated by with the polycarbonate leaching film of no Vinylpyrrolidone polymer up and down, and PBMC is 3 μ m with cavy neutrophil leucocyte use filter membrane aperture, and U937, Jurkat, THP-1 use filter membrane aperture are 5 μ m.Cell is put into 37 ℃ of incubators, 5%CO
2, hatch 3h.The cell that PBMC, U937, Jurkat, THP-1 drew hole under the cell when chemotactic finished uses luciferase-containing reagent Cell-Titer Glo (Promega) to measure its values of chemiluminescence reacting cells count value.Transfection pcDNA3.1 empty carrier transfection supernatant is as negative control.
When finishing, cavy neutrophil leucocyte chemotactic removes filter membrane from cell, and fixing with the staining kit washing of 3 steps, dyeing.5 high power lens visual field countings of the cell picked at random of every hole migration.Transfection pcDNA3.1 empty carrier transfection supernatant is as contrast.
Chemotactic index CI is that the migrating cell number is divided by the cellular control unit number.All experiments repeat 3 times at least.There is the significance meaning CI＞2.
Two, result:
As shown in Figure 2, the FAM19A5 culture supernatant all has chemotaxis to PBMC (A-1 to A-3), cavy neutrophil leucocyte (B), U937 (C), Jurkat (D), THP-1 (E).
One, method:
With the centrifugal back of HEK 293T cell dissociation furnishing 1.5 * 10
7It is in the 150mm plate that cell density is seeded in diameter, carries out transfection simultaneously.PcDNA3.1-FAM19A5-myc-his6DNA 12.5 μ g; PEI (prestige lattice Lars Bioisystech Co., Ltd) 50 μ g, mixed solution slowly splashes in the ready cell, establishes the contrast of pcDNA3.1-myc-his6 empty carrier transfectional cell simultaneously; Change serum free medium HEKG after 16 hours, 37 ℃ of 5%CO
2Cultivated the supernatant after the results transfection 48 hours.2000rpm/min, 10 minutes, 0.22 μ m membrane filtration.Get Ni Sepharose 6Fast Flow (GE healthcare) post material, 20 times of water by volume balances, 5mM imidazoles 200mM NaCl balance liquid balance, supernatant is washed post with the foreign protein washing lotion earlier after crossing post, again with the albumen washing lotion wash-out that contains the 1M imidazoles.Through purifying; Behind the wash-out sample through the 12.5%SDS-PAGE electrophoretic transfer to pvdf membrane; With Coomassie brilliant blue dyeing, detect the identical band in positive position with Western blot under cut out methyl alcohol/glacial acetic acid decolouring back and carry out proteinic N end order-checking (entrusting Jikang Biotechnology Co Ltd, Shanghai's order-checking).
Two, result:
Shown in Fig. 3 A-3C, the protein example behind the purifying is through the 12.5%SDS-PAGE electrophoresis, does the order-checking of N end after being transferred to pvdf membrane.FAM19A5 (BC039396.1)-myc-his has a clear band at the 22kd place; FAM19A5 (NM_001082967)-myc-his has two clear bands at the 22kd place; FAM19A5 (NM_015381.5)-myc-his has a clear band at the 22kd place.All deliver to Jikang Biotechnology Co Ltd, Shanghai and carry out the order-checking of N end.Proteinic N end sequencing result is T-C-E-I-V-T-L-D-R-D.
One, method:
Obtain PBMC among the embodiment 3 and use LPS 10ng/ml respectively, 1 μ g/ml after 5 μ g/ml stimulate 6h, 24h respectively, utilizes the Trizol reagent of Invitrogen company to extract cell total rna, utilizes reverse transcription test kit (Invitrogen) to carry out rt and PCR.With FAM19A5 isoform1 upper reaches F1 (5 ' GCC CTG CCC AGC ATG TCC TC, 3 ' (SEQ ID NO:5)), downstream R1 (5 ' GTC CAG CCT GAC CGG TTG AT, 3 ' (SEQ ID NO:6)) is a primer, and amplification 40 is taken turns.With FAM19A5 isoform2 upper reaches F1 (5 ' CGC TCT GGG CAC TGGCAG G, 3 ' (SEQ ID NO:7)), downstream R1 (5 ' CGT GGT GGT CTT TAT CCT CCCGC, 3 ' (SEQ ID NO:8)), amplification 35 is taken turns.EB dyeing was taken through UV after the PCR product carried out 1% agarose gel electrophoresis.
