CN102757485A - Mutant protein of bacillus thuringiensis insecticidal crystal and application thereof - Google Patents

Abstract

The invention relates to a mutant protein of a bacillus thuringiensis (Cry1Aa) insecticidal crystal which includes the mutation of any single point selected from H168R, N372G or N372A, and relates to an application of the mutant protein. The invention relates to the mutant protein of a bacillus thuringiensis (Cry1Aa) insecticidal crystal and the application of the mutant protein in preparation of insecticide. The invention also relates to an insecticide which includes the mutant protein of a bacillus thuringiensis (Cry1Aa) insecticidal crystal based on effective dose.

Description

Bacillus thuringiensis insecticidal crystal mutain and application thereof

Technical field

The present invention relates to biochemical field, particularly a kind of bacillus thuringiensis CrylAa insecticidal crystal mutain, it comprises any simple point mutation that is selected from H168R, N372G or N372A, and their application.

Background technology

Since the sixties in 20th century, because the chemical classes agricultural chemicals is outstanding day by day to the harm of environment, and the resistance of insect sharply increases in agriculture prodn, and the biological control method of environmental protection more and more receives people's attention.

Bacillus thuringiensis (Bacillus thuringiensis; Be called for short Bt) be gram-positive microorganism; Be that one type strong to the insect virulence, the speed that causes death are fast, and, can form parasporal crystal albumen in the stable growth phase of thalline to the avirulent entomopathogen of pest natural enemy; Claim again insecticidal crystal protein (insecticidal crystal protein, ICP) or delta-endotoxin.ICP has strong toxicity by CRY gene and CYT genes encoding to sensitive insect, and to higher animal and people's nontoxicity.Bt is the maximum biotic pesticide of present turnout in the world; Be widely used in controlling the insect of multiple lepidopteran, Diptera, Coleoptera, in addition to the various pests of Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon insecticidal activity selectively.Because it is strong, environmentally friendly that Bt has specificity, to the person poultry harmless, biological degradation does not have advantages such as residual hazard, is widely used in the agriculture prodn.

Since Schnepf in 1981 and Whiteley have successfully cloned a coding Bt insecticidal crystalline gene first, up to now, 235 kinds of insecticidal crystal proteins (Crickmore et al., 2012) have been isolated.These albumen have been divided into totally 73 types of Cry1～Cry70, Cyt1, Cyt2, Cyt3 by the homology of its aminoacid sequence, and wherein the Cry1 class contains Cry1A to M, totally 14 subclass.And Cry1Aa is the gene family of Cry1Aa to Cry1Ai, and Cry1Aa contains 21 genotype, called after Cry1Aa1～Cry1Aa21 successively altogether.

Through to Cry1A; Cry2A; The three-dimensional structure of the toxin protein that Cry3A etc. are representative and the amino acid whose homology analysis of Cry insecticidal crystal protein; Find that there are 5～8 conserved regions in most of Cry albumen on primary structure, and space structure all is similar globular preteins, is made up of three typical structural domains: Domain1 is positioned at the N end of peptide chain; Be one group by 6～7 amphipathic alpha-helixs (helix) round the alpha-helix bundle that the alpha-helix of a hydrophobic core forms, participated in the perforation of cytolemma; Domain2 is positioned at the centre of peptide chain; Form by three groups of antiparallel beta sheet lamellas (sheet); Be β-triangular column and surround a leg-of-mutton hydrophobic inner core, form an antigen determining district that is similar to Tegeline in vertical 3 rings of Domain2 (loop) structure, the identification of having participated in toxin and receptor protein with combine (Wu S.; Et al., 1996; Bravo A, et al., 2005); Be positioned at the sandwich structure that the Domain3 of C end is made up of two groups of antiparallel beta sheet lamellas; Arrange with β jam volume (jelly roll) topological framework; Major function comprises the stability that keeps toxin; Prevent proteolytic enzyme contratoxin molecule excessive degradation, regulate toxin activity and with combine etc. (Jenkins J., et al., 2005) of acceptor.The difference of Domain2 between the different insecticidal crystal proteins is maximum; Especially be positioned at vertical loop part; All there is very big difference at aspects such as aminoacid sequence, length, conformations; Just because of these differences between the different insecticidal crystal proteins, Domain2 is considered to determine the specific important factor of albumen desinsection.

