CN102757498A - Bifunctional antibody for resisting four serotype dengue viruses and application thereof in preparation of drugs for resisting dengue virus infection - Google Patents
Bifunctional antibody for resisting four serotype dengue viruses and application thereof in preparation of drugs for resisting dengue virus infection Download PDFInfo
- Publication number
- CN102757498A CN102757498A CN2011101057287A CN201110105728A CN102757498A CN 102757498 A CN102757498 A CN 102757498A CN 2011101057287 A CN2011101057287 A CN 2011101057287A CN 201110105728 A CN201110105728 A CN 201110105728A CN 102757498 A CN102757498 A CN 102757498A
- Authority
- CN
- China
- Prior art keywords
- antibody
- variable region
- dengue virus
- kinds
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the technical field of biology, and particularly discloses a bifunctional DVD antibody for resisting four serotype dengue viruses, a preparation method and application thereof in the preparation of drugs for resisting dengue virus infection.
Description
Technical field
The invention belongs to biological technical field, more specifically, the invention discloses a kind of anti-four kinds of serotype dengue virus bifunctional antibody albumen and purposes in preparation anti-dengue virus infection medicine thereof with new texture.
Background technology
Dengue virus (Dengue virus; DENV) be the important member of flaviviridae (Flaviviridae), Flavivirus (arthropod-borne flaviviruses); Also comprise yellow fever virus (Yellow fever virus in this genus; YFV), west nile virus (West Nile virus, WNV), encephalitis b virus (Japanese encephalitis virus, JEV) and fores encephalitis virus (Tick-borne encephalitis virus; TBEV) but etc. the pathogenic agent of serious harm human health; Being one of most important arbovirus in the world, is communication media with Aedes albopictus (Aedes albopictus) and Aedes aegypti (Aedesaegypti) mainly, is widely current in the torrid zone and subtropical zone.Mainly cause clinically singapore hemorrhagic fever (Dengue Fever, DF), dengue hemorrhagic fever (Dengue hemorrhagic fever, DHF) and dengue shock syndrome (dengue shock syndrome, DSS).Wherein, DF is the self limiting febrile disease; DHF/DSS then causes vascular permeability and significantly increases, and causes the blood plasma seepage, and serious threat patient's life mainly betides the crowd of newborn infant and superinfection.There is the population of half to live in the singapore hemorrhagic fever epidemic-stricken area in the world approximately, has every year to surpass 5,000 ten thousand cases of infection, wherein have 500,000 people to develop into serious dengue hemorrhagic fever and dengue shock syndrome.And, in recent years, under influence of various factors such as global warming and the continuous expansion of mosquito distribution range, make breaking out of singapore hemorrhagic fever frequent day by day, number of the infected demonstrates constantly soaring trend.But the pathogeny of singapore hemorrhagic fever it be unclear that, and lacks effective vaccine and medicine that prevention and treatment DENV infect clinically, is main with the supportive treatment of suiting the medicine to the illness mainly.
Tegeline is the important way of virus disease treatment.Monoclonal antibody is compared with micromolecular compound has its special meliority: efficient, high specificity; Spinoff is little; The virus that can not only neutralize, it is viral to activate the vivo immuning system removing through CDC and ADCC effect.A large amount of inside and outside experiments of body prove: neutralizing antibody can effectively stop the infection of DENV, can not only bring into play the preceding prophylactic effect of virus infection, and in one period behind virus infection, still can bring into play the effect of treatment virus infection.Based on the present situation that infects no effective means of prevention clinically to DENV, and the huge advance made that all obtains at aspects such as humanization, mass-producing cultivation preparations of monoclonal antibody technique in recent years, the therapeutic antibodies strategy of dengue virus has obtained extensive concern.
In the Antybody therapy of dengue virus, because the normal cross infection that several kinds of serotypes take place of singapore hemorrhagic fever, therefore, antibody will be applied to treatment, must four kinds of serotype viruses of cross protection.Mostly existing persistent erection and active monoclonal antibody are the specific neutralizing antibody of single type or subgroup, though the property antibody of four serotypes of many strains in all intersecting is also arranged, tire to the protection of different serotypes virus and differ; And the problem that there is complicated component in the mixing application of several kinds of antibody and need carries out repeatedly clinical trial.
