CN102758000A - Organism lifetime based method for screening compounds capable of improving generation efficiency of induced pluripotent stem cells - Google Patents
Organism lifetime based method for screening compounds capable of improving generation efficiency of induced pluripotent stem cells Download PDFInfo
- Publication number
- CN102758000A CN102758000A CN2011101103529A CN201110110352A CN102758000A CN 102758000 A CN102758000 A CN 102758000A CN 2011101103529 A CN2011101103529 A CN 2011101103529A CN 201110110352 A CN201110110352 A CN 201110110352A CN 102758000 A CN102758000 A CN 102758000A
- Authority
- CN
- China
- Prior art keywords
- stem cells
- compound
- pluripotent stem
- organism
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for screening compounds capable of improving generation efficiency of induced pluripotent stem cells, in particular to a method for screening compounds capable of improving generation efficiency of induced pluripotent stem cells in basis of organism lifetimes, particularly fruit fly lifetimes. The invention further relates to a lifetime prolonging compound, in particular to a fruit fly lifetime prolonging compound, and particularly discloses new usages of rapamycin, PP242, PQ401, resveratrol, fisetin, spermidine, LY294002 and curcumin in improvement of generation efficiency of induced pluripotent stem cells.
Description
Technical field
The present invention relates to screening and improve inductive pluripotent stem cells (induced pluripotent stem cell; Abbreviation iPSC) method of the compound of generation efficient; Specifically be based on the organism life-span, particularly the life span of drosophila melanogaster screening improves the method that inductive pluripotent stem cells produces the compound of efficient.The invention still further relates to life-span prolongation compound; Particularly life span of drosophila melanogaster prolongs compound, specifically is rapamycin, PP242, PQ401, trans-resveratrol, fisetin, spermidine, LY294002 and the turmeric yellow new purposes in improving inductive pluripotent stem cells generation efficient.
Background technology
Embryonic stem cell (ESC) is that a group derives from embryo's inner cell mass blastula stage, can keep the cell of multidirectional differentiation capability simultaneously at external infinite multiplication.Before more than ten years, the successful separation of human embryo stem cell brings very big hope to regenerative medicine.The research of scientists expection ESC directed differentiation will help to quicken the paces of Transplanted cells clinical treatment.Yet the immunological rejection problem that unavoidable ethics problem of ESC itself and variant cell are transplanted has constituted the ESC treatment and has been applied to clinical huge obstacle.Appearing at of inductive pluripotent stem cells solved above two problems to a great extent simultaneously; IPSC obtains through four transcription factors that in somatocyte, import external source with viral mode at first; Have form similar and epigenetic characteristic with ESC; The more important thing is that both have similar differentiation capability, i.e. the totipotency (pluripotency) of differentiation
[1]
The appearance of iPSC makes the stem cell of the patient-specific that no ethics is disputed on obtain to become possibility; And the specificity precursor cell that is obtained by the iPSC of patient-specific differentiation and mature cell be in histoorgan transplantation treatment, gene therapy, medicaments sifting model foundation, and special disease Molecular Study aspect has sizable advantage and potentiality undoubtedly
[2]Since the report of first piece of iPSC in 2006, there has been the development of advancing by leaps and bounds in this field under various countries scientist's effort.At present, existing three groups announce successfully to obtain the human inductive pluripotent stem cells of virus-free integration
[3-5]This indicates that inductive pluripotent stem cells research has stepped essential step to clinical application.Simultaneously; Protein and ascorbic application improve the low efficient of inducing of inductive pluripotent stem cells rapidly, and the tetraploid complementary assay that utilizes inductive pluripotent stem cells to clone the experiment made on the living mouse has first proved that then inductive pluripotent stem cells possesses the potentiality of development same with ES.Therefore inductive pluripotent stem cells is closely similar with the ES cell at aspects such as cellular form, growth characteristics, stem cell markers expression, and formation chimeric animal aspect is also almost completely identical with the ES cell.
But, in the inductive pluripotent stem cells inductive technology rapidly in the progress, induce in the process Molecular Study but to make slow progress for inductive pluripotent stem cells, this becomes inductive pluripotent stem cells and is applied to clinical major obstacle.We know; Exogenous factor inductive cell reprogrammed is a process very slowly; Usually need two weeks even longer time; In this process, most of cell has only the complete reprogrammed of cell quilt after having passed through several intermediate states of only a few (being generally 0.5%) not by reprogrammed
[6]
From before result of study see that it is basic identical that inductive pluripotent stem cells produces efficient, efficient is approximately from 100,000 initiator cells and obtains ten inductive pluripotent stem cells, this efficient is very low.The inefficient promotion and application that can have a strong impact on inductive pluripotent stem cells.Since inductive pluripotent stem cells produces; Its reprogrammed mechanism and high efficiency exploration were not just stopped; Present research proof has some compounds to improve the generation efficient of inductive pluripotent stem cells through the adjusting chromatin Structure; Can improve the compound that inductive pluripotent stem cells produces efficient yet this area still is starved of, also need more effective system to screen and to improve the compound that inductive pluripotent stem cells produces efficient.
The production process of organism life-span and inductive pluripotent stem cells is all by many signals, multipath regulation and control.The research work in early stage shows that the polyphenoils vitamins C can prolong the life-span of fruit bat.Report that also vitamins C can significantly improve iPSC and induce efficient
[8]These study prompting, organism life-span regulatory pathway maybe with cell reprogrammed regulatory pathway, and then relevant with induced multi-potent stem cells.