Site-directed mutagenesis technique has been widely used in Cry protein structure and functional study.Method through crystalline diffraction and homology modeling is further understood on the basis of insecticidal crystal protein three-dimensional structure, filters out Key residues and carries out rite-directed mutagenesis experiment and can develop the insecticidal proteins that toxicity is higher, insecticidal spectrum is wider.According to existing report, the rite-directed mutagenesis of proteic 3 structural domains of Cry can both cause the change of protein-active, and most sudden changes have reduced the effect of toxin, but also has the part sudden change to improve the proteic toxicity of Cry.As far back as 1992, Wu and Aronson found that a sudden change H168R of Cry1Ac pore-forming territory (Domain I) α 5 spirals has promoted the irreversible combination of Cry1Ac albumen, makes albumen improve 2 times (Wu D., et al., 1992) to maduca sexta toxicity; The R204A sudden change of Cry4B Domain I then possibly improve 3 times (Angsuthanasombat C., et al., 1993) with toxicity through removing proteoclastic unstable site; The loop1 of Cry3A Domain II with receptors bind in have vital role; Two kinds of multipoint mutation A1 (R345A-Y350F-Y351F) on this ring and A2 (R345A-Δ Y350-Δ Y351) can make Cry3A that the toxicity of Coleoptera Tenebrio molitor has been improved 7 times and 11 times of (Wu S. respectively; Et al., 2000); The point mutation N372A of Cry1Ab albumen domain II loop2 or N372G make albumen improve 8 times to the toxicity of gypsymoth, and the avidity of acceptor has increased by 4 times in the BBMV bubble simultaneously.And the N372A on loop 2 and loop α 8, A282G and L283S triple mutant, toxicity has improved 36 times especially, then improves 4 times than Cry1Aa toxicity.All the brush border membrane vesicle avidity with insect is high for two kinds of mutains, explains that sudden change has improved the keying action of Cry albumen and acceptor, thereby has improved the toxicity (Rajamohan F., et al., 1996) to insect.

Ecogen company has carried out a series of rite-directed mutagenesis work to it on the basis that the Cry3B model is fully studied, obtained the mutain that many toxicity increase; In (the English that patents in 2000; Et al., 2000, US Patent 6060594).The Baum of Monsanto company etc. have carried out rite-directed mutagenesis to the part site of the whole ORFs of Cry1Ca; The biological assay result of experiment shows; Cry1C R148G, Cry1C R148M, Cry1C R148L, Cry1C R148A, Cry1C R148D, Cry1C 563 (E118D-N121H-A124T), Cry1C 499 (N121H) and Cry1C579 (E118V-A124G) sudden change crystalline toxicity are all active high than wild Cry1C; This technology was in (the Baum that patents in 2004; Et al.2004, US Patent 6825006).

The killing ability of Cry1Aa in Cry1 class insecticidal crystal protein is relatively more outstanding; So also caused its widespread use in agriculture prodn; But along with resistance strengthens; The insecticidal effect of Cry1Aa obviously descends, and the rite-directed mutagenesis work of the critical sites on the Cry1Aa insecticidal crystal protein is not carried out as yet.Although the sequence homology of Cry1Ac and Cry1Aa is than higher and functional similarity; But because Bt albumen is very fast in the speed that occurring in nature produces sudden change; Recently increasing new bt albumen is identified, also has no talent at present and on these sites of Cry1Aa, carries out the research in mutational site.Therefore, the present invention is the insecticidal effect that effectively improves Cry1Aa, for the insecticidal mechanism of studying better and understand Bt method and reference is provided simultaneously.

Summary of the invention

The present invention carries out simple point mutation to the Cry1Aa insecticidal crystal protein, is respectively H168R, N372G and N372A; First the function of proteic these critical sites of Cry1Aa is studied; And mutant plasmid is successfully changed in the Bt bacterial strain and obtains stably express, after the Bt protein Preparation with sudden change, adopt the cytology method for quick; Promptly earlier with the wild-type protein damping fluid as contrast; Grope suitable proteic concentration and be used for cell experiment, and then the wild-type protein under the more same concentration conditions and mutain there be better insecticidal effect thereby identify mutain rapidly and accurately than wild-type to the deadly number of insect cell.