Summary of the invention
One of the object of the invention is to disclose the four kinds of serotype dengue virus bifunctional antibodies that can neutralize simultaneously.
More specifically, the invention discloses the DVD antibody structure that can keep 2 strain antibody variable region best-of-breed functionalitys, comprise the order of connection of linker sequence and variable region.
Another object of the present invention is to disclose the application of DVD antibody in anti-dengue virus infects that possesses said structure.
Particularly; Applicant of the present invention at first utilizes molecular biotechnology to clone the variable region sequences of two strain antibodies; And the mode through merging PCR carries out front and back connection with the variable region sequences of two strain antibodies through suitable linker sequence, makes up the weight chain expression vector respectively.The screening of cotransfection Chinese hamster ovary celI obtains the cell strain of stably express DVD antibody.Applicant of the present invention utilizes Chinese hamster kidney BHK-21 cell to carry out external plaque to reduce neutralization and verify the infection that resists four kinds of serotype dengue virus pair cells disclosed by the invention, and experimental result shows the bifunctional antibody DVD1A1D-1G6 of the present invention four kinds of serotype dengue viruss that can effectively neutralize.Applicant of the present invention utilize the suckling mouse encephalic attack malicious modelling verification bifunctional antibody DVD1A1D-1G6 also have effective provide protection in vivo.
Description of drawings
The structure mode chart of Fig. 1 DVD antibody.DVD1A1D-1G6 is that 1A1D-2 antibody weight chain variable region (VL and VH) is respectively at preceding cascaded structure.
The weight chain overlap PCR result of Fig. 2 bifunctional antibody structure DVD1A1D-1G6, the light chain size is about 1000bp, and the heavy chain size is about 700bp;
The enzyme of the light chain of Fig. 3 DVD1A1D-1G6 and heavy chain expression carrier cloning is cut evaluation, and swimming lane 1-3 represents the 1A1D-1G6-VLCL clone; 4-6 represents the 1G6-1A1D-VLCL clone; 7-9 represents the 1A1D-1G6-VH clone; 10-12 represents the 1G6-1A1D-VH clone;
The SDS-PAGE electrophoresis of Fig. 4 DVD antibody;
Fig. 5 DVD1A1D-1G6 detects with four kinds of serotype dengue virus bonded immunofluorescences.
Fig. 6 DVD1A1D-1G6 detects with four kinds of proteic immunoblottings of serotype dengue virus E D3;
Fig. 7 different serotypes dengue virus E D3 is with bonded competitive ELISA experiment between the DVD1A1D-1G6;
Fig. 8 DVD1A1D-1G6 antibody detects with the avidity of stepping on leather 1-4 C-type virus C ED3 district;
The external neutralization experiment of Fig. 9 antibody;
The endogenous protective experiment of Figure 10 antibody.
Embodiment
Further the present invention will be described below in conjunction with embodiment, experimental example, and these embodiment, experimental example should not be construed as limitation of the present invention.Embodiment does not comprise the detailed description to traditional method; Be used for the method for carrier construction and plasmid like those, the gene of proteins encoded is inserted into the method for such carrier and plasmid or plasmid is introduced the method for host cell and classical cytogamy is screened with monoclonal antibody and the method for purifying etc.Such method is well-known for the personnel that have ordinary skill in this area, and in many publications, all describes to some extent, comprises Sambrook; J., Fritsch, E.F.and Maniais; T. (1989) Molecular Cloning:A Laboratory Manual, 2
NdEdition, Cold spring Harbor Laboratory Press.
Former, the auxiliary material of not indicating the source in the embodiment of the invention or the experimental example are commercially available.
The construction strategy of embodiment 1 bifunctional antibody
We have made up the DVD antibody of two kinds of different structures, are respectively the 1A1D variable region is series at heavy chain and light chain at two preceding antibody variable regions in preceding and 1G6 variable region constant regions (CH and CL).Mode chart is seen Fig. 1.