Summary of the invention
The present invention has tested multiple compound with life-span prolongation effect, finds that surprisingly these compounds go up the effect that all has induced multi-potent stem cells basically.
Therefore, the object of the present invention is to provide a kind of can the screening more efficiently to improve the method that inductive pluripotent stem cells produces the compound of efficient.This method is on the basis of existing screening method; The step of prescreen is carried out in introducing according to the organism life-span; Have easy and simple to handle, characteristics such as reference value is high, economy, can screen more efficiently, more accurately and improve the compound that inductive pluripotent stem cells produces efficient.
Particularly, the present invention provides a kind of the screening to improve the method that inductive pluripotent stem cells produces the compound of efficient, and said method comprises:
1) candidate compound is provided;
2) can prolong the compound in organism life-span with the organism prescreen; With
3) from above-mentioned steps 2) in the compound that screens further screening improve the compound that inductive pluripotent stem cells produces efficient.
More specifically, the step 2 of the invention described above method) can comprise:
I) with candidate compound feeding or cultivation organism;
The life-span of ii) observing organism changes; With
Iii) select to prolong the compound in organism life-span.
In an embodiment, candidate compound can be any compound, preferably infers the compound that possibly prolong the organism life-span, for example mTOR suppressor factor, inhibitor or DNA restoration accelerator etc. according to prior art.In another embodiment, the used organism of the present invention can be bacterium, fungi or animal body, preferably is used as those of model animals in the biological experiment.The consumption of candidate compound should be the consumption that this organism is not produced overt toxicity in the organism screening; For example; Every kg body weight 0.01-100mg; For example every kg body weight 0.01mg, 0.05mg, 0.1mg, 0.5mg, 1mg, 2mg, 5mg, 10mg, 15mg, 20mg, 25mg, 30mg, 35mg, 40mg, 45mg, 50mg, 55mg, 60mg, 65mg, 70mg, 75mg, 80mg, 85mg, 90mg, 95mg, 100mg or any therebetween scope, those skilled in the art are not difficult to confirm this consumption according to prior art and limited experiment.
In another embodiment; Can observe the variation of organism life-span through multiple index or parameter; Include but not limited to, the survival time of record organism, write down life-span associated molecule index such as the telomere length or the like of life-span relevant physiological index such as basal metabolic rate(BMR), the detection of biological body of death condition, the detection of biological body of organism in time.
On the other hand, the step 3) of the invention described above method can comprise:
A) zooblast is provided;
B) with the said zooblast of induced transcription factor transfection and with step 1) in the compound that filters out contact;
C) quantity of detection inductive pluripotent stem cells; With
D) select to increase the compound that inductive pluripotent stem cells produces quantity.
In an embodiment, said zooblast can be the cell of part differentiation or the last eventually cell that breaks up.In another embodiment, said zooblast can be buied or with this area separation method animal body preparation, wherein said animal body can be adult or embryo from commercial sources.
In another embodiment, the process of transfection induced transcription factor is carried out through this area usual manner, for example passes through the virus vector transfection, passes through lipofectamine transfection etc., preferably through the virus vector transfection.Said virus vector can be retrovirus, adenovirus etc., preferred retroviral vector, for example pMXs carrier.In one embodiment, any transcription factor of induced transcription factor ability induced multi-potent stem cells, for example Sox2, Klf4, Oct4 and c-Myc (being abbreviated as SKOM in this article).In another embodiment; Said compound contacting step can be simply certain density compound to be added in the animal cell culture liquid; Also can be that for example liposome, emulsifying agent etc. contact certain density compound with zooblast through certain carrier.Said compound contacting step can before the transfection process, during or begin afterwards to carry out, for example, can be before or after transfection process begins begin to carry out in 1-10 days, and lasting 1-20 days or longer time.Specifically, said compound contacting step can be before or after transfection process begins to carry out in 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days or 10 days.Say that more specifically said compound contacting step is sustainable carried out (for example) 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 12 days, 14 days, 16 days, 18 days or 20 days or any scope therebetween.
Used compound final concentration can be any concentration that this zooblast is not had overt toxicity in the zooblast screening; According to particular compound; Can be (for example) 0.01nM to 100 μ M; For example 0.01nM, 0.03nM, 0.05nM, 0.07nM, 0.1nM, 0.3nM, 0.5nM, 0.7nM, 1nM, 3nM, 5nM, 7nM, 10nM, 15nM, 20nM, 25nM, 30nM, 35nM, 40nM, 45nM, 50nM, 55nM, 60nM, 65nM, 70nM, 75nM, 80nM, 85nM, 90nM, 95nM, 1 μ M, 5 μ M, 10 μ M, 15 μ M, 20 μ M, 25 μ M, 30 μ M, 35 μ M, 40 μ M, 45 μ M, 50 μ M, 55 μ M, 60 μ M, 65 μ M, 70 μ M, 75 μ M, 80 μ M, 85 μ M, 90 μ M, 95 μ M, 100 μ M or any therebetween scope, those skilled in the art are not difficult to confirm this concentration according to prior art and limited experiment.