Therefore; The objective of the invention is to obtain the simple point mutation albumen of Cry1Aa through the method for simple point mutation; It comprises be selected from H168R, N372G or N372A any simple point mutation (promptly; Cry1Aa H168R, Cry1Aa N372G and Cry1Aa N372A), thereby acquisition improves the effective ways of the insecticidal activity of Cry1Aa.When the present invention has important use to be worth to agriculture prodn, environmentally friendly safety.

The application that the present invention also provides the mutain of above-mentioned three kinds of bacillus thuringiensis Cry1Aa insecticidal crystals to be used to prepare sterilant.

The present invention also provides a kind of sterilant, and it comprises in the mutain of above-mentioned three kinds of bacillus thuringiensis Cry1Aa insecticidal crystals of significant quantity any.

Sterilant of the present invention can be used for killing the insect of lepidopteran, Diptera, Coleoptera, also the various pests of Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon is had to have specific insecticidal activity.

Detect the simple point mutation albumen (H168R of Cry1Aa of the present invention; N372G and N372A) the experiment of insecticidal effect be clearly for a person skilled in the art, those skilled in the art can select suitable detection method that the insecticidal activity and the effect of mutain are detected.Usually; This area generally adopts biological activity determination method to detect, and is about to constructed mutant protein and is applied to hatch the examination worm with suitable concentration, detects the number of the examination worm of survival behind the cultivation appropriate time; But biological activity determination method is long general experimental period; Given this, the inventor has adopted a kind of cytology detection method, and the detailed step of this cytology detection method is described below:

1) insect cell line Sf9 (available from the hundred grace thing company that supports one's family) is cultivated in recovery, adds 1 * mycillin, and 5ml TC100 substratum (PAA company) was cultivated 3 days.

2) 3 days left and right sides cell quantities reach 10 ⁶Individual ml ^-1After carry out succeeding transfer culture, the centrifugal 5min collecting cell of 3000g (eppendorf company 5702 types) is used slow pressure-vaccum of the fresh substratum of 1ml and re-suspended cell again, is sucked into to shake up continued on the 10cm petridish that contains the 9ml fresh culture and cultivate.

3) cell quantity reaches 10 by the time ⁶Individual ml ^-1, the fresh slow re-suspended cell of TC100 substratum 12ml is used in centrifugal collection again, divides to install on cell cultures 6 orifice plates, and every hole adds 2ml.Attention shakes up, and prevents that cell from gathering group.

4) observation of cell shape and size under the microscope (10 times of eyepieces).

5) will dilute samples such as good albumen and damping fluid in advance with the membrane filtration degerming and join successively in each hole of Tissue Culture Plate, in cell culture incubator, cultivate 3h for 27 ℃.

6) hatch 3h after, centrifugal collecting cell, even with the resuspended piping and druming of 100 μ l PBS (phosphoric acid buffer), dye with the trypan blue dye liquor again, on blood counting chamber the statistics not cytochrome (viable cell) and cytochrome (dead cell) number.

7) statistics numbers and analytical results.

Description of drawings

From the detailed description below in conjunction with accompanying drawing, above-mentioned feature and advantage of the present invention will be more obvious, wherein:

Fig. 1 shows proteic molecular sieve result of Cry1Aa (Figure 1A) and SDS-PAGE electrophoresis result (Figure 1B).

Fig. 2 shows the lethal effect of the Cry1Aa albumen of different concns to insect cell line Sf9.

Fig. 3 shows that different Cry1Aa albumen are at same protein concentration (0.04mg ml ^-1) under to the lethal effect of insect cell line Sf9.

Fig. 4 shows that different Cry1Aa albumen are at same protein concentration (0.004mg ml ^-1) under to the lethal effect of insect cell Sf9.

The sequence table explanation

The aminoacid sequence of SEQ ID No.1 wild-type Cry1Aa

The aminoacid sequence of SEQ ID No.2 Cry1Aa two mutants H168R

The aminoacid sequence of SEQ ID No.3 Cry1Aa two mutants N372G

The aminoacid sequence of SEQ ID No.4 Cry1Aa two mutants N372A

Embodiment

Describe embodiments of the invention below in detail.It should be appreciated by those skilled in the art that said embodiment illustrates the present invention, and limit scope of the present invention never in any form.

Those skilled in the art be also to be understood that except as otherwise noted used reagent is commercially available other reagent of analytical pure level among the embodiment.