Two, result:
As shown in Figure 4: the 1st swimming lane is a molecular weight standard; 2nd, 3,4,5,6,7,8 swimming lanes are to use LPS 10ng/ml respectively with PBMC respectively, and it is template that 1 μ g/ml, 5 μ g/ml stimulate the rt cDNA of 6h, 24h respectively, with (A) FAM19A5 isoform1 (F1, R1); (B) FAM19A5isoform2 (F1, R1); (C) F1 of G3PDH (5 ' ACCACAGTCCATGCCATCAC 3 ' (SEQ ID NO:9)), the RT-PCR that R2 (5 ' TCCACCACCCTGTTGCTGTA 3 ' (SEQ ID NO:10)) carries out for primer.RT-PCR result shows: FAM19A5 isoform1 does not express in PBMC, and FAM19A5 isoform2 low expression in PBMC, stimulating the back to express at LPS increases, and wherein stimulates at 1 μ g/ml LPS and peaks in 24 hours.
Make up pET32a-FAM19A5-his6 fusion protein prokaryotic expression plasmid, be used to express the former nucleoprotein of FAM19A5-his6.
One, method:
FAM19A5 encoding sequence (SEQ ID NO:11) is inserted pET32a (Novagen company) expression vector, make up the pET32a-FAM19A5-his6 prokaryotic expression plasmid.After the exactness of sequence verification plasmid, carry out plasmid amplification, extract plasmid, be used for the transfection of follow-up prokaryotic expression host bacterium with the little extraction reagent kit in dimension lattice Lars.
Two, result:
Correct through the dna sequencing coding region sequence.
One, method:
After the pET32a-FAM19A5-his6 prokaryotic expression plasmid is transfected into Origami B host bacterium; Cultivate in 37 ℃ of LA substratum of 280rpm/min; When treating bacteria growing to OD 0.6, add the IPTG final concentration and be 25 μ M 250rpm/min induce for 25 ℃ spend the night after, discard substratum after centrifugal; PBS 7.4 is resuspended, the ultrasonication thalline.Gather in the crops supernatant behind the broken thalline, centrifugal 12000rpm/min, 10 minutes, 0.22 μ m membrane filtration.Get Ni Sepharose 6HP (GE healthcare) post material, 20 times of water by volume balances, 20mM imidazoles 500mM NaCl balance liquid balance, supernatant is washed post with the foreign protein washing lotion earlier after crossing post, again with the albumen washing lotion wash-out that contains the 500mM imidazoles.Through purifying, sample concentrates after ultrafiltration pipe (milipore 3000D) ultrafiltration behind the wash-out.Cross DEAE (GE healthcare) at last and remove intracellular toxin, the quantitative back of BCA is frozen to be used for follow-up functional experiment in-80 ℃.
Two, result:
As shown in Figure 5, the protein example behind the purifying is through the 12.5%SDS-PAGE electrophoresis, directly coomassie brilliant blue staining.Use the FAM19A5-his6 of arrow indication to be the target protein band among the figure.
The BCA quantitative result shows that the FAM19A5-his6 concentration behind the purifying is 500 μ g/ml.
One, method:
The separation of human peripheral blood single nucleus cell (PBMC) and cultivation are with embodiment 3, and after cell attachment spent the night, human peripheral lymphocyte (PBL) was able to separate with monocyte (Monocyte), PBL suspension growth, the centrifugal continued chemotactic experiment of sucking-off substratum; Add fresh culture, the adherent mononuclear cells growth scrapes centrifugal continued chemotactic experiment with cell.
The chemotactic experiment is at the chemotactic cell (Neutroprobe in 48 holes; Cabin John, MD carries out in U.S.A.).The albumen that detects as chemotactic adds or does not add 0.1%BSA through Hepes RPMI 1640 and is diluted in the following hole that 1ng/ml, 10ng/ml, 100ng/ml, 1000ng/ml, 10000ng/ml be added to cell (27 μ l/ hole), and using Hepes RPMI 1640 to add then or not adding the same substratum in 0.1%BSA dilution back resuspended is 4 * 10
6Individual cell/ml is added in the last hole of cell (55 μ l/ hole), and in check board experiment, cell joins in the last hole of chemotactic cell after hatching with the former nucleoprotein 500ng/ml of FAM19A5 in advance again.The hole is separated by with the polycarbonate leaching film of no Vinylpyrrolidone polymer up and down, and it is 3 μ m that PBL and monocyte use the filter membrane aperture, and it is 5 μ m that the THP-1 cell uses the filter membrane aperture.Cell is put into 37 ℃ of incubators, 5%CO
2, hatch 3h.When finishing, chemotactic removes filter membrane from cell, and fixing with the staining kit washing of 3 steps, dyeing.5 high power lens visual field countings of the cell picked at random of every hole migration.Hepes RPMI 1640 adds or does not add 0.1%BSA as contrast.