In one embodiment; The step of said detection inductive pluripotent stem cells quantity can known by one of skill in the art one or more methods be carried out; Include but not limited to; Can be through staining known in the art, for example immunostaining directly detects and carries the cell of inductive pluripotent stem cells marker gene.These marker gene can be distributed in cell surface or the cell, or even endonuclear marker gene, for example SEAP, SSEA-1 and/or Nanog; Also can be induced transcription factor of the present invention, for example be among Sox2, Klf4, Oct4 and the c-Myc one or more.After the dyeing, can carry out quantitatively determined through for example following method: utilize the blood counting chamber counting process to examine under a microscope the quantity of staining cell; Utilize flow cytometry that staining cell is counted; Quantitative analysis to the dyeing total amount; Or the like.
In addition, the quantity that also can carry the cell of inductive pluripotent stem cells marker gene through reporter gene method indirect detection known in the art.Said reporter gene can be built into the detectable gene of when marker gene is expressed; Comprise the detectable gene that drives its expression when marker gene is expressed as stated; Drive the detectable gene of its expression when one or more are expressed among preferred Sox2, Klf4, Oct4 and the c-Myc; Driving the detectable gene of its expression when more preferably Oct4 expresses, for example is fluorescence protein gene, like GFP or YFP gene.Said reporter gene can carry out step 2 of the present invention) before, during or introduce afterwards in the said zooblast, preferably carrying out step 2 of the present invention) introduce before in the said zooblast.After the dyeing, can carry out quantitatively determined: utilize the blood counting chamber counting process under fluorescent microscope, to observe the cell quantity that sends fluorescence through for example following method; Utilize flow cytometry to sending the cell counting of fluorescence; Quantitative analysis to the fluorescence total amount; Or the like.
In addition, also can carry out quantitatively determined to the marker gene in treated whole cells, confirm the relative populations of inductive pluripotent stem cells through protein known in the art or mRNA quantitative determination process.This method specifically can include but not limited to, Western blotting, reverse transcription PCR and/or real-time quantitative PCR etc.
Use and above-mentionedly carry out the screening of inductive pluripotent stem cells related compound based on the organism life-span; Successfully filter out rapamycin, PP242, PQ401 equal life and prolong compound and have and improve the effect that inductive pluripotent stem cells produces efficient, and they are to the not influence of pluripotent stem cell characteristic of inductive pluripotent stem cells.
Therefore, the present invention also aims to provide the life-span to prolong the application of compound in improving inductive pluripotent stem cells generation efficient.Through experiment confirm, all life-spans prolongation compounds of the present invention's test are gone up basically and can both be improved inductive pluripotent stem cells generation efficient.The compound that the raising inductive pluripotent stem cells that is filtered out in addition produces efficient does not influence the expression of induced transcription factor, does not influence the stem cell versatility; The inducibility stem cell that obtains has multipotency under physiological condition.
Description of drawings
After Figure 1A and B explained that respectively PP242 and PQ401 handle, green fluorescent protein (GFP) positive cell accounted for the percentage ratio of MEC sum, n=4, data be expressed as MV ± standard error (
*P＜0.01,
*P＜0.05).Fig. 1 C and E explain respectively under the situation of feed 3 μ M rapamycins and different concns PP242 as shown in the figure and PQ401 that the W1118 fruit bat becomes the time-histories of per-cent alive to change.Fig. 1 D and F explain respectively under the situation of feed 3 μ M rapamycins and different concns PP242 as shown in the figure and PQ401, the column diagram of W1118 fruit bat mean survival time, data representation MV ± standard error (
* *P＜0.001,
*P＜0.01).Fig. 1 G all test compounds of explanation (0.3nM rapamycin, 0.1nM PP242,0.3nM PQ401,3 μ M trans-resveratrols, 3 μ M fisetin, 30nM spermidine, 0.3 μ M LY294002,10 μ M turmeric yellows) cause that all green fluorescent protein (GFP) positive cell percentage ratio increases.Fig. 1 H is that the functional mechanism of all test compounds shown in Fig. 1 G, evidence and the reprogramming efficiency that the life-span prolongs improve gathering of multiple.
Fig. 2 A and C explain that respectively the rapamycin (Rapa) with different concns handles MEC 16 days or account for the percentage ratio of all colony quantity, data representation MV ± standard error with the positive colony of green fluorescent protein (GFP) that produces behind the 0.3nM rapamycin treatment MEC different time.Fig. 2 B explanation rapamycin (Rapa) is handled the percentage ratio that back GFP positive cell accounts for the MEC sum, n=4, data representation MV ± standard error (
*P＜0.01,
*P＜0.05).Fig. 2 D from left to right is respectively light field Photomicrograph, fluorescence (GFP) Photomicrograph and the alkaline phosphatase staining Photomicrograph that rapamycin (Rapa) is handled back inductive inductive pluripotent stem cells.Fig. 2 E shows the relative mRNA expression level of endogenous versatility mark Nanog, Oct4 and Sox2 in rapamycin (Rapa) the processing inductive inductive pluripotent stem cells, and wherein #2, #4 and #5 represent the numbering of different colonies respectively.Fig. 2 F is respectively Nanog and the SSEA-1 immunostaining Photomicrograph that rapamycin (Rapa) is handled the positive inductive pluripotent stem cells of GFP of back generation.Fig. 2 G is the karyotyping figure that rapamycin (Rapa) is handled the inductive pluripotent stem cells of back generation.Fig. 2 H shows the allophenic mice of the inductive pluripotent stem cells generation that produces after rapamycin (Rapa) is handled.