According to the characteristics of tetravalence DVD antibody sequence, we are with introducing 9 amino acid whose linker sequences respectively between the variable region of weight chain two strain antibodies, and its sequence is following:
The light chain heavy chain
Aminoacid sequence TVAAPSVFI ASTKGPSVF
Nucleotide sequence ACTGTAGCAGCACCTTCT GCCTCCACCAAGGGCCCA
GTCTTCATC TCGGTCTTC
The mouse source variable region sequences of monoclonal antibody 1G6 is recorded by 5 ' RACE PCR; The variable region sequences of 1A1D-2 antibody with reference to the PDB DB (PDB ID:2R69H, 2R69L) provide data synthetic by full gene, sequence is following:
1G6 weight chain variable region nucleotide sequence:
ATGGAATGGAGCTGGATATTTCTCTTTCTCCTGTCAGGAACTGCAGGTGTCCACTCTGAGGTCCAGCTGCAGCAGTCTGGACCTGAGCTGGTAAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGATACACATTCACTAACTATTTTTTACACTGGGTAAAACAGAAGCCTGGGCAGGGCCTTGAGTGGATTGGATATATTAATCCTTACAATGATGGTACTAAATACAATGAGAAGTTCAAAGGCAAGGCCACACTGACTTCAGACCAATCCTCCAGCACAGCCTACATGGAGCTCAGCAGCCTGACCTCTGAGGACTCTGCGGTCTATTACTGTGCAAGATTCGGGACTGGGACCCTATATTATTATGCTATGGACTACTGGGGTCAAGGAATATCAGTCACCGTCTCCTCA
1G6 light chain variable region nucleotide sequence:
ATGGGCATCAAGATGGAGTTTCAGACCCAGGTCTTTGTATTCGTGTTGCTCTGGTTGTTTGGTGTTGATGGAGACATTGTGATGACCCAGTCTCAAAAATTCATGTCCACATCAGTAGGAGAGAGGGTCACCATCACCTGCAAGGCCAGTCAGAATGTAGGAATTAATGTAGCCTGGTATCAGCAGAAAGTAGGGCAGTCTCTTGAACTGCTGATCTATGGGGCATCCAAGCGGCACACTGGAGTCCCTGATCGCTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCACCAATGTGCAGTCTGAAGACATGACAAATTATTTCTGTGAGCAATATAGCAGTTATCCTCTGACGTTCGGTGGAGGCACCGAGCTGGAAATCAAACGG
1A1D-2 weight chain variable region nucleotide sequence:
AAGCTTGCCGCCACCATGGATTTTCAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATATCCAGAGGAGAGGTCCAGCTGCAACAGTCTGGAGCTGAACTGGTGAAGCCTGGGGCTTCAGTGAAATTATCCTGCACCGCCTCTGGCTTCAACATTAAAGATACCTACATGCACTGGGTGAAGCAGCGCCCTGAGCAGGGCCTTGAGTGGATTGGACGCATTGATCCTGCCAATGGTTACAGCAAGTACGATCCTAAGTTCCAGGGCAAGGCCACAATTACTGCCGACACCTCCTCCAACGCCGCCTACCTGCAGCTCTCCAGCCTGACATCTGAAGATACCGCAGTCTATTTCTGTGCCCGGGACTACGAGGGCTTCGCCTACTGGGGTCAAGGAACCCTGGTCACCGTCTCCTCAGCTAGC
1A1D-2 light chain variable region nucleotide sequence:
AAGCTTGCCGCCACCATGGATTTTCAGGTGCAGATTTTCAGCTTCCTGCTAATCAGTGCCTCAGTCATAATATCCAGAGGAGACATTGTGCTGACCCAGTCTCCTGCTTCTCTGGCAGTGTCACTGGGTCAGCGTGCAACCATCTCTTGCCGTGCCAGTGAATCTGTTGTGCGTTACGGCAACTCTTTCATGCACTGGTATCAACAGAAACCAGGACAACCACCTAAACTACTGATATACCGTGCATCCTCTCTGGAATCTGGCATCCCTACTCGCTTCAGCGGCAGTGGATCTCGTACAGATTTCACTCTCACCATCAATCCAGTGGAAGCAGACGATGTGGCAACCTATTATTGCCAGCAAACCAACGTTGACCCATGGGCATTCGGAGGGGGGACCAAGCTGGAAATAAAACGGACTGTGGCTGCACCATCTGT