Chemotactic index CI is that the migrating cell number is divided by the cellular control unit number.All experiments repeat 3 times at least.There is the significance meaning CI＞2.
Two, result:
Shown in Fig. 6 A and 6B, wherein A shows that former nucleoprotein of FAM19A5 and eukaryotic protein have chemotaxis to PBMC.B shows that former nucleoprotein of FAM19A5 and PBMC preincubate rear enclosed fall the chemotaxis of the former nucleoprotein of FAM19A5 to PBMC, explain that the former nucleoprotein of FAM19A5 is special for the chemotaxis of PBMC.C and D are respectively the former nucleoprotein of FAM19A5 PBL and monocyte are had chemotaxis.E shows that the former nucleoprotein of FAM19A5 has chemotaxis and the most obvious in the 100ng/ml effect to THP-1.
One, method:
Human each tissue cDNA library is available from Clontech company.With FAM19A5isoform1 upper reaches F1 (5 ' GCC CTG CCC AGC ATG TCC TC, 3 ' (SEQ ID NO:5)), downstream R1 (5 ' GTC CAG CCT GAC CGG TTG AT, 3 ' (SEQ ID NO:6)) is a primer, and amplification 40 is taken turns.With FAM19A5isoform2 upper reaches F1 (5 ' CGC TCT GGG CAC TGGCAG G, 3 ' (SEQ ID NO:7)), downstream R1 (5 ' CGT GGT GGT CTT TAT CCT CCCGC, 3 ' (SEQ ID NO:8)), amplification 40 is taken turns.EB dyeing was taken through UV after the PCR product carried out 1% agarose gel electrophoresis.
Two, result:
As shown in Figure 7: the 1st swimming lane is a molecular weight standard; 2nd, 3,4,5,6,7,8,9,10,11,12,13,14,15,16,17 swimming lanes are respectively people's the heart, brain, placenta, lung, liver, Skelettmuskel, kidney, pancreas, spleen, thymus gland, prostate gland, testis, ovary, small intestine, colon, the cDNA library of peripheral blood lymphocyte; Be respectively with (A) FAM19A5isoform1 (F1, R1); (B) FAM19A5 isoform2 (F1, R1); (C) F1 of G3PDH (5 ' ACCACAGTCCATGCCATCAC 3 ' (SEQ ID NO: 9)), the RT-PCR that R2 (5 ' TCCACCACCCTGTTGCTGTA 3 ' (SEQ ID NO:10)) carries out for primer.
The result shows: FAM19A5isoform1 expresses in brain, lung, liver, Skelettmuskel, kidney, thymus gland, testis, ovary, small intestine, colon, and surplus organizing do not seen expression; FAM19A5isoform2 expresses in brain, kidney, pancreas, testis, ovary, small intestine, colon, and surplus organizing do not seen expression.
One, method:
With containing 10%FBS, the MEM substratum of 1mg/ml Sigma I8405 (sigma company) is at 5%CO with the MCF7 cell
2, to cultivate 48 hours in 37 ℃ the incubator, digestion MCF7 cell is with cell furnishing 2 * 10
5The shop is gone in 24 orifice plates, is placed with the cell climbing sheet that diameter is 12mm (Fisher Coverglass) in the hole in advance.Let cell at the fixed cell (room temperature 15 minutes, 1% Paraformaldehyde 96) after 48 hours of growth on the creep plate, and infiltrationization (10 minutes, 0.1%NP-40), seal (5% lowlenthal serum).All solution prepare with PBS.Use FAM19A5 monoclonal antibody (R&D company), rat IgG (sigma company) successively, the mouse IgG of FITC labelled goat Chinese People's Anti-Japanese Military and Political College dyeing.Examine with the Hochest33342 transfect cell at last.Laser confocal microscope is observed.