Fig. 3 shows through flow cytometry, and the 12nd day green fluorescent protein positive cell of rt virus transfection accounts for the percentage ratio of whole cells under contrast and rapamycin (0.3nM) treatment condition.
Fig. 4 A-F shows the percentage ratio of the positive inductive pluripotent stem cells of trans-resveratrol, fisetin, spermidine, LY294002, turmeric yellow and N1,N1-Dimethylbiguanide inductive GFP of different concns respectively.
Embodiment
I. definition
Term used herein " embryonic stem cell " or " ES cell " refer to derived from the embryo, can keep the cell of multidirectional differentiation capability at external infinite multiplication simultaneously.
Term used herein " inductive pluripotent stem cells " or " iPSC " refer to have the form similar with ESC, epigenetic characteristic and differentiation capability, but not derived from embryo's cell.Specifically, inductive pluripotent stem cells can be the multipotential stem cell of inducing generation through means such as physics, chemistry, biology, genetic engineering.Said inductive pluripotent stem cells can be from invertebrates or vertebrates; Preferably from vertebrates; Specifically can be from fish, birds or Mammals; More specifically can be from rodent, felid, Canis animals or primate, most preferably from mouse, rat, dog, macaque, chimpanzee or people.
Term used herein " induced transcription factor " refers to the transcription factor of ability induced multi-potent stem cells, specifically can be SKOM transcription factor, i.e. Sox2, Klf4, Oct4 and c-Myc.Known in the art, can obtain inductive pluripotent stem cells after in somatocyte, importing said induced transcription factor with viral mode.
Term used herein " organism " refers to bacterium, fungi or animal; Usually be to be used as short those of the life cycle of model animals in the biological experiment; Include but not limited to eubacterium, yeast, nematode, insect, rodent, fish etc.; Specifically can be intestinal bacteria, genus bacillus, yeast saccharomyces cerevisiae, beautiful new rhabditis axei (C.elegans), fruit bat (Drosophila), mouse, rat or zebra fish or the like; Preferred fruit bat, mouse, rat, yeast or fish, more preferably fruit bat.Certainly, mouse and rat life cycle reach 1-2, raise the conditional request harshness, are not applicable to large-scale screening compound research very much.
Term used herein " life-span prolongs compound " refers to prolong the compound in organism life-span, includes but not limited to: mTOR suppressor factor, inhibitor, DNA restoration accelerator, rapamycin, PP242, PQ401, trans-resveratrol, fisetin, spermidine, LY294002 and turmeric yellow etc.
Term used herein " rapamycin " is also referred to as sirolimus (Sirolimus), is a kind of suppressor factor of mTOR signal path, on fruit bat and mouse model, all can prolong the organism life-span
[9]Term used herein " PP242 " does
(C
16H
16N
6O), it also is the mTOR signal pathway inhibitor; Term used herein " PQ401 " does
(C
18H
16ClN
3O
2), it is growth factor antagonist of para-insulin.Term used herein " LY294002 " does
(C
19H
18ClNO
3).
Term used herein " totipotency " refers to be differentiated to form the ability of complete organism.
Term used herein " zooblast " refers to derive from the cell of animal body.On the one hand; This type cell can be from invertebrates or vertebrates; Preferably from vertebrates; Specifically can be from fish, birds or Mammals, more specifically can be from rodent, felid, Canis animals or primate, most preferably from mouse, rat, dog, macaque, chimpanzee or people.On the other hand, this type cell can be the cell of part differentiation or the last eventually cell that breaks up.Said " part differentiation cell " refer to from the myeloid-lymphoid stem cell differentiation, do not have totipotency but still keep the cell of certain differentiation capability; Said " eventually end differentiation cell " refer to from the myeloid-lymphoid stem cell differentiation, do not have totipotency, lose the cell of further differentiation capability yet.Said " part noble cells " comprises inoblast, neuroblast, lymphoblast, hemopoietic stem cell, basal cell, scleroblast, epithelial cell, hair cell; Said " terminally differentiated cells " comprises hemocyte, lymphocyte, myocyte, liver cell, kidney cell, neurocyte, stellate cell, myxocyte etc.This term can refer to derive from the cell of animal embryo, for example derives from the inoblast of animal embryo, preferably derives from the inoblast of mice embryonic.
II. embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.
Material:
The W1118 fruit bat is provided by Damian doctor Crowther of Institute for Medical Research of univ cambridge uk; The pMXs carrier is Toshio professor Kitamura of Tokyo University present; The plat-E cell is from Guangzhou biological medicine health research institute;
Original flavor ground rice is available from the Nestle SA (catalog number (Cat.No.) Q/SCQC0005S) of Shanghai City, China, and growth cabinet is available from Ningbo, south of the River instrument company (Chinese Ningbo City, Zhejiang Province);
Rapamycin is available from Wyeth (Shanghai City, China); PQ401 and PP242 are available from the Sigma aldrich company (Sigma-Aldrich) of Shanghai City, China; Trans-resveratrol, fisetin, spermidine are available from the Sigma company (Sigma) of Chinese Shanghai; LY294002 and turmeric yellow are available from special kerry Corp. (Tocris) of Missouri, USA; Polybrene is available from Millipore Corp. (Milipore) of Chinese Shanghai; Used substratum, FBS, KSR and LIF are available from the Ji Buke company (Gibco BRL) of Chinese Shanghai in the experiment; Basic biochemical reagents such as L-glutaminate, non-essential amino acid, beta-mercaptoethanol are purchased in Chinese Shanghai experiment reagent ltd.
