CN102758003A - PCR (Polymerase Chain Reaction) primer composite for quantifying transcriptional level of mice xanthine oxidase and PCR method thereof - Google Patents
PCR (Polymerase Chain Reaction) primer composite for quantifying transcriptional level of mice xanthine oxidase and PCR method thereof Download PDFInfo
- Publication number
- CN102758003A CN102758003A CN2012100060997A CN201210006099A CN102758003A CN 102758003 A CN102758003 A CN 102758003A CN 2012100060997 A CN2012100060997 A CN 2012100060997A CN 201210006099 A CN201210006099 A CN 201210006099A CN 102758003 A CN102758003 A CN 102758003A
- Authority
- CN
- China
- Prior art keywords
- pcr
- transcriptional level
- xod
- mouse
- mice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a PCR (Polymerase Chain Reaction) primer composite for quantifying the transcriptional level of mice xanthine oxidase and a PCR method thereof. The nucleotide sequence of the PCR primer composite is 5'-TATGGCCCCGAGGTAAAAAC-3' in a forward direction and 5'-GGGCGGCCTGTCTTGTATGC-3'' in a reverse direction. The PCR primer composite can be obtained by carrying out a DNA synthesis technology by utilizing a chemical synthesis method well known by technical personnel in the field, and a primer sequence is on the basis of sufficiently analyzing the gene sequence of the mice xanthine oxidase so as to have no amplification signal on a non-target gene in a material. In the invention, the transcriptional level of the mice xanthine oxidase is quantified by using the PCR primer composite, and a method is simple and accurate; and the PCR primer composite is high in specificity, can not be interfered by other genes, thereby providing an effective tool for researching the functions of the mice xanthine oxidase and the influence of other factors on the mice xanthine oxidase.
Description
Technical field
The present invention relates to a kind of living mouse XOD transcriptional level and quantitatively use the PCR combination of primers, also relate to a kind of real time fluorescence quantifying PCR method that uses this primer simultaneously, belong to Measurement for Biotechnique.
Background technology
XOD (XO) is a kind of important enzyme in the nucleic acid in vivo metabolism, and this enzyme is distributed widely in the histocyte serous coats such as people body-centered, lung, liver, mucous membrane of small intestine, and the XO in the serum mainly comes from liver cell.XOD is that a species specificity is not high, can the catalysis xanthoglobulin generates xanthine, and then generates uric acid, again the direct enzyme of catalysis xanthine generation uric acid.The substrate obligate is wider, is outside the electron donor divided by purine derivative, and all right pteridine derivatives, aldehyde (generation carboxylic acid) are electron donor, generates oxy-compound on the surface, and Sauerstoffatom derives from water.Electron acceptor(EA) is a lot, and molecular oxygen, nitrate salt, benzoquinones, nitro-compound, NAD, ferredoxin etc. are arranged, but different according to the source of enzyme.When reaction, generate superoxide, cause chain reaction.
In the past to the research of XOD mainly concentrate on this enzyme sequence, structure, function, active with and inhibition on; It is 02827205.6 patent of invention that the Chinese patent communique discloses a kind of application number; Announced a kind of xanthine oxidase inhibitor, and the effective instrument of shortage is gone up in research for the XOD transcriptional level.
The gene amplification method of real-time fluorescence quantitative PCR has been widely used in the quantitative of gene transcription level.Real-time fluorescence quantitative PCR can carry out the dna profiling of denier accurately quantitatively, and because of its precision is high, the time is short and used widely.Also do not see research at present both at home and abroad to XOD transcriptional level quantivative approach.
In order to study the transcriptional level of XOD in the mouse body, need set up a kind of can be accurately to XOD mRNA quantitative methods, and then lay the first stone for research XOD function and influence factor thereof.
Summary of the invention
The object of the present invention is to provide a kind of mouse XOD transcriptional level quantitatively to use the PCR combination of primers, on transcriptional level, XOD is carried out quantitatively.
Simultaneously, the present invention also aims to provide a kind of real time fluorescence quantifying PCR method that uses this PCR combination of primers.