The extraction of embodiment 1:Cry1Aa wild-type protein

Contain the Cry1Aa gene the Bt bacterial strain (can be that material is cloned with the Bt wild type strain according to conventional molecular cloning method, cloning process can referring to Schnepf H.E.and Whiteley H. R., 1981, the Bt wild type strain is available from Chinese common micro-organisms culture presevation administrative center (strain number 1.1014)) and cultivate centrifugal receipts bacterium after the logarithmic phase, use 50mM Na ₂CO ₃-HCl (comprise 5% beta-mercaptoethanol, pH 9.5) fully suspends and precipitates, 37 ℃ of insulation 1h; Centrifugal (2850g; Whizzer is available from the Allegra X-15R of Beckman company model) 5min, go deposition (promptly removing undissolved parasporal crystal and brood cell), supernatant is the early-products of crystallin solution.The crystallin supernatant is dripped 4M NaAc-HAc (pH 4.4), about 1/20 volume, centrifugal, remove supernatant, deposition is used ddH ₂O washes 3 times, uses 50mM Na again ₂CO ₃-HCl (pH9.5) dissolves above-mentioned albumen precipitation, and centrifugal (being precipitated as a small amount of metaprotein and impurity), supernatant is soluble crystal albumen.Press trypsinase: crystallin=add trypsin solution to soluble crystal protein solution at 1: 50, handle 60min for 37 ℃.Again the solution after the enzymolysis is carried out molecular sieve purification, carry out SDS-PAGE electrophoresis detection albumen after the purifying.Fig. 1 has shown that wild-type Cry1Aa albumen carries out enzymolysis molecular sieve result and SDS-PAGE electrophoresis result afterwards, and damping fluid is 50mMNaHCO ₃, pH 10.2.

2: three kinds of Cry1Aa simple point mutations of embodiment albumen (H168R, N372G, preparation N372A)

We are in order to obtain wild-type Cry1Aa plasmid; With Plasmid137 DNA (from bacillus thuringiensis Bt1520) is template; According to the Cry1Aa sequences Design special primer sequence, primer sequence is following: upstream primer 5 '-TCCCCCGGG GTAATCGCTCGTCTATC-3 ' (adding the smalI site); Downstream primer: 5 '-ACGCGTCGAC CATATAGGGAGAATGCAGT-3 ' (adding the SalI site).

According to ordinary method, the gene amplification fragment is reclaimed, enzyme is cut, and the Cry1Aa full length gene is connected in the pHT1k carrier.Again recombinant plasmid electric shock is changed over to (Bt171 competent cell bacterial strain is explained sub-ox professor laboratory by Sheng Ke institute of Hua Zhong Agriculture University and is so kind as to give in the Bt171 competent cell; The Bt171 competent cell is by the ordinary method preparation, and concrete grammar sees 2.3 for details, can be with reference to Li Lin; Shao Zongze; Explain sub-ox. the electricimpulse method transforms research [J] the microbiology circular of bacillus thuringiensis BMB171,2000,27 (5): 331-334 (being reference 13)).In order to study the insecticidal mechanism of Cry1Aa, we utilize the method for rite-directed mutagenesis PCR to make up three clone: H168R, N372G, N372A to be template by the above-mentioned wild-type Cry1Aa plasmid that builds.What following table was listed is the used primer of rite-directed mutagenesis (table 1).

Table 1 is used to make up the primer of Cry1Aa two mutants

	Adopted primer is arranged	Antisense primer
			H168R	GCAAATTTACGTTTATCAGTTTTGAG	AACTGATAAACGTAAATTTGCAGCTT
N372A	GACCTTTTGCTATAGGGATAAATAAT	ATCCCTATAGCAAAAGGTCTTCTATA
			N372G	GACCTTTTGGTATAGGGATAAATAAT	ATCCCTATACCAAAAGGTCTTCTATA

2.1PCR rite-directed mutagenesis experiment

The principle of PCR rite-directed mutagenesis is to be template with the plasmid that is connected with wild-type CRYIAa gene fragment, lets the archaeal dna polymerase be initial with mutant primer, and ring-like amplification one circle obtains a shape material grain that contains sudden change.Because plasmid is generally bigger, the time that amplification needs is long, and enzyme activity can constantly descend, and is more prone to cause sudden change, so select the active archaeal dna polymerase of long time-histories: LA-taq (available from Takara company) for use.