According to above variable region sequences, design overlap PCR primer is following:
1A1D-1G6-P1H：cccAAGCTTGCCGCCACCATGG
1A1D-1G6-P2H：GAAGACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGG
1A1D-1G6-P3H：CCAAGGGCCCATCGGTCTTCGAGGTCCAGCTGCAGCAGT
1A1D-1G6-P4H：ctaGCTAGCTGAGGAGACGGTGACTGATA
1A1D-1G6-P1L：cccAAGCTTGCCGCCACCATGG
1A1D-1G6-P2L：GATGAAGACAGAAGGTGCTGCTACAGTCCGTTTTATTTCCAGCTTGG
1A1D-1G6-P3L：CAGCACCTTCTGTCTTCATCGACATTGTGATGACCCAGT
1A1D-1G6-P4L：ccgGAATTCTCAACACTCTCCCCTGTTGAAGCTCT
1G6-1A1D-P1H：CCCAAGCTTGCCGCCACCATGGAA
1G6-1A1D-P2H：GAAGACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACTGATA
1G6-1A1D-P3H：CCAAGGGCCCATCGGTCTTCGAGGTCCAGCTGCAACAGTC
1G6-1A1D-P4H：GCTAGCTGAGGAGACGGTGACC
1G6-1A1D-P1L：CCCAAGCTTGCCGCCACCATGGGCA
1G6-1A1D-P2L：GATGAAGACAGAAGGTGCTGCTACAGTCCGTTTGATTTCCAGCTCG
1G6-1A1D-P3L：CAGCACCTTCTGTCTTCATCGACATTGTGCTGACCCAGTC
1G6-1A1D-P4L：ccgGAATTCTCAACACTCTCCCCTGTTGAAGCTCT
At first with increase the respectively variable region, front and back of DVD antibody of P1, P2 and P3, P4 primer, then the front and back fragment is carried out overlap PCR, the result sees Fig. 2.Respectively weight chain purpose fragment is reclaimed; Directly be connected into expression vector pcDNA3.1 (+) behind the double digestion through identical double digestion; Picking mono-clonal enzyme is cut and is identified the positive colony (see figure 3), and the expression plasmid that finally contains correct sequence with the order-checking picking carries out the cotransfection Chinese hamster ovary celI.
The expression of 2 two kinds of different structure DVD of embodiment antibody, purifying and avidity are measured
With the sequence of embodiment 1 gained correct contain the right Chinese hamster ovary celI of the DVD antibody weight pulsating pcDNA3.1 of chain gene (+) plasmid corotation after; The single clone of picking surely changes cell strain; Select to collect the expression supernatant after a large amount of serum-free culture of high expression level mono-clonal, through anti-Protein A affinity chromatography column purification.SDS-PAGE shows that the molecular weight size is consistent with expection.With different serotypes dengue virus E D3 albumen wrapper sheet, ELISA detects the avidity of DVD antibody.The result sees Fig. 4.The result shows that DVD1A1D-1G6 can keep the antigen-binding activity of two strain antibody variable regions better than DVD1G6-1A1D.