To achieve these goals, technical scheme of the present invention has adopted a kind of mouse XOD transcriptional level quantitatively to use the PCR combination of primers, and this nucleotides sequence is classified as:
Forward: 5 '-TATGGCCCCGAGGTAAAAAC-3 '
Oppositely: 5 '-GGGCGGCCTGTCTTGTATGC-3 ".
Technical scheme of the present invention has also adopted the quantitative real-time fluorescence quantitative PCR method of a kind of mouse XOD transcriptional level; The cDNA that becomes with the total RNA reverse transcription of sample is a template; Utilize the PCR combination of primers to carry out the real-time fluorescence quantitative PCR amplification, according to the quantitative XOD transcriptional level of the changing conditions of fluorescence in the reaction system.
Described extension increasing sequence is:
tatggccccgaggtaaaaatcgagaaaggagatctcaagaaaggcttttctgaagctgacaatgttgtctcaggaga
attatatattggtggccaggagcacttctatctggagacccactgcaccattgccgtgccgaaaggcgaggcaggcg
agatggagctcttcgtgagcacacagaacaccatgaaaacccagagctttattgcaaagatgttgggtgttccagac
aacagaattgtagtccgagtgaaaagaatgggtggaggctttggagggaaggagacccggagcactctgatatccac
agcagtggccttggctgcatacaagacaggccgccc
Described pcr amplification system is: 25 μ L systems, 2 * SYBRMix, 12.5 μ L; 10 μ mol/L forwards, each 0.5 μ L of reverse primer; CDNA template 2 μ L, 9.35 μ L deionized waters, TaqDNAPolymerase 0.15 μ L; Three-step approach increases to sample, on quantitative real time PCR Instrument, obtains the CT value.
Described three-step approach is: 95 ℃ of 3min, 95 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 31sec, 40 circulations.
The present invention uses real time fluorescence quantifying PCR method XOD transcriptional level quantivative approach is studied; Through XOD sequences Design special primer, thus set up fast, efficiently, the quantitative method of XOD transcriptional level accurately.Through analyzing mouse XOD gene order, the design special primer can be quantitative to the XOD transcriptional level fast, accurately.Primer of the present invention can well known to a person skilled in the art that the DNA synthetic technology that chemical synthesis process carries out obtains through utilization; Primer sequence is fully to analyze on the basis of XOD gene order, therefore non-goal gene in the material is not being had amplified signal.The primer of the application of the invention is implemented quantitatively the XOD transcriptional level of mouse, and method is simple, accurately.And, divide the primer specificity of invention strong, can not receive the interference of other genes, to its influence effective tool is provided for studying mouse XOD function and other factors.
Real-time fluorescence quantitative PCR 25 μ L systems (2 * SYBRMix, 12.5 μ L, 10 μ mol/L forwards, each 0.5 μ L of reverse primer, cDNA template 2 μ L; 9.35 μ L deionized water, TaqDNAPolymerase 0.15 μ L), three-step approach (95 ℃ of 3min; 95 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 31sec; 40 circulations) sample is increased, on quantitative real time PCR Instrument, obtain the CT value.Amplification can through with house-keeping gene (like the glyceraldehyde 3-phosphate dehydro-genase gene etc.) relatively, thereby confirm the transcriptional level of aldehyde oxidase.Calculation formula is following:
Aldehyde oxidase gene transcription level=2
-Δ CT
ΔCT＝(CT.Target-CT.Actin)
Time?x-(CT.Target-CT.Actin)
Time?0.
Annotate: CT.Target is an XOD gene C T value
CT.Actin is house-keeping gene CT value
Time 0 is the initial time point data
Time x is later stage time point data
Use primer of the present invention and method to carry out the quantitative sample of XOD transcriptional level and be mainly liver, but its hetero-organization also can use.
Description of drawings
Fig. 1 is the segmental solubility curve of XO purpose;
Fig. 2 is an XO purpose fragment PCR amplification.
Fig. 1, Fig. 2 are the quantitative fluorescent PCR specific detection; Every curve is represented the liver sample of different mouse among Fig. 1, and 2-9 among Fig. 2 represents the liver samples of different mouse respectively.