Reaction system is (25 μ l) as follows:

Reaction conditions is following:

Reaction is gone test sample with the method for agarose gel electrophoresis after finishing, and the Cry1Aa template plasmid with respective concentration during application of sample is done a contrast.Be significantly higher than control sample if observe the brightness of amplification sample, then prove the pcr amplification success.

2.2PCR the recovery of product

The product that PCR obtains reclaims with PCR cleaning agents box after finishing with the agarose gel electrophoresis detection.If what reclaim is the product of plasmid rite-directed mutagenesis,, must select the adsorption column in the plasmid a small amount of extraction agent box to replace the adsorption column in the former PCR cleaning agents box (Axygen company) because molecular weight is very big.Concrete operations are following:

(1) (the PCR-A liquor capacity that adds if desired is less than 100 μ l in sample to be recycled, to add the PCR-A solution of three times of sample volumes; Then add 100 μ l); With being added drop-wise in the adsorption column behind the gentle mixing of solution; Centrifugal 30 seconds of 12000g abandons the liquid in the collection tube, and adsorption column is put back in the collection tube.

(2) in adsorption column, add the 70% alcoholic acid W2 solution that contains of 700 μ l, centrifugal 30 seconds of 12000g abandons waste liquid, and adsorption column is put back in the collection tube.

(3) repeating step (2), but only add the W2 solution of 500 μ l.

(4) 12000g is centrifugal 2 minutes, removes as far as possible and remains in the W2 solution on the adsorption column.

(5) adsorption column is put into a clean centrifuge tube, in super clean bench, dry up residual ethanol.Afterwards again toward the sterilization ddH of adsorption film central position Dropwise 50 μ l ₂O leaves standstill 2 minutes so that nucleic acid fully dissolves, and 12000g collected nucleic acid solution in centrifugal 2 minutes.

The sample of plasmid rite-directed mutagenesis is after reclaiming; The inside exists annular wild plasmid and linear mutant plasmid simultaneously, if these two kinds of plasmids are simultaneously as transforming, because the transformation efficiency of shape material grain is very low; The clone who chooses at last will be the clone of wild-type all, cause the failure of an experiment.So before conversion, must do a step is exactly the wild plasmid template of degrading.Wild plasmid extracts from intestinal bacteria; The nucleic acid modification that methylated; And the mutant plasmid that amplifies is not methylate to modify, therefore select for use can single-minded degraded methylate DNA enzyme DpnI (available from Promega company) carry out enzyme and cut reclaiming product.Reaction system is (50 μ l) as follows:

Behind the above composition mixing, place 37 ℃ of water-baths 6 hours, get half the enzyme and cut product conversion Top10 competent cell, the flat board of coating kalamycin resistance screens, and remaining is half the frozen subsequent use to do in-40 ℃.

2.3 the electric shock of mutant protein transforms

1. the activation of recipient bacterium.F-strain Bt71 to be transformed rules on LB (Luria-Bertani) agar plate, makes it form typical single bacterium colony in 30 ℃ of incubated overnight.

2. the cultivation of thalline.Get the isolating recipient bacterium of line single bacterium colony a little transfer in the LB liquid nutrient medium, put 30 ℃, 200rpm shaking culture to logarithm early stage (this moment nutrient solution OD ₆₅₀Be about 0.1～0.2).

3. the preparation of competent cell.With cultured bacterium liquid at ice bath on ice after 10 minutes; (whizzer was available from Beckman company in centrifugal 5 minutes with 2850g with the 50ml centrifuge tube; Allegra X-15R model) collects thalline; Use SG damping fluid centrifuge washing thalline 4 times more respectively, with 200 μ l SG damping fluid suspension thalline, be competent cell then.

4. electricity transforms.Get 200 μ l competent cells and transform in the cup in 0.4cm electricity, add donor plasmid 10 μ l after placing 10 minutes on ice, after blotting electricity and transform cup outer wall moisture with thieving paper, conversion processing shocks by electricity to the electroporation apparatus.Replace donor plasmid as negative control with sterilized water, handle equally.Shock parameters can adopt: 25 μ F (electric capacity), 200 Ω (resistance), 25kV (voltage), the burst length of 1 electroporation this moment is 4.6ms.Usually adopt 1 electricimpulse to get final product.