Trizol reagent and PCR mixture (PCR MIX) and alkaline phosphatase staining test kit (85L3R) are available from the Sigma company (Sigma) of Chinese Shanghai; M-MLV is available from the Pu Luomaige company (Promega) of Chinese Shanghai; Eva green (Eva Green) visits the company of rising (Biotium) available from California, USA; SSEA-1 antibody 480 (sc21702) and Nanog antibody M-149 (sc33760) are all from U.S. markon welfare Ya Zhou Santa Cruz biotech company (Santa Cruz);
MX3000P type PCR machine is looked into column foot company (Stratagene) available from California, USA department.
Method:
● life span of drosophila melanogaster is learned: the wild-type fruit bat is backcrossed more than 6 times, produces the F1 filial generation and is divided into 20/pipe, and each handles 5 pipes totally 100 fruit bats.All experiments are all raised in 25 ℃ of maintenances, 65% humidity with fruit bat and are raised condition and 12 hours daytimes: in the growth cabinet of 12 hour daily cycle of evening, write down the mortality of fruit bat every day.Fruit bat food is formed by the aqueous solution and the instant original flavor ground rice of the 0.55g thorough mixing of 1.4mL respective concentration compound.Fruit bat food was changed once in per two days, and the life span of drosophila melanogaster data are with Kaplan-Meier statistical study mapping in SPSS 13.0 softwares (IBM Corporation, New York city,U.S).
● MEC separates: press described methods such as Huangfu DW
[19]Acquisition contains the GFP reporter gene and the transgene mouse model OG2+ that drive to be expressed by OCT4/-/ROSA26+/-(OG2) GFP mouse; With OG2+/-/ROSA26+/-(OG2) GFP mouse (13.5 embryonic stage) is put to death; Remove all bodies of gland and internal organ; Directly separate embryo fibroblast by the embryo, cell uses in follow-up test after 3 times through going down to posterity.Have green fluorescence protein gene in the used mouse genome; This expression of gene receives the Oct4 transcription factor to drive expression; And Oct4 only in transfection expression is just arranged in the inductive pluripotent stem cells of SKOM, thereby can detect inductive pluripotent stem cells through the fluorescence that the green GFP sends.
● inducing of retrovirus making and inductive pluripotent stem cells: retrovirus is with the retroviral vector pMXs transfection Retronituse encapsulated cell line plat-E that contains mouse source Sox2, Klf4, Oct4 and c-Myc encoding sequence, packaging virus.And dye MEC 2 with this viral liquid transfection liquid inductance and take turns, the Polybrene that adds final concentration 8 μ g/mL is to improve the virus transfection rate.After this, cell being changed to the mES nutrient solution (contains and continues among the DMEM of 15%FBS (foetal calf serum), L-glutaminate, non-essential amino acid, beta-mercaptoethanol and 1000U/ml LIF to cultivate, and this sky is defined as infected the back the 0th day.
● compound treatment: compound elder generation's water or DMSO dissolving, be diluted to respective concentration with the mES nutrient solution, adding to cultivate has in the mES nutrient solution of l cell.And after infection, detected the positive colony of GFP with flow cytometer on the 12nd day, under fluorescent microscope, calculate the number (calculate two at least and coil cells) of GFP positive cell.In order to obtain reprogrammed inductive pluripotent stem cells completely; After infection the 16th day; Picking ES appearance colony from the MEC of SKOM transfection; Trysinization is that single cell suspension changes in 96 orifice plates of the DMEM nutrient solution that contains 15%KSR (Knockout Serum Replacement knocks out serum substitute), L-glutaminate, non-essential amino acid, beta-mercaptoethanol and 1000U/ml LIF.
● the checking of inductive pluripotent stem cells: SEAP (AP) and SSEA-1 are the marker protein on inductive pluripotent stem cells surface; Nanog is a transcription factor in the specific expressed nuclear of inductive pluripotent stem cells, and those skilled in the art usually verify inductive pluripotent stem cells with their specific staining.Specifically be with setting up good inductive pluripotent stem cells with 1 * 10
4Individual/hole density changes 24 orifice plates over to, uses SEAP, Nanog and SSEA-1 dyeing in alkaline phosphatase staining test kit, SSEA-1 antibody 480 and the Nanog antibody M-149 pair cell two days later.
● rt real-time quantitative PCR: from cell pyrolysis liquid, extract total RNA with Trizol reagent; Use the M-MLV rt, the PCR reaction system: 2x PCR mixture (PCR MIX) adds that Eva green (EvaGreen) reacts and measures the gene relative expression and use the confidential reference items stdn on MX3000P type PCR machine.The real-time quantitative PCR reaction conditions is following: 94 ℃ of initial sex change 5 minutes, after connect 35 circulations in 94 ℃ of 30 seconds of sex change, 58 ℃ of 60 seconds of annealing, 72 ℃ of 60 seconds of amplification.Primer used in the real-time quantitative PCR is following:
OCT4 sense primer: TCTTTCCACCAGGCCCCCGGCTC (SEQ ID NO:1);
OCT4 antisense primer: TGCGGGCGGACATGGGGAGATCC (SEQ ID NO:2);
Nanog sense primer: AGGGTCTGCTACTGAGATGCTCTG (SEQ ID NO:5);
Nanog antisense primer: CAACCACTGGTTTTTCTGCCACCG (SEQ ID NO:6).