Embodiment
The mouse XOD transcriptional level of present embodiment is quantitatively used the PCR combination of primers, and this nucleotides sequence is classified as:
Forward: 5 '-TATGGCCCCGAGGTAAAAAC-3 '
Oppositely: 5 '-GGGCGGCCTGTCTTGTATGC-3 ".
Be that mouse XOD transcriptional level quantitatively is used to measure the influence of molybdenum to mouse XOD transcriptional level with the specific embodiment of PCR combination of primers and PCR method below
1 laboratory animal
1.1.1 the selection of laboratory animal
60 of the cleaning level ICR small white mouses at two monthly ages.
1.1.2 the grouping of laboratory animal
20 of 40 of healthy female small white mouses and male white mouses adapted to after 5 days, were divided into 4 groups at random; Every group 10 female and 5 male white mouses, male and female are separately raised, free choice feeding; Basal diet is identical; The molybdenum (with the Na2MoO42H2O form) that adds various dose in the drinking-water is respectively blank group, low molybdenum group (100mgL-1), middle molybdenum group (200mgL-1), high molybdenum group (400mgL-1), and male and female mate raising after 4 weeks.Farrowing back 30 and 15 male white mouses of female at random small white mouse from every group of newborn mouse give the molybdenum of various dose by former grouping, and after 8 weeks, 10 and 5 male white mouses of the female small white mouse of picked at random mate raising from every group again.Treat its farrowing.So back and forth, make four generations of MOUSE REPRODUCTION.Get two monthly age of the three or four generation each 5 of mouse for every group, eyeball blood sampling is got liver organization and is placed sample protective material (Sample protector, TAKARA company) to be used for the detection of XOD transcriptional level after putting to death.
1.2 experimental technique
1.2.1 the collection of mouse liver
After the eyeball of mouse blood sampling is put to death, cut off the abdominal cavity, separate and win liver organization placing sample protective material (Sample protector, TAKARA company) to be used for the detection of XOD transcriptional level.
1.2.2 the amplification of goal gene, clone, evaluation and order-checking
1.2.2.2 the extraction of total RNA, with reference to specification sheets, step is following:
Homogenate: get the fresh mouse liver tissue of about 50～100mg, handled the mortar homogenate of liquid nitrogen precooling with DEPC after, be transferred in the EP pipe of 1.5mL, add 1mLTRIPURE reagent, jolting a moment.
The separation of RNA: hatch homogenate sample 5min, make the abundant cracking of nucleic acid dissociate out, every milliliter of TRIPURE reagent adds the 0.2mL chloroform; Capped; Rock EP pipe 15sec at full tilt with hand, 15～30 ℃ of held 2～3min, the centrifugal 15min of 1200g (2 ℃～8 ℃) layering: lower floor is a phenol-chloroform; The upper strata is a water, and RNA is present in aqueous phase.The water volume should be 60% of TV.
The deposition of RNA: draw in the EP pipe of the new 1.5mL of upper strata water to, stay organic phase.Use isopropanol precipitating RNA, with the ratio that begins most to add the TRIPURE amount be 2: 1, place 10min, the centrifugal 10min of 1200g (2 ℃～8 ℃) for 15～30 ℃.
RNA is invisible to the naked eye before centrifugal, can on the pipe end or sidewall, form the drop of similar gels after centrifugal.
The RNA rinsing: remove supernatant, with 75% ethanol rinsing RNA deposition, with the ratio that begins most to add the TRIPURE amount be 1: 1.Concussion mixing sample, 2 ℃～8 ℃ centrifugal 5min of 7500g.
Dry RNA: dry air or vacuum-drying 5～10min.
Heavily dissolve RNA: RNA is dissolved in 20 μ l not to be had in the DEPC water of RNA enzyme, blow and beat severally to place 55～60 ℃ of 10min down, and it is dissolved as far as possible, and it is for use to store in-70 ℃ of refrigerators.