5. recover to cultivate.Behind the electricimpulse, add 1ml LB nutrient solution rapidly and transform in the cup in electricity, and mixing gently, be transferred to then in the aseptic test tube, tilt to be positioned in 30 ℃ of shaking tables, with 160rpm shaking culture 2h.

6. be coated with resistant panel.The bacterium liquid 200 μ l that recover to cultivate are carried out gradient dilution; And be coated with corresponding resistant panel in 30 ℃ of cultivations; When treating on the resistant panel to occur tangible transformant bacterium colony (should asepticly drop out existing on the negative control), transfer the transformant bacterium colony on a new resistant panel and be cultured to bacterium colony formation with aseptic toothpick.

7. the checking of transformant.Usually can reach aspects such as antibiotic characteristic are verified from the transformant plasmid is big or small, certain enzyme cut, microscopy thalli morphology or crystal formation.

2.4 the extraction of mutant protein

Method adopts the process for extracting of embodiment 1 wild-type protein.

Embodiment 3: grope suitable protein concentration, set up the cytology detection architecture

At first need confirm suitable protein concentration; Fig. 3 has shown under the comfortable different concns of Cry1Aa egg the lethal effect to insect cell line Sf9; Specific practice is following: carry out test cell line respectively after Cry1Aa protein concentration (4mg/ml) is diluted 10 times, 100 times, 1000 times and 10000 times; Simultaneously with proteolytic damping fluid as blank (control), the result shows that with 100 times, 1000 times concentration as the reference protein of test testing protein of Cry1Aa protein concentration (4mg/ml) dilution be comparatively suitable.

The cytologic experiment result of embodiment 4:Cry1Aa mutain functional verification

Different mutational sites influence result such as Fig. 4, shown in Figure 5 to the insecticidal activity of Cry1Aa, and wherein Fig. 4 is presented at 0.04mg ml ^-1Under the concentration; The different mutains of Cry1Aa are to the lethal effect of insect cell line Sf9; Wherein damping fluid group and Cry1Aa wild-type group have significant difference (P=0.00011) on 0.05 level, damping fluid group and 3 two mutants groups (H168R, N372A; N372G) significant difference (being respectively P=0, P=0.00004 and P=0) is all arranged on 0.05 level; (H168R N372G) also presents significant difference and (is respectively P=0, P=0.00114) on 0.05 level for Cry1Aa wild-type group and 2 two mutants groups; And Cry1Aa wild-type group and single mutation N372A group difference are not remarkable.Fig. 5 is presented at 0.004mg ml ^-1Under the protein concentration; Different Cry1Aa mutains are to the lethal effect of insect cell line Sf9; Wherein damping fluid group and Cry1Aa wild-type group have significant difference (P=0.02774) on 0.05 level, damping fluid group and 3 two mutants groups (H168R, N372A; N372G) significant difference (being respectively P=0.00002, P=0.00010 and P=0.00065) is all arranged on 0.05 level; (H168R, N372A N372G) also present significant difference (respectively at P=0.00001, P=0.00009 and P=0.00195) on 0.05 level for Cry1Aa wild-type group and 3 two mutants groups.

The result of Fig. 4 and Fig. 5 has supported these mutain comparisons according to wild-type protein stronger insecticidal effect, particularly H168R and these 2 locational simple point mutations of N372G to be arranged consumingly.Under these 2 low concentration conditions; The trend of the insecticidal function of these mutains is still coincide each other; All be obviously to be better than reference protein, can draw that these simple point mutation albumen still can have the ability of killing preferably to insect cell under low concentration through these 2 results.

Comprehensive above presentation of results: (sudden change N372G) can obviously improve its deadly ability to insect cell to Cry1Aa for H168R, N372A, is one of a kind of feasible approach that improves insecticidal crystal protein Cry1Aa insecticidal activity on special site.

Should be appreciated that; Although with reference to its exemplary embodiment; The present invention is shown particularly and describe, but will be understood by those skilled in the art that, under the condition that does not deviate from by the defined the spirit and scope of the present invention of accompanying Claim; The variation of various forms and details can be carried out therein, the arbitrary combination of various embodiments can be carried out.

Reference:

1.Saxena?D.，Stotzky?G.，Bacillus?thuringiensis(Bt)toxin?released?from?root?exudates?and?biomass?of?Bt?corn?has?no?apparent?effect?on?earthworms，nematodes，protozoa，bacteria，and?fungi?in?soil[J].Soil?Biology?&?Biochemistry，2001，33(9)：1225-1230.