In another experiment, let cell at the fixed cell (room temperature 15 minutes, 1% Paraformaldehyde 96) after 48 hours of growth on the creep plate, infiltrationization (10 minutes, 0.1%NP-40), 3% superoxol removal endogenous katalase.Sealing (5% lowlenthal serum).All solution prepare with PBS.Use FAM19A5 monoclonal antibody (R&D company), rat IgG (sigma company) successively, the mouse IgG of HRP labelled goat Chinese People's Anti-Japanese Military and Political College dyeing.The colour developing of DAKO colouring reagents box.Neutral gum mounting behind the haematoxylin redyeing nucleus.Microscopically is observed and is taken pictures.
Two, result:
Shown in Fig. 8 A and 8B: A, B are the painted result of cellular immunofluorescence.C, D are the result of cellular immunization chemical staining.A shows that homotype control rats IgG detects endogenous FAM19A5 location; The FAM19A5 monoclonal antibody that shows B detects the location of endogenous FAM19A5 at the MCF7 cell; C is shown as homotype control rats IgG and detects the location of endogenous FAM19A5 at the MCF7 cell; The FAM19A5 monoclonal antibody that shows D detects the location of endogenous FAM19A5 at the MCF7 cell.
The result shows: FAM19A5 all has expression in cytolemma, tenuigenin, the nucleus in the MCF7 cell.It is higher in cytolemma and nucleus, to express abundance.
The immunohistochemical staining that embodiment 13, FAM19A5 express at the aorta of rat aorta balloon injury model
One, method:
Sprague-Dawley rat body weight 250 ± 50g, male, animal is according to the time random packet of drawing materials, row right carotid balloon dilatation.Behind Chloral Hydrate (300mg/kg) intraperitoneal injection of anesthesia, be fixed on the animal specific anchor; Make a median incision in the throat, 1.5cm sacculus (Maverick, Boston Scientific Corporation), passivity is separated LCC, slowly inserts foley's tube, and depth of penetration is 4cm.In sacculus, inject heparin-saline and make its expansion, repeat 3 times and cause inner membrance to damage fully, withdraw from conduit, the ligation artery.Control group carries out same operation, but does not carry out the balloon injured operation.
Laboratory animal was put to death in 7 days after surgery, got injured group and the arteries that does not damage control group, 4% formaldehyde fixed, and after gradient alcohol dewatered step by step, embedding, 3um section were used for the experiment of follow-up immunization histological chemistry.
Cell immunohistochemical staining method is following: the descending aquation of gradient alcohol, and high-pressure process is carried out antigen retrieval, and 3% superoxol is removed the endogenous katalase, sealing (5% lowlenthal serum).Use FAM19A5 monoclonal antibody (R&D company), rat IgG (sigma company) successively, the mouse IgG of HRP labelled goat Chinese People's Anti-Japanese Military and Political College dyeing.The colour developing of DAKO colouring reagents box.Neutral gum mounting behind the haematoxylin redyeing nucleus.Microscopically is observed and is taken pictures.
Two, result:
Fig. 9 A and 9B are the result of FAM19A5 at the immunohistochemical staining of the aorta expression of rat aorta balloon injury model.A, B, C, D are respectively that 4 different rats are individual.Caption 200 * and 400 * be respectively the opticmicroscope magnification ,+expression balloon injured group rat ,-expression does not damage control rats.
The result shows: FAM19A5 is in the expression that is positive of the aorta vessel smooth muscle cell of balloon injured group rat, and in the aorta vessel smooth muscle cell that the does not damage control rats expression that is negative.Such differential expression explanation FAM19A5 is relevant with VSMC activation and hyperplasia.
The immunohistochemical staining that embodiment 14, FAM19A5 express at the atherosis patient's atherosclerotic plaque of human artery
One, method:
Collection of specimens: get atherosclerotic plaque during the human artery is atherosis patient's peripheral arterial Intimectomy.4% formaldehyde fixed, after gradient alcohol dewatered step by step, embedding, 3 μ m section were used for the experiment of follow-up immunization histological chemistry.
Cell immunohistochemical staining method is with embodiment 13.
Two, result:
Figure 10 is the result of FAM19A5 at the immunohistochemical staining of the atherosis patient's atherosclerotic plaque expression of human artery.A, B are respectively 2 different cases.Caption 200 * and 400 * being respectively the opticmicroscope magnification, Rat IgG is the homotype contrast of antibody, Rat anti 19A5 representes to detect the positive signal of FAM19A5 in tissue with the FAM19A5 monoclonal antibody.