1.2.2.3 agarose gel electrophoresis takes by weighing an amount of agarose, is made into 1.25% left and right sides concentration with aseptic TAE damping fluid, after the microwave oven heating and melting, cools off and solidifies, electrophoresis in the glue groove of handling with the TAE damping fluid.Voltage is about 100V, after the point sample hole adds 5 μ LRNA samples, carries out electrophoresis.When tetrabromophenol sulfonphthalein go to gel length 2/3 the time stop electrophoresis, gel is moved to observes its integrity on the uv lamp and take pictures.
Measure the concentration of RNA with the nucleic acid concentration determinator of pharmacia biotech company, extract the quality of RNA according to a preliminary estimate, required addition when confirming reverse transcription.
1.2.2.4cDNA the synthetic test kit description operation of pressing.In the 200 μ LPCR of the no Rnase that handled with DEPC pipe, carry out the synthetic of goal gene cDNA.
1.2.2.5 the goal gene primer design is according to the gene order of XO that includes among the GenBank and glyceraldehyde 3-phosphate dehydro-genase gene (GAPDH).Utilize primer-design software Primer Express2.0 to carry out design of primers respectively.Wherein the GAPDH fragment is as internal reference.The goal gene primer design is following: (table 1)
Table 1 PCR primer
1.2.3 confirming of goal gene quantitative fluorescent PCR reaction system
Behind RNA extraction test kit extraction RNA, measure the concentration of the cDNA of total RNA and rt, goal gene is carried out confirming of best PCR reaction conditions.
Adopt SYBR Green I dye method, on the ABI7000 quantitative real time PCR Instrument, increase and data analysis.According to the reaction system that SYBR Green I Real Time PCR Kit recommends, be adjusted into 25 μ L systems (2 * SYBR Mix, 12.5 μ L, each 0.5 μ L of 10 μ mol/L upstream and downstream primers; Template 2 μ L, 9.35 μ L deionized waters, TaqDNAPolymerase 0.15 μ L); Three-step approach (95 ℃ of 3min, 95 ℃ of 30sec, 60 ℃ of 30sec; 72 ℃ of 31sec, 40 circulations) sample is increased.
2.2.4 relative expression's variance analysis of gene
Relative expression's difference of 2-Δ CT methods analyst gene is adopted in this experiment.Calculation formula is following:
amount?of?target＝2-ΔCT
ΔCT＝(CT.Target-CT.Actin)Time?x-(CT.Target-CT.Actin)Time?0.
2 results
2.1 the solubility curve of mouse XO gene by fluorescence quantitative PCR reaction
By Fig. 1,2 visible, the rarely seen independent peak of solubility curve of quantitative fluorescent PCR reaction in the amplification procedure of XO gene, the rarely seen specific band of electrophoretic result after reaction finishes.The purpose fragments specific that shows amplification is good.
2.2 molybdenum is to the influence of mouse liver XOmRNA level
Method through real-time fluorescence quantitative PCR can know that the XO transcriptional level of experimental group generally is higher than control group.The result sees table 2
Table 2 molybdenum is to the influence of mouse liver XOmRNA level
Claims (5)
1. a mouse XOD transcriptional level is quantitatively used the PCR combination of primers, and it is characterized in that: this nucleotides sequence is classified as:
Forward: 5 '-TATGGCCCCGAGGTAAAAAC-3 '
Oppositely: 5 '-GGGCGGCCTGTCTTGTATGC-3 ".
2. quantitative real time fluorescence quantifying PCR method of mouse XOD transcriptional level; It is characterized in that: the cDNA that becomes with the total RNA reverse transcription of sample is a template; Utilize the PCR combination of primers to carry out the real-time fluorescence quantitative PCR amplification, according to the quantitative XOD transcriptional level of the changing conditions of fluorescence in the reaction system.