The difunctional combination determination of activity of embodiment 3DVD1A1D-1G6
Experimental example 1 is to the immunofluorescence assay of four kinds of serotype dengue viruss
The preparation of experimental example 1-1 virus antigen sheet
We will step on leather 1,2,3,4 C-type virus Cs, and (wherein the dengue 1-type virus strain is called DENV1 128, and GENEBANK number is FJ176780; The dengue 2-type virus strain is called DENV2 43, and GENEBANK number is AF204178; The dengue 3 virus strain is called DENV3 80-2, and GENEBANK number is AF317645; The 4-type dengue virus strain is called DENV4 B5, and GENEBANK number is AF289029).The suspension of above virus strain is inoculated individual layer BHK-21 cell respectively, cultivates after 3-7 days for 37 ℃ the cell dissociation of virus infection is processed cell suspension; It is added drop-wise in the plated film Cell sheet glass hole of handling well, puts into the wet mid-37 ℃ of cultivations of box and make cell attachment; Rinse not adherent suspension cell with the PBS damping fluid; Room temperature is dried and is put into precooling acetone behind the slide and fix; Dry the virus antigen sheet that slide promptly obtains stepping on leather 1,3,4 C-type virus Cs, japanese encephalitis virus, west nile virus, yellow fever virus and fores encephalitis virus ,-20 ℃ of sealings are preserved.
Experimental example 1-2. indirect immunofluorescence experiment
1G6,1A1D and DVD1A1D-1G6 monoclonal antibody are added in the antigen film perforation of different dengue virus preparations, put into the mid-37 ℃ of effect 60min of wet box, the virus antigen sheet is with PBS damping fluid vibration washing 5min then, and room temperature is dried.On the virus antigen sheet, add with two of fluorescein isothiocyanate (FITC) mark of 200 times of dilutions of the blue solution of 0.02% ivens and resist (middle China fir Golden Bridge Company products); Place 37 ℃ of effect 30min in the wet box; Then with PBS damping fluid vibration washing 5min; Room temperature is dried, observations under the fluorescent microscope.Experimental result is seen Fig. 6.The result shows, 1A1D antibody can with step on the cross reaction of leather 1-3 C-type virus C; The 1G6 antibodies specific combines 4-type dengue virus; DVD1A1D-1G6 can be simultaneously with step on the cross reaction of leather 1-4 C-type virus C.
The immunoblotting of experimental example 2DVD1A1D-1G6 detects
To step on leather 1-4 C-type virus C ED3 district albumen through the 10%SDS-PAGE electrophoresis, albumen on the glue will be transferred on the nitrocellulose filter.The TBST damping fluid that contains 10% skim-milk after 4 ℃ of sealings are spent the night, adds the monoclonal antibody and the bifunctional antibody of suitable concn, and incubated at room 1h washes film 3 times with the TBST damping fluid, each 10min.The goat anti-human igg (1: 4000) who adds the HRP mark, incubated at room 1h, similarity condition is washed film.Last chemoluminescence method film colour developing.The result sees Fig. 7.Show the ED3 protein binding that DVD1A1D-1G6 can be viral with four kinds of serotypes.
Experimental example 3 different serotypes dengue virus E D3 are with DVD1A1D-1G6 bonded competitive ELISA
Whether can combine two kinds of not synantigens simultaneously for detecting DVD1A1D-1G6 antibody; At first the DVD antibody of an amount of concentration being hatched in 37 ℃ with the different serotypes ED3 albumen of 100 μ g/ml respectively makes it fully combine; Join then in the elisa plate that another kind of albumen encapsulates, detect and combining a kind of antigenic while whether can also combine with another kind of antigen.The result sees Fig. 8.The result shows, DVD1A1D-1G6 combine to step on the leather 1-3 proteic while of C-type virus C ED3 still can with 4-type dengue virus ED3 protein binding, can be to the combination of the 4-type dengue virus ED3 inhibition of competing; Otherwise, at first combined the proteic DVD1A1D-1G6 of 4-type dengue virus ED3 still can with step on leather 1-3 C-type virus C ED3 protein binding, explain that DVD1A1D-1G6 has possessed and combines two kinds of antigenic abilities simultaneously.