The result shows: FAM19A5 is in the expression that is positive of the atherosis patient's atherosclerotic plaque of human artery tissue, and antibody morphism contrasts Rat IgG and do not have positive signal.Explain that FAM19A5 is relevant with cardiovascular disordeies such as atherosclerosiss, possibly participate in the generation and the development of this type of disease.The immunohistochemical staining that embodiment 15, FAM19A5 express at fatty tissue
One, method:
Collection of specimens: get normal mouse C57BL/6J lung tissue, the tumor specimen that breast tumor and ovarian tumor are gathered respectively when patient's row surgical blanking.4% formaldehyde fixed, after gradient alcohol dewatered step by step, embedding, 3 μ m section were used for the experiment of follow-up immunization histological chemistry.
Many organs of people healthy tissues combined chip is numbered FDA999 available from Shaanxi Chaoying Biotechnology Co., Ltd..
Cell immunohistochemical staining method is with embodiment 13.
Two, result:
Figure 11 A to 11D is the result of FAM19A5 at the immunohistochemical staining of fatty tissue expression.A is the immunochemistry coloration result of mouse lung tissue expression.B is the result of the immunohistochemical staining of breast tumor expression.C is the result of the immunohistochemical staining of ovarian tumor expression.D is the result of the immunohistochemical staining of normal parathyroid gland expression.Caption 100 *, 200 *, 400 * be respectively the opticmicroscope magnification.
The result shows: FAM19A5 is at the mouse lung fatty tissue, HBT's fatty tissue, and people's ovarian tumor fatty tissue presents positive expression in the normal parathyroid gland fatty tissue of people.Explaining that FAM19A5 maybe be relevant with metabolism of fat, possibly be a new fatty factor.
This paper describes the present invention through some concrete embodiments, and is described for purpose of description also is directed against many details.To those skilled in the art, the present invention can comprise some other embodiment, also can under the situation that does not depart from purport of the present invention, be directed against the summary of the invention that is disclosed and carry out suitable adjustment and variation.
Claims (11)
1. albumen, it comprises:
(1) has the albumen of aminoacid sequence shown in the SEQ ID NO:1; Or
(2) aminoacid sequence that has (1) said albumen at least 80% homology, its function and the same or similar or different biological function of (1) said proteic function.
2. albumen as claimed in claim 1, it is:
(1) has the albumen of aminoacid sequence shown in the SEQ ID NO:1; Or
(2) aminoacid sequence that has (1) said albumen at least 90% homology, its function and the same or similar or different biological function of (1) said proteic function.
3. polynucleotide, it comprises:
(1) polynucleotide of aminoacid sequence shown in the coding SEQ ID NO:1; Or
(2) have polynucleotide sequence with (1) said polynucleotide at least 80% homology, its encoded protein has the similar or different biological function of identical functions with the albumen of (1) said polynucleotide encoding.
4. polynucleotide as claimed in claim 3, it comprises and has the sequence shown in the SEQ ID NO:1 or its complementary sequence.
5. engineering carrier, it contains claim 3 or 4 described polynucleotide.
6. pharmaceutical composition; The engineering carrier that it contains the polynucleotide of claim 1 or 2 described albumen, encoding said proteins and/or contains said polynucleotide, and the acceptable salt of one or more medicines or pharmaceutically acceptable carrier or vehicle.
7. the polynucleotide of use albumen or encoding said proteins according to claim 1 or claim 2 prevent and/or treat the application in the medicine of cardiovascular disordeies such as virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure in preparation.
8. a vitro detection is from the method for the polynucleotide expression level of claim 1 in the person's to be measured sample or 2 described albumen or encoding said proteins.
9. method as claimed in claim 8, said method are reverse transcription-polymerase chain reaction or western blotting, ELISA, FACS, immunofluorescence, immunohistochemical methods, immunocytochemistry detection method.
10. the polynucleotide of albumen or an encoding said proteins according to claim 1 or claim 2 are in the application of cardiovascular disordeies such as preparation commercialization reagent research virus infection, anaphylactic disease, inflammatory reaction, transplant rejection, encephalopathy, autoimmune disease, metastases, immunomodulatory, stem cells hyperplasia differentiation, osteoporosis, obesity and insulin resistant, atherosclerosis, angiosteosis, Myocardial Ischemia Reperfusion Injury, hypertension, heart failure.