● allophenic mice: in the segmentation cavity of donor mice, be transplanted in the uterus of the female mouse of false pregnancy by the blastaea after will injecting again with the iPSC injection cell for the method through microinjection, thereby obtain allophenic mice.
● method of karyotype analysis: get the medium cell of experimental group and contrast, after dyeing with the nucleus basic dyestuff,, after microscopically is taken pictures, compare with chromosome pairing.
Unless otherwise specified, following examples all adopt above-mentioned materials and method to carry out.
The inventor detects the PQ401 of PP242 and different concns of 3 μ M rapamycins, different concns to the influence of life span of drosophila melanogaster according to aforesaid method.The result finds, 3 μ M rapamycins, and 0.3 μ M, 1 μ M and 3 μ M PP242, and 3 μ M, 10 μ M and 30 μ M PQ401 all can significantly increase become to live per-cent (shown in Fig. 1 C and E) and the mean survival time (shown in Fig. 1 D and F) of fruit bat.
Embodiment 2PP242 and PQ401 are to l cell GFP
+The influence of percentage ratio
The inventor detects the PP242 of different concns and the following GFP that produces with the SKOM transfection of PQ401 effect of different concns according to aforesaid method
+Percentage of cells and GFP
+The colony number is to confirm PP242 and the PQ401 influence to SKOM success transfection l cell.The result shows, compares with the contrast of handling without motif compound, and 0.03nM, 0.1nM, 0.3nM and 1nM PP242, and 0.3nM, 1nM, 3nM and 10nM PQ401 all can improve GFP
+Percentage of cells and GFP
+The colony number has promptly improved SKOM success transfection l cell, makes its efficient that becomes inductive pluripotent stem cells (shown in Figure 1A and B).Through quantitative analysis, can confirm that these compounds can improve inductive pluripotent stem cells and induce efficient to reach 3 times more than.
More than 3 kind of compound of embodiment is to l cell GFP
+The influence of percentage ratio
The life-span that on yeast, nematode, fruit bat, mouse isotype biology, has that the inventor has also chosen rapamycin and bibliographical information prolongs the compound of effect, comprises trans-resveratrol, fisetin, spermidine, LY294002, turmeric yellow and N1,N1-Dimethylbiguanide
[14-18], detect the GFP that under they effects, produces with the SKOM transfection according to aforesaid method
+Percentage of cells.Find that surprisingly and only compare with the contrast of DMSO processing with carrier such as water, except that N1,N1-Dimethylbiguanide, these compounds (3 μ M trans-resveratrols, 3 μ M fisetin, 30nM spermidine, 0.3 μ M LY294002,10 μ M turmeric yellows) all can improve GFP
+Percentage of cells has promptly improved SKOM success transfection l cell, makes its efficient that becomes inductive pluripotent stem cells (shown in Fig. 1 G and H).
On the basis of embodiment 3, the inventor further detects the GFP that the rapamycin effect produces with the SKOM transfection down according to aforesaid method
+Percentage of cells and GFP
+The colony number.The result shows, compares with contrast without rapamycin treatment, and the rapamycin treatment of different concns 16 days (shown in Fig. 2 A and B), or, can improve GFP with 0.3nM rapamycin treatment different time (shown in Fig. 2 C)
+Percentage of cells and/or GFP
+The colony number has promptly improved SKOM success transfection l cell, makes it become the efficient of inductive pluripotent stem cells.Through quantitative analysis, can confirm that rapamycin can improve inductive pluripotent stem cells and induce efficient to reach 4 times more than.This analytical results and flow cytometry analysis result consistent (as shown in Figure 3).
Observe rapamycin treatment to GFP through the verification method of aforementioned inductive pluripotent stem cells
+The influence that the SEAP of l cell (AP), Nanog and SSEA-1 express.The result finds that the rapamycin treatment process does not have influence (shown in Fig. 2 D and F) to the expression of these inductive pluripotent stem cells marks.
Also further verify GFP in the mRNA level through aforementioned rt real time quantitative PCR method
+Relative expression's level of OCT4, Sox 2 and Nanog in the l cell.The result indicates, the rapamycin treatment process is to the expression of inductive pluripotent stem cells mark Nanog and rotaring redyeing gene OCT4 and Sox2 do not make significant difference (shown in Fig. 2 E).
Also analyze the GFP that obtains after the rapamycin treatment through aforementioned method of karyotype analysis
+L cell finds that these cells remain normal inductive pluripotent stem cells (Fig. 2 G).The multipotential stem cell that induces through rapamycin treatment like this can and successfully be differentiated to form allophenic mice (shown in Fig. 2 H) in performance function under the physiological condition.
On the basis of embodiment 3, the inventor further detects the GFP that under trans-resveratrol, fisetin, spermidine, LY294002, turmeric yellow and the N1,N1-Dimethylbiguanide effect of different concns, produces with the SKOM transfection according to aforesaid method
+Percentage of cells.The result confirms that further except that N1,N1-Dimethylbiguanide, these compounds all can improve GFP
+Percentage of cells has promptly improved SKOM success transfection l cell, makes its efficient that becomes inductive pluripotent stem cells (as shown in Figure 4).