The extracorporeal neutralizing activity of embodiment 4DVD1A1D-1G6 is measured
At first we with the dilution bivalent antibody 1G6 of difference, 1A1D and tetravalence DVD1A1D-1G6 antibody with contain 100PFU/ml (plaque forming unit, plague-forming unit) step on leather 1-4 C-type virus C balanced mix, 37 ℃ of water-bath effect 1h.The antibody and the viral mixed solution of above-mentioned preparation are added the BHK-21 monolayer that is incubated at 6 orifice plates respectively, 37 ℃ of absorption 1h.Abandon after the mixed solution every hole and add the 2 * DMEM that contains 1% agarose and keep liquid, 37 ℃ are continued to cultivate 5-7 days.With formaldehyde fixed cell 1h, abandon Qiong Gai, with the PBS buffer solution for cleaning for several times, use violet staining 30min then, PBS cleans back counting plaque number, and the neutralization index of calculating antibody.The result sees Fig. 9.The result shows, two strain antibodies are built into bifunctional antibody after, its extracorporeal neutralizing activity to four kinds of serotype dengue viruss is unaffected fully, explains that its two variable regions are separate, on totivirus, can not produce sterically hindered influence.
In in the body of embodiment 5DVD1A1D-1G6 and determination of activity
The interior neutralization of body that utilizes the suckling mouse encephalic to attack malicious model detection antibody is tired.Specifically, with different concns monoclonal antibody and 10
4The dengue virus equivalent mixing of PFU/ml is hatched 1h for 37 ℃.Antiviral antibody mixed solution encephalic is inoculated 1 age in days Kunming kind suckling mouse, every about 30 μ l, each concentration is inoculated 1 nest (9-12 is only).Observe every day and morbidity of record suckling mouse and death condition, observed for 3 weeks altogether, calculate the mouse survival rate.The result sees Figure 10.The result shows; Do not add positive controls suckling mouse death of all falling ill in 7-14 days behind virus infection of monoclonal antibody; Similar nervous symptoms also appears although add the experimental group suckling mouse of lower concentration monoclonal antibody; But their death time obviously postpones, and along with the continuous increase of AC, the suckling mouse survival rate significantly improves.Utilization log-rank method is carried out statistical study, shows that DVD1A1D-1G6 has the ability of four kinds of serotype dengue viruss of neutralization, and has identical respectively to neutralising capacity in the body of different serotypes dengue virus with bivalent antibody.
Claims (4)
1. anti-four kinds of serotype dengue virus bifunctional antibodies are DVD antibody, it is characterized in that the 1A1D variable region is series at the constant region of heavy chain and light chain at two preceding antibody variable regions in preceding and 1G6 variable region.
2. described anti-four kinds of serotype dengue virus bifunctional antibodies of claim 1; It is characterized in that introducing 9 amino acid whose link sequences respectively between the variable region of antibody; The aminoacid sequence that wherein links variable region of light chain is TVAAPSVFI, and the aminoacid sequence of link heavy chain chain variable region is ASTKGPSVF.
3. the preparing methods of claim 1 or 2 described anti-four kinds of serotype dengue virus bifunctional antibodies; The variable region sequences that comprises biotechnology clone 1A1D and 1G6 antibody; And the mode through merging PCR is carried out front and back connection with the variable region sequences of antibody through suitable sequence; Make up the weight chain expression vector respectively, the screening of cotransfection Chinese hamster ovary celI obtains the cell strain of stably express antibody, and expression cell line prepares.