11. albumen or encoding said proteins and interacting molecule thereof according to claim 1 or claim 2 developed compound, antibody, polypeptide drugs and commercialization reagent as target application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110418686.2A CN102775490B (en) | 2011-05-12 | 2011-12-14 | Secretory protein with migration activity and application thereof |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101222138 | 2011-05-12 | ||
| CN201110122213.8 | 2011-05-12 | ||
| CN201110122213 | 2011-05-12 | ||
| CN201110418686.2A CN102775490B (en) | 2011-05-12 | 2011-12-14 | Secretory protein with migration activity and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102775490A true CN102775490A (en) | 2012-11-14 |
| CN102775490B CN102775490B (en) | 2017-04-12 |
Family
ID=47120619
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110418686.2A Active CN102775490B (en) | 2011-05-12 | 2011-12-14 | Secretory protein with migration activity and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102775490B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104254343A (en) * | 2012-02-15 | 2014-12-31 | 高丽大学校产学协力团 | Pharmaceutical use of fam19a5 involved in regulating gliogenesis |
| CN106749661A (en) * | 2015-11-13 | 2017-05-31 | 北京大学 | Monoclonal antibody of anti-PSMP and application thereof |
| KR101802411B1 (en) * | 2015-02-17 | 2017-11-29 | 울산대학교 산학협력단 | Composition for preventing or treating of obesity comprising FAM19A5 and screening method for agent for treatment of obesity using the same |
| CN110386973A (en) * | 2018-04-18 | 2019-10-29 | 北京大学 | Polypeptide and its medical usage with multiple functions |
| CN111315774A (en) * | 2017-06-27 | 2020-06-19 | 纽洛可科学有限公司 | anti-FAM 19a5 antibodies and uses thereof |
| CN112119091A (en) * | 2018-05-10 | 2020-12-22 | 纽洛可科学有限公司 | Antibodies against sequence similarity family 19 member a5 and methods of use thereof |
| CN112424223A (en) * | 2018-04-24 | 2021-02-26 | 纽洛可科学有限公司 | Use of an antibody against member a5 of sequence similarity family 19 for the treatment of neuropathic pain |
| CN113227139A (en) * | 2018-12-27 | 2021-08-06 | 纽洛可科学有限公司 | Use of anti-FAM 19a5 antibodies for treating atherosclerosis |
| CN113491764B (en) * | 2020-04-03 | 2023-09-19 | 北京大学 | Medical application of FAM19A5 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006119775A2 (en) * | 2005-05-11 | 2006-11-16 | Aarhus Universitet | Method for diagnosis and treatment, of a mental disease |
-
2011
- 2011-12-14 CN CN201110418686.2A patent/CN102775490B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006119775A2 (en) * | 2005-05-11 | 2006-11-16 | Aarhus Universitet | Method for diagnosis and treatment, of a mental disease |
Non-Patent Citations (3)
| Title |
|---|
| GENPEPT: "ACCESSION：NP_001076436", 《GENPEPT》 * |
| GENPEPT: "ACCESSION：NP_056196", 《GENPEPT》 * |
| TANG Y.等: "TAFA: a novel secreted family with conserved cysteine residues and restricted expression in the brain", 《GENOMICS》 * |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11739141B2 (en) | 2012-02-15 | 2023-08-29 | Neuracle Science Co., Ltd. | Pharmaceutical use of FAM19A5 involved in regulating gliogenesis |
| US10640557B2 (en) | 2012-02-15 | 2020-05-05 | Neuracle Sceince, Inc. | Pharmaceutical use of FAM19A5 involved in regulating gliogenesis |
| CN104254343A (en) * | 2012-02-15 | 2014-12-31 | 高丽大学校产学协力团 | Pharmaceutical use of fam19a5 involved in regulating gliogenesis |
| KR101802411B1 (en) * | 2015-02-17 | 2017-11-29 | 울산대학교 산학협력단 | Composition for preventing or treating of obesity comprising FAM19A5 and screening method for agent for treatment of obesity using the same |
| CN106749661A (en) * | 2015-11-13 | 2017-05-31 | 北京大学 | Monoclonal antibody of anti-PSMP and application thereof |
| CN111315774A (en) * | 2017-06-27 | 2020-06-19 | 纽洛可科学有限公司 | anti-FAM 19a5 antibodies and uses thereof |