Discuss:
According to one's analysis, the life-span prolongs compound and possibly impel reprogramming of somatic cells through following approach, and then induced multi-potent stem cells:
1) the old and feeble approach of anti-cell:, make cell seldom enter into the process of reprogrammed, and then produce inductive pluripotent stem cells changing the cell aging of the initial reprogrammed meeting of retroviral acceleration bodies, apoptosis process over to.The main mechanism that life-span prolongs compound is exactly to delay senility, thereby can make more cell get into the reprogrammed process, produces efficient thereby improve inductive pluripotent stem cells.
2) mTOR signal path approach: the mTOR signal pathway is growth factor, an amino acid in the perception environment, and suppressing mTOR has very strong anti-cell aging, energy limited effect
[10-13]TGF signal approach in mTOR signal pathway downstream works in addition; The rising of TGF β level suppresses the generation of reprogramming of somatic cells in the process of reprogrammed, possibly pass through the effect that TGF signal approach prolongs the organism life-span and improves reprogrammed so suppress mTOR.
(3) anti-oxidant approach: polyphenoils such as VITAMINs can prolong the organism life-span, and the raising reprogramming efficiency of somatic cells works through anti-oxidant approach exactly.
(4) strengthen the DNA repairing effect: suppressing mTOR can increase the genomic effect of cytothesis, increases the genome damage and influences reprogramming efficiency and in the reprogramming of somatic cells process, cross the expression transcription factor.
Reference:
[1]Yamanaka?S.Cell?Stem?Cell，2007，11)：39-49；
[2] Daley GQ, Lensch MW, Jaenisch R. etc., Cell Stem Cell, 2009,4 (3): 200-1;
[3] Yu J, Hu K, Smuga-Otto K. etc., Science, 2009;
[4] Kaji K, Norrby K, Paca A. etc., Nature, 2009,458 (7239): 771-5;
[5] Woltjen K, Michael IP, Mohseni P. etc., Nature, 2009,458 (7239): 766-70;
[6] Brambrink T, Foreman R, Welstead GG. etc., Cell Stem Cell, 2008,2): 151-9;
[7]Fontana?L，Partridge?L，Longo?VD(2010).Science.328，321-326；
[8] Miguel Angel Esteban etc., Cell Stem Cell.2010 January 8; 61): 71-9;
[9] David E.Harrison etc., Nature 460,392-395;
[10] Powers RW, Kaeberlein M, Caldwell SD, Kennedy BK, Fields S (in January, 2006) .Genes Dev.202): 174-84;
[11] Kaeberlein M, Powers RW, Steffen KK, Westman EA, Hu D, Dang N, Kerr EO, Kirkland KT, Fields S, Kennedy BK (in September, 2005) .Science 310 (5751): 1193-6;
[12] Jia K, Chen D, Riddle DL. (in August, 2004) .Development 131 (16): 3897-906;
[13] Kapahi P, Zid BM, Harper T, Koslover D, Sapin V, Benzer S (in May, 2004) .Curr.Biol.14 (10): 885-9;
[14] Howitz KT, Bitterman KJ, (in September, 2003) .Nature 425 (6954): 191-6 such as Cohen HY;
[15] Lee KS, Lee BS, Semnani S. etc., Rejuvenation Res.2010Oct; 13 (5): 561-70;
[16] Tobias Eisenberg .Nature CellBiology 11 such as Heide Knauer.Alexandra Schauer, 1305-1314 (2009);
[17] A.A.Moskalev and M.V.Shaposhnikov.REJUVENATTON RESEARCH the 13rd volume, 2-3 phase, 201;
[18] Mouchiroud L, Molin L, Dalliere N, Solari F.Biofactors.2010 September; 36 (5): 377-82;
[19] Huangfu DW, Maehr R, Guo WJ etc., Nat Biotechnol.2008; 26:795-797.
Claims (10)
1. one kind is screened the method that the raising inductive pluripotent stem cells produces the compound of efficient, and said method comprises:
1) candidate compound is provided;
2) can prolong the compound in organism life-span with organism prescreen from candidate compound; With
3) from above-mentioned steps 2) in the compound that screens further screening improve the compound that inductive pluripotent stem cells produces efficient.
2. the method for claim 1 is characterized in that, said step 2) comprising:
I) with said candidate compound feeding or cultivation organism;
The life-span of ii) observing said organism changes; With
Iii) select to prolong the compound in organism life-span.
3. according to claim 1 or claim 2 method is characterized in that said step 3) comprises:
A) zooblast is provided;
B) with the said zooblast of induced transcription factor transfection and with said step 2) in the compound that filters out contact;
C) quantity of detection inductive pluripotent stem cells; With
D) select to increase the compound that inductive pluripotent stem cells produces quantity.
4. method as claimed in claim 2 is characterized in that, said organism is bacterium, yeast, nematode, insect, rodent or fish.
5. method as claimed in claim 4 is characterized in that, said organism is fruit bat, yeast or fish.
6. method as claimed in claim 2; It is characterized in that said step I i) survival time through the record organism, write down the death condition of organism, the life-span relevant physiological index of detection of biological body or the life-span associated molecule of detection of biological body in time and carry out.
7. method as claimed in claim 3 is characterized in that, used induced transcription factor is one or more among Sox2, Klf4, Oct4 and the c-Myc in the said step b).
8. method as claimed in claim 3 is characterized in that, said step c) can be carried out through staining, reporter gene method, quantification of protein assay method or mRNA quantitative determination process.
9. the life-span prolongs the application of compound in improving inductive pluripotent stem cells generation efficient.