2.Crickmore?N.，Zeigler?D.R.，Schnepf?E.，Van?Rie?J.，Lereclus?D.，Baum?J.，Bravo?A.and?Dean?D.H.，″Bacillus?thuringiensis?toxin?nomenclature″(2012)http://www.lifesci.sussex.ac.uk/Home/Neil_Crickmore/Bt/.

3.Wu?S.J，Dean?D.H.，Functional?significance?of?loops?in?the?receptor?binding?domain?of?Bacillus?thuringiensis?CryIIIAδ-endotoxin[J].J?Mol?Biol，1996，255：628-640.

4.Bravo?A.，Gill?S.S.，Soberón，M.，Bacillus?thuringiensis?Mechanisms?and?Use[M]Gilbert，L.I.，Iatrou，K.，and?Gill，S.S.(Eds)，Comprehensive?Molecular?Insect?Science，2005，6：175-206.

5.Vachon?V.，Prfontaine?G.，Coux?F.，Role?ofhelix?3?in?pore?formation?by?the?Bacillus?thuringiensis?toxin?Cry1Aa[J].Biochemistry，2002，41(19)：6178-6184.

6.Wu?D.，and?Aronson?A.I.，Localized?mutagenesis?defines?regiohs?of?the?Bacillus?thuringiensis?d-endotoxin?involved?in?toxicity?and?specificity[J]J.Biol.Chem.1992，267：2311-2317.

7.Angsuthanasombat?C.，Crickmore?N.，and?Ellar?D.J.，Effects?on?toxicity?of?eliminating?a?cleavage?site?in?a?predicted?interhelical?loop?in?Bacillus?thuringiensis?CryIVB?delta?endotoxin[J].FEMS?Microbiol.Letter，1993，111：255-261.

8.Wu?S.J.，Koller?C.N.，Miller?D.L.Enhanced?toxicity?of?Bacillus?thuringiensis?Cry3A?delta-endotoxin?in?coleopterans?by?mutagenesis?in?a?receptor?binding?loop[J].FEBS?Letter，2000，473(2)：227-32.

9.Rajamohan?F.，Alzate?O.，Cotrill?J.A.，Protein?engineering?of?Bacillus?thuringiensis?δ-endotoxin：mutations?at?domain?II?of?Cry1Ab?enhance?receptor?affinity?and?toxicity?towards?gypsy?moth?larvae[J].Proc?Natl?Acad?Sci?USA，1996，93：14338-14343.

10.Baum.，et?al.Nucleic?acid?and?polypep?tide?compositions?encoding?lepidopteran-toxic?polypep?tides[P].US?Patent?6825006；2004，Monsanto?Company，St.Louis，MO(US).

11.English.，et?al.，Nucleic?acid?segments?encodingmodified?B?acillus?thuringiensis?coleopteran-toxic?crystal?proteins[P].US?Patent?6060594，2000，Ecogen，Inc.Langhorne，PA(US).

12.Schnepf?H.E.and?Whiteley?H.R.Cloning?and?expression?of?the?Bacillus?thuringiensis?crystal?protein?gene?in?Escherichia?coli[J]Proc?Natl?Acad?Sci，USA.1981May；78(5)：2893-2897.

13. Li Lin, Shao Zongze explains sub-ox. the electricimpulse method transforms research [J] the microbiology circular of bacillus thuringiensis BMB171,2000,27 (5): 331-334.

Claims (5)

1. the mutain of a bacillus thuringiensis Cry1Aa insecticidal crystal, it comprises any unit point sudden change that is selected from H168R, N372G or N372A.

2. the mutain of the bacillus thuringiensis Cry1Aa insecticidal crystal described in the claim 1 application that is used to prepare sterilant.

3. sterilant, it comprises the mutain of the bacillus thuringiensis Cry1Aa insecticidal crystal described in the claim 1 of significant quantity.

4. the sterilant of claim 3, it is used to kill the insect of lepidopteran, Diptera, Coleoptera.

5. the sterilant of claim 3, it is also to the various pests of Hymenoptera, Homoptera, Orthoptera, Mallophaga and plant pathogeny line insect, mite class, protozoon insecticidal activity selectively.

Images