4. claim 1 or the purposes of 2 described anti-four kinds of serotype dengue virus bifunctional antibodies in preparation anti-dengue virus infection medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101057287A CN102757498A (en) | 2011-04-26 | 2011-04-26 | Bifunctional antibody for resisting four serotype dengue viruses and application thereof in preparation of drugs for resisting dengue virus infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101057287A CN102757498A (en) | 2011-04-26 | 2011-04-26 | Bifunctional antibody for resisting four serotype dengue viruses and application thereof in preparation of drugs for resisting dengue virus infection |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102757498A true CN102757498A (en) | 2012-10-31 |
Family
ID=47052177
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011101057287A Pending CN102757498A (en) | 2011-04-26 | 2011-04-26 | Bifunctional antibody for resisting four serotype dengue viruses and application thereof in preparation of drugs for resisting dengue virus infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102757498A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110590943A (en) * | 2018-06-12 | 2019-12-20 | 赖思佳 | Anti-dengue virus antibody and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010065882A1 (en) * | 2008-12-04 | 2010-06-10 | Abbott Laboratories | Dual variable domain immunoglobulins and uses thereof |
-
2011
- 2011-04-26 CN CN2011101057287A patent/CN102757498A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010065882A1 (en) * | 2008-12-04 | 2010-06-10 | Abbott Laboratories | Dual variable domain immunoglobulins and uses thereof |
Non-Patent Citations (1)
| Title |
|---|
| SHEE-MEI LOK等: "Binding of a neutralizing antibody to dengue virus alters the arrangement of surface glycoproteins", 《 NATURE STRUCTURAL & MOLECULAR BIOLOGY》, vol. 15, no. 3, 31 March 2008 (2008-03-31), XP055112355, DOI: 10.1038/nsmb.1382 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110590943A (en) * | 2018-06-12 | 2019-12-20 | 赖思佳 | Anti-dengue virus antibody and application thereof |
| CN110590943B (en) * | 2018-06-12 | 2022-11-25 | 赖思佳 | Anti-dengue virus antibody and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Halstead | Dengue and dengue hemorrhagic fever | |
| Laureti et al. | Flavivirus receptors: diversity, identity, and cell entry | |
| Guabiraba et al. | Dengue virus infection: current concepts in immune mechanisms and lessons from murine models | |
| Zellweger et al. | Enhanced infection of liver sinusoidal endothelial cells in a mouse model of antibody-induced severe dengue disease | |
| ES2476416T3 (en) | Composition of intravenous immunoglobulin | |
| Ludwig-Begall et al. | Noroviruses—the state of the art, nearly fifty years after their initial discovery | |
| Wan et al. | Protection against dengue virus infection in mice by administration of antibodies against modified nonstructural protein 1 | |
| Cabrera-Romo et al. | Experimental inoculation of Artibeus jamaicensis bats with dengue virus serotypes 1 or 4 showed no evidence of sustained replication | |
| Saiz et al. | Pathogenicity and virulence of West Nile virus revisited eight decades after its first isolation | |
| Sarwar et al. | Filovirus emergence and vaccine development: a perspective for health care practitioners in travel medicine | |
| Kentaro et al. | Genetic and biological characterization of tick-borne encephalitis virus isolated from wild rodents in southern Hokkaido, Japan in 2008 | |
| Hucke et al. | Prophylactic strategies to control chikungunya virus infection | |
| Andrade et al. | Rise and fall of vector infectivity during sequential strain displacements by mosquito‐borne dengue virus | |
| Côrtes et al. | Integrated control strategies for dengue, Zika, and Chikungunya virus infections | |
| Zhang et al. | A Review of Molecular Characterization of Classical Swine Fever Virus (CSFV). | |
| Jorge et al. | Isolation and characterization of a Brazilian strain of yellow fever virus from an epizootic outbreak in 2009 | |
| Hoffman et al. | Human acute and chronic viruses: Host-pathogen interactions and therapeutics | |
| Clark et al. | Role of microparticles in dengue virus infection and its impact on medical intervention strategies | |
| CN102757498A (en) | Bifunctional antibody for resisting four serotype dengue viruses and application thereof in preparation of drugs for resisting dengue virus infection | |
| CN105267948A (en) | Applications of hepatocyte growth factor-regulated tyropsine kinasesubstrate in preparation of medicines preventing enterovirus 71-type infection | |
| Yamanaka et al. | A simple method for evaluating dengue vaccine effectiveness in mice based on levels of viremia caused by intraperitoneal injection of infected culture cells | |
| Abdelhalim et al. | Seroprevalence of West Nile Fever & Dengue Fever Viruses in Suburban areas in Khartoum State, Sudan | |
| Patel et al. | Infectivity of three Mayaro Virus geographic isolates in human cell lines | |
| CN105288655A (en) | Application of vacuolar protein sorting 4A to preparing medicines for preventing or treating enterovirus type 71 infection | |
| Chiou et al. | Phenotypic changes in the Japanese encephalitis virus after one passage in Neuro-2a cells: generation of attenuated strains of the virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20121031 |