3. the quantitative real time fluorescence quantifying PCR method of mouse XOD transcriptional level according to claim 2, it is characterized in that: described extension increasing sequence is:
tatggccccgaggtaaaaatcgagaaaggagatctcaagaaaggcttttctgaagctgacaatgttgtctcaggaga
attatatattggtggccaggagcacttctatctggagacccactgcaccattgccgtgccgaaaggcgaggcaggcg
agatggagctcttcgtgagcacacagaacaccatgaaaacccagagctttattgcaaagatgttgggtgttccagac
aacagaattgtagtccgagtgaaaagaatgggtggaggctttggagggaaggagacccggagcactctgatatccac
agcagtggccttggctgcatacaagacaggccgccc
4. the quantitative real time fluorescence quantifying PCR method of mouse XOD transcriptional level according to claim 2; It is characterized in that: described pcr amplification system is: 25 μ L systems, 2 * SYBR Mix, 12.5 μ L, 10 μ mol/L forwards, each 0.5 μ L of reverse primer, cDNA template 2 μ L; 9.35 μ L deionized water; TaqDNAPolymerase 0.15 μ L, three-step approach increases to sample, on quantitative real time PCR Instrument, obtains the CT value.
5. the quantitative real time fluorescence quantifying PCR method of mouse XOD transcriptional level according to claim 4, it is characterized in that: described three-step approach is: 95 ℃ of 3min, 95 ℃ of 30sec, 60 ℃ of 30sec, 72 ℃ of 31sec, 40 circulations.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210006099.7A CN102758003B (en) | 2012-01-10 | 2012-01-10 | PCR (Polymerase Chain Reaction) primer composite for quantifying transcriptional level of mice xanthine oxidase and PCR method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210006099.7A CN102758003B (en) | 2012-01-10 | 2012-01-10 | PCR (Polymerase Chain Reaction) primer composite for quantifying transcriptional level of mice xanthine oxidase and PCR method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102758003A true CN102758003A (en) | 2012-10-31 |
| CN102758003B CN102758003B (en) | 2014-06-04 |
Family
ID=47052655
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210006099.7A Expired - Fee Related CN102758003B (en) | 2012-01-10 | 2012-01-10 | PCR (Polymerase Chain Reaction) primer composite for quantifying transcriptional level of mice xanthine oxidase and PCR method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102758003B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003000299A (en) * | 2001-06-18 | 2003-01-07 | Fuji Photo Film Co Ltd | Method for detecting target nucleic acid fragment, and kit for detecting target nucleic acid fragment |
| EP1435393A1 (en) * | 2002-12-12 | 2004-07-07 | Fuji Photo Film Co., Ltd. | Method for analyzing gene expression levels by quantification of pyrophosphoric acid |
| JP2004321127A (en) * | 2003-04-28 | 2004-11-18 | Fuji Photo Film Co Ltd | Method for detecting target nucleic acid fragment |
| CN102146451A (en) * | 2011-01-24 | 2011-08-10 | 内蒙古民族大学 | PCR (Polymerase Chain Reaction) product qualitative and semiquantitative detecting kit |
-
2012
- 2012-01-10 CN CN201210006099.7A patent/CN102758003B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2003000299A (en) * | 2001-06-18 | 2003-01-07 | Fuji Photo Film Co Ltd | Method for detecting target nucleic acid fragment, and kit for detecting target nucleic acid fragment |
| EP1435393A1 (en) * | 2002-12-12 | 2004-07-07 | Fuji Photo Film Co., Ltd. | Method for analyzing gene expression levels by quantification of pyrophosphoric acid |
| JP2004321127A (en) * | 2003-04-28 | 2004-11-18 | Fuji Photo Film Co Ltd | Method for detecting target nucleic acid fragment |
| CN102146451A (en) * | 2011-01-24 | 2011-08-10 | 内蒙古民族大学 | PCR (Polymerase Chain Reaction) product qualitative and semiquantitative detecting kit |
Non-Patent Citations (4)
| Title |
|---|
| 《Free Radical Biology & Medicine》 20061231 Katrin Schr�der et al.， "Xanthine oxidase inhibitor tungsten prevents the development of atherosclerosis in ApoE knockout mice fed a Western-type diet" 第1353-1360页 , 第41期 * |
| 《GenBank》 20101006 Carninci,P. et al. "NCBI reference sequence: No. AK171642.1" ORIGIN序列 , * |
| CARNINCI,P. ET AL.: ""NCBI reference sequence: No. AK171642.1"", 《GENBANK》, 6 October 2010 (2010-10-06) * |
| KATRIN SCHRöDER ET AL.，: ""Xanthine oxidase inhibitor tungsten prevents the development of atherosclerosis in ApoE knockout mice fed a Western-type diet"", 《FREE RADICAL BIOLOGY & MEDICINE》, no. 41, 31 December 2006 (2006-12-31), pages 1353 - 1360 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102758003B (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104818318A (en) | Primers, probes, detection system and kit for one time detection of lung cancer multiple genes | |
| JP2011501964A (en) | Prognostic prediction process of squamous cell lung cancer | |
| CN107326071B (en) | Application of PLPP4 as non-small cell lung cancer diagnosis, treatment and prognosis target | |
| CA3077800A1 (en) | Biomarkers useful for detection of types, grades and stages of human breast cancer | |
| CN108342482A (en) | A kind of glioblastoma marker and its application, kit | |
| CN106701910A (en) | Primer pair, kit and method for identifying gender of dove | |
| CN107312852A (en) | Myocardial infarction diagnosis mark compositions | |
| CN108456731A (en) | Application of long-chain non-coding RNA L INC00336 as biomarker in preparation of lung adenocarcinoma prognosis detection preparation | |
| CN108192974A (en) | Application of long-chain non-coding RNA L INC00842 as biomarker in preparation of lung adenocarcinoma prognosis detection preparation | |
| CN108085391B (en) | RNA quality control product of lung cancer fusion gene detection kit capable of being stably stored | |
| CN105255869B (en) | Application of ABCC4 gene polymorphism site rs3742106 and detection primer and kit thereof | |
| Koshkin et al. | Profile of microRNA expression in brain tumors of different malignancy | |
| CN109182528B (en) | Glioblastoma multiforme auxiliary diagnosis and prognosis evaluation kit based on ITGB5 gene and use method thereof | |
| EP2942399B1 (en) | Method for the diagnosis of breast cancer | |
| CN110358835A (en) | Application of the biomarker in gastric cancer is detected, diagnosed | |
| CN102758003B (en) | PCR (Polymerase Chain Reaction) primer composite for quantifying transcriptional level of mice xanthine oxidase and PCR method thereof | |
| CN113151462B (en) | Application of lung cancer prognosis diagnosis marker and detection kit | |
| CN107586844A (en) | Application of glioma prognostic marker Circ9:135881633|135883078 | |
| CN107142332A (en) | A kind of enzyme DNA machines are used for the method that miRNA is detected | |
| CN103589786B (en) | Method, test kit and the primer of detection RRM1 mRNA relative expression quantity and probe | |
| CN113832232A (en) | Biomarker for predicting responsiveness of lung adenocarcinoma to platinum-containing dual-drug chemotherapy, and related product | |
| CN109295059B (en) | Application of covalent circular closed single-stranded RNA in triple-negative breast cancer kit | |
| CN112813167A (en) | Marker LINC01977 and application thereof | |
| CN102690882A (en) | PCR (Polymerase Chain Reaction) primer combination and PCR method for quantifying transcriptional level of mice aldehyde oxidase | |
| CN102643899B (en) | Kit for diagnosing acute myelocytic leukemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Cai Inventor after: Wang Yang Inventor after: Wang Hongwei Inventor after: Lin Lin Inventor after: Shang Zesong Inventor after: Wang Yalei Inventor after: Zhu Zhongwei Inventor before: Zhang Cai Inventor before: Wang Hongwei Inventor before: He Wanling Inventor before: Yang Zijun Inventor before: Wang Xueying Inventor before: Zhu Zhongwei Inventor before: Wang Yalei Inventor before: Shang Zesong |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: ZHANG CAI WANG HONGWEI HE WANLING YANG ZIJUN WANG XUEYING ZHU ZHONGWEI WANG YALEI SHANG ZESONG TO: ZHANG CAI WANG YANG WANG HONGWEI LIN LIN SHANG ZESONG WANG YALEI ZHU ZHONGWEI |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140604 Termination date: 20150110 |
|
| EXPY | Termination of patent right or utility model |