10. application as claimed in claim 9; It is characterized in that it is mTOR suppressor factor, inhibitor, DNA restoration accelerator, rapamycin, PP242, PQ401, trans-resveratrol, fisetin, spermidine, LY294002 and turmeric yellow etc. that the said life-span prolongs compound.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110110352.9A CN102758000B (en) | 2011-04-29 | 2011-04-29 | Organism lifetime based method for screening compounds capable of improving generation efficiency of induced pluripotent stem cells |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110110352.9A CN102758000B (en) | 2011-04-29 | 2011-04-29 | Organism lifetime based method for screening compounds capable of improving generation efficiency of induced pluripotent stem cells |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102758000A true CN102758000A (en) | 2012-10-31 |
| CN102758000B CN102758000B (en) | 2015-02-18 |
Family
ID=47052652
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110110352.9A Active CN102758000B (en) | 2011-04-29 | 2011-04-29 | Organism lifetime based method for screening compounds capable of improving generation efficiency of induced pluripotent stem cells |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102758000B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107375948A (en) * | 2017-06-08 | 2017-11-24 | 浙江大学 | Extend the medicament and its discrimination method in insect life-span |
| CN111849868A (en) * | 2020-08-03 | 2020-10-30 | 青岛农业大学 | Epithelial cell culture solution |
| CN112616775A (en) * | 2020-12-30 | 2021-04-09 | 昕慕（上海）科技发展有限公司 | Method for establishing hepatic fibrosis of healthy SD male rat by adopting compound factor method |
-
2011
- 2011-04-29 CN CN201110110352.9A patent/CN102758000B/en active Active
Non-Patent Citations (9)
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107375948A (en) * | 2017-06-08 | 2017-11-24 | 浙江大学 | Extend the medicament and its discrimination method in insect life-span |
| CN107375948B (en) * | 2017-06-08 | 2020-06-16 | 浙江大学 | Agent for prolonging life of insect and identification method thereof |
| CN111849868A (en) * | 2020-08-03 | 2020-10-30 | 青岛农业大学 | Epithelial cell culture solution |
| CN111849868B (en) * | 2020-08-03 | 2022-02-08 | 青岛农业大学 | Epithelial cell culture solution |
| CN112616775A (en) * | 2020-12-30 | 2021-04-09 | 昕慕（上海）科技发展有限公司 | Method for establishing hepatic fibrosis of healthy SD male rat by adopting compound factor method |
| CN112616775B (en) * | 2020-12-30 | 2023-02-10 | 昕慕（上海）科技发展有限公司 | Method for establishing hepatic fibrosis of healthy SD male rat by adopting compound factor method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102758000B (en) | 2015-02-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ge et al. | Dmrt1 induces the male pathway in a turtle species with temperature-dependent sex determination | |
| Parr et al. | MicroRNA-302 switch to identify and eliminate undifferentiated human pluripotent stem cells | |
| Trusler et al. | Cell surface markers for the identification and study of human naive pluripotent stem cells | |
| Russell et al. | A dynamic role of TBX3 in the pluripotency circuitry | |
| KR101386690B1 (en) | Rat embryonic stem cell | |
| Muenzner et al. | Generation and characterization of hepatocellular carcinoma cell lines with enhanced cancer stem cell potential | |
| Romer et al. | Isolating mitotic and meiotic germ cells from male mice by developmental synchronization, staging, and sorting | |
| US20140342369A1 (en) | Haploid cells | |
| Hayashi et al. | Enrichment of spermatogonial stem cells using side population in teleost | |
| CN107002031A (en) | The method for extracting noble cells | |
| Bajusz et al. | Evolving role of RING1 and YY1 binding protein in the regulation of germ-cell-specific transcription | |
| Magadi et al. | Dissecting Hes-centred transcriptional networks in neural stem cell maintenance and tumorigenesis in Drosophila | |
| Yamashiro et al. | Persistent requirement and alteration of the key targets of PRDM1 during primordial germ cell development in mice | |
| Di Giovannantonio et al. | Direct repression of Nanog and Oct4 by OTX2 modulates the contribution of epiblast-derived cells to germline and somatic lineage | |
| CN102758000B (en) | Organism lifetime based method for screening compounds capable of improving generation efficiency of induced pluripotent stem cells | |
| AU2019266240A1 (en) | Cell populations and gene expression associated with in vitro beta cell differentiation | |
| Liu et al. | The role of the Pax1/9 gene in the early development of amphioxus pharyngeal gill slits | |
| Matsui et al. | Primordial germ cells contain subpopulations that have greater ability to develop into pluripotential stem cells | |
| Huszar et al. | Med1 regulates meiotic progression during spermatogenesis in mice | |
| Součková et al. | From fish to cells: Establishment of continuous cell lines from embryos of annual killifish Nothobranchius furzeri and N. kadleci | |
| Fraune et al. | The synaptonemal complex of basal metazoan hydra: more similarities to vertebrate than invertebrate meiosis model organisms | |
| US20190224251A1 (en) | Methods of differentiating stem cells into endoderm | |
| Ding et al. | Scalable and Efficient Generation of Mouse Primordial Germ Cell-like Cells | |
| Sundby | Investigating the interplay between germ granules and sRNA pathways in C. elegans | |
| Ungricht et al. | Genome-wide screening in human kidney organoids identifies novel aspects of nephrogenesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200707 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai, Xuhui District Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| TR01 | Transfer of patent right |