| CN111315774B (en) * | 2017-06-27 | 2023-12-22 | 纽洛可科学有限公司 | anti-FAM 19A5 antibodies and uses thereof |
| CN110386973A (en) * | 2018-04-18 | 2019-10-29 | 北京大学 | Polypeptide and its medical usage with multiple functions |
| CN110386973B (en) * | 2018-04-18 | 2022-09-27 | 北京大学 | Multifunctional protein polypeptide and medical application thereof |
| CN112424223A (en) * | 2018-04-24 | 2021-02-26 | 纽洛可科学有限公司 | Use of an antibody against member a5 of sequence similarity family 19 for the treatment of neuropathic pain |
| JP2021514363A (en) * | 2018-04-24 | 2021-06-10 | ニューラクル サイエンス カンパニー リミテッド | Sequence similarity 19, anti-family use with member A5 antibody for the treatment of neuropathic pain |
| JP7171081B2 (en) | 2018-04-24 | 2022-11-15 | ニューラクル サイエンス カンパニー リミテッド | Use of anti-family with sequence similarity 19, member A5 antibodies for the treatment of neuropathic pain |
| CN112119091A (en) * | 2018-05-10 | 2020-12-22 | 纽洛可科学有限公司 | Antibodies against sequence similarity family 19 member a5 and methods of use thereof |
| CN113227139A (en) * | 2018-12-27 | 2021-08-06 | 纽洛可科学有限公司 | Use of anti-FAM 19a5 antibodies for treating atherosclerosis |
| CN113491764B (en) * | 2020-04-03 | 2023-09-19 | 北京大学 | Medical application of FAM19A5 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102775490B (en) | 2017-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102775490A (en) | Secretory protein with migration activity and application thereof | |
| ES2831329T3 (en) | Peptide that has antidiabetic and antiobesity effects, and its use | |
| Salamon et al. | Human MYO18B, a novel unconventional myosin heavy chain expressed in striated muscles moves into the myonuclei upon differentiation | |
| JPH03502453A (en) | Proteins that induce activation and chemoattraction of immune effector cells | |
| JPH07507446A (en) | DNA encoding taurine and GABA transporter and its use | |
| JP2017513941A (en) | Peptide having fibrosis inhibitory activity and composition containing the same | |
| EP1809660A2 (en) | A thymus-specific protein | |
| CN108484747A (en) | Japan frog skin repair peptide cathelicidin-NV and its gene and application | |
| ES2901416T3 (en) | Peptide exhibiting anti-obesity and anti-diabetes efficacy and use thereof | |
| WO2018082590A1 (en) | Tumor immunotherapy target and application thereof | |
| CN103626865B (en) | Secreted protein with chemotactic activity, as well as coding sequence and medicament usage thereof | |
| CN111793134A (en) | Medicine, tumor vaccine and inhibitor for cancer treatment | |
| ES2659877T3 (en) | A gene encoding a multifarm-resistant human p glycoprotein homolog on chromosome 7p15-21 and uses thereof | |
| Chicheportiche et al. | Cloning and expression of a mouse macrophage cDNA coding for a membrane glycoprotein of the scavenger receptor cysteine-rich domain family. | |
| JPH07501441A (en) | Lymph antigen CD30 | |
| KR101064914B1 (en) | Pharmaceutical composition for treating autoimmune, allergic and inflammatory diseases and delivery method thereof | |
| CN103204921A (en) | Secretory protein with chemotactic activity, and coding sequence and application thereof | |
| KR101947902B1 (en) | Recombinant protein for treatment or prevention and compositon for treatment or prevention containing thereof | |
| CN102807613A (en) | Secreted protein with chemotactic activity and medicament usage thereof | |
| EP1464704B1 (en) | Mouse adhesion molecule occludin | |
| CN101481412B (en) | Polypeptide with antineoplastic function, encoding gene and use thereof | |
| US8236758B2 (en) | Method of treatment of diabestes or reduction in pancreatic beta-cells | |
| CN100497625C (en) | Cancer gene and its medical use | |
| CN104356216A (en) | SibaDef of blood sucking insect, as well as gene and application thereof | |
| CN101015683B (en) | Application of human RTN4B protein in preparation of medicine for healing wound |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |