CN102732626A - Alicyclobacillus acidoterrestris detection kit and its detection method - Google Patents

Abstract

The invention relates to a biological detection kit, and concretely relates to an Alicyclobacillus acidoterrestris detection kit and its detection method. The Alicyclobacillus acidoterrestris detection kit and the Alicyclobacillus acidoterrestris detection method provided in the invention have the advantages of rapidness, strong specificity and low cost. The Alicyclobacillus acidoterrestris detection kit comprises a loop-mediated isothermal amplification reaction solution, a Bst DNA polymerase and a developer. The Alicyclobacillus acidoterrestris detection method which uses the Alicyclobacillus acidoterrestris detection kit concretely comprises the steps of bacterial DNA extraction, loop-mediated isothermal amplification, and developing detection. Four specially-designed primers and the Bst DNA polymerase having the strand displacement activity are utilized to specifically, efficiently and rapidly amplify DNA at a constant temperature, so 10<9> target sequence copies can be reached within 1h, and the amplification effect can be observed through a fluorescent dye.

Description

Sour soil ring grease genus bacillus detection kit and detection method thereof

Technical field

The present invention relates to biological detection reagent kit, especially relate to a kind of sour soil ring grease genus bacillus detection kit and detection method thereof that adopts loop-mediated isothermal amplification technique.

Background technology

Sour soil ring grease genus bacillus (Alicyclobacillus acidoterrestris) be a kind of thermophilic, have a liking for acid, aerobic bacillus; Be thermoduric bacteria (thermo-acidophilic bacteria; TAB) pollute the main bacteria seed of fruit juice in, its gemma can stand the pasteurize in the acidic juice processing and survive, and under suitable temperature, can breed in a large number; Cause fruit juice sense organ quality deterioration; Thermoduric bacteria exceed standard be one of the most serious quality problems of fruit juice concentrate product (Hu Yichun, the high mountain goes out profit, Yuan Yahong etc. harm of alicyclic acid genus bacillus in the fruit juice (Alicyclobacillus spp.) and control [J] thereof. Food science; 2008,29 (1): 364-368).In recent years, China's concentrated Succus Mali pumilae industry has obtained the progress of advancing by leaps and bounds, and the production that China in 2010 has become world's AJC exports first state.China's outlet 1～November in 2011 concentrated Succus Mali pumilae quantity is 54.13 ten thousand tons, and the amount of money is 9.36 hundred million dollars (http://www.21food.cn/html/news/35/666252.htm (food commerce Nets)).At present, in the international trade thermoduric bacteria in the fruit juice being had strict demand, is the essential items for inspection of AJC, also is problem anxious to be solved during one of major technique barrier of being met with in the outlet of current Chinese apple juice concentrate is produced with AJC.At present; The method that detects sour soil ring grease genus bacillus mainly contains traditional mikrobe Physiology and biochemistry detection method and molecular biological PCR method (Kong Deyi; Dong Jia, Bai Xiaoqiong. the progress of alicyclic acid genus bacillus [J]. grain and foodstuffs industry, 2011; 18 (2): 39-42), do not see the report that detects sour soil ring grease genus bacillus with the ring mediated isothermal amplification amplification technique as yet.

Summary of the invention

The purpose of this invention is to provide a kind of fast, high specificity and the low sour soil ring grease genus bacillus detection kit of cost.

Another object of the present invention provides a kind of method that detects sour soil ring grease genus bacillus.

Said sour soil ring grease genus bacillus detection kit comprises:

1) loop-mediated isothermal amplification liquid;

Said loop-mediated isothermal amplification liquid contains 10 * Thermopol reaction buffer, 10mmol/L dNTP, 50mmol/L sal epsom, 20 μ mol/L sour soil ring grease genus bacillus upper reaches inner primers, 20 μ mol/L sour soil ring grease genus bacillus downstream inner primers, 20 μ mol/L sour soil ring grease genus bacillus upper reaches outer primers, 20 μ mol/L sour soil ring grease genus bacillus downstream outer primers;

Sour soil ring grease genus bacillus upper reaches outer primer F3:

CGGGTAGGCATCTACTTGTG；

Sour soil ring grease genus bacillus downstream outer primer B3:

GCGGAAGATTCCCTACTGC；

Sour soil ring grease genus bacillus upper reaches inner primer FIP:

GCCGTTACCTCACCAACTAGCTGAAAGATGCAACTGCATCGC；

Sour soil ring grease genus bacillus downstream inner primer BIP:

GATGCGTAGCCGACCTGAGAGTGCCTCCCGTAGGAGTCT；

2) Bst archaeal dna polymerase: contain 8 activity units (U)/μ l;

3) developer: SYBR GREEN I optical dye, 1000 *;

The method of said detection sour soil ring grease genus bacillus is used said sour soil ring grease genus bacillus detection kit, said method comprising the steps of:

1) extraction of DNA of bacteria:

2) ring mediated isothermal amplification;

3) color developing detection.

Cardinal principle of the present invention is to utilize the primer of 4 particular design and have the active Bst archaeal dna polymerase of strand displacement, special under constant temperature, efficiently, DNA amplification apace, in 1h, can reach 10 ⁹The target sequence copy can be observed expanding effect through optical dye.

Advantage of the present invention is following:

The present invention adopt ring mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP) technology has been set up loop-mediated isothermal amplification detection kit and the detection method of sour soil ring grease genus bacillus, this technological high specificity; With PCR method identical sensitivity is arranged; But do not need expensive PCR appearance or quantitative real time PCR Instrument, only need common water-bath to get final product, and the result needn't check with gel electrophoresis method; Adding the optical dye visual observations gets final product; Without gel imaging system, fast simple, be particularly suitable for food inspection mechanism of basic unit and food processing enterprises self check.

(Loop-mediated isothermal amplification, LAMP) method detects sour soil ring grease genus bacillus, for the food safety monitoring provides new scientific basis to adopt ring mediated isothermal amplification.

Embodiment

The following example is further to explanation of the present invention, the restriction of the present invention of should not opposing.

Embodiment 1, preparation sour soil ring grease genus bacillus detection kit:

(1) loop-mediated isothermal amplification liquid:

Contain 10 * Thermopol reaction buffer, 10mmol/L dNTPs, 50mmol/L sal epsom, 5mol/L trimethyl-glycine, 20 μ mol/L sour soil ring grease genus bacillus upper reaches inner primers, 20 μ mol/L sour soil ring grease genus bacillus downstream inner primers, 20 μ mol/L sour soil ring grease genus bacillus upper reaches outer primers, 20 μ mol/L sour soil ring grease genus bacillus downstream outer primers;

(2) Bst archaeal dna polymerase: concentration 8U/ μ l;

(3) developer: SYBR GREEN I optical dye, 1000 *.

Like needs, can loop-mediated isothermal amplification liquid, Bst archaeal dna polymerase and developer be packed in the box body after the preparation.

The application of embodiment 2, sour soil ring grease genus bacillus detection kit:

(1) pre-treatment of test sample---extract the DNA gene by ordinary method:

A gets the bacterium liquid of 1.0～1.5mL incubated overnight, places the 1.5mL centrifuge tube, with the centrifugal 5min of whizzer 10000rpm, abandons supernatant;

B adds 1.0mL sterilization distilled water, mixing, and the centrifugal 5min of 10000rpm abandons supernatant;

C adds 100 μ L sterilization distilled water, mixing, 100 ℃ of boiling water bath 10min;

The centrifugal 5min of D 10000rpm gets in supernatant to the new 1.5mL centrifuge tube, and this supernatant is DNA of bacteria to be checked.

(2) test kit with invention detects---ring mediated isothermal amplification

A sour soil ring grease genus bacillus LAMP reaction system: as shown in table 1.

Table 1 sour soil ring grease genus bacillus LAMP reaction system

Component	Working fluid concentration	Application of sample amount (μ L)	The reaction system final concentration
				The ThermoPol damping fluid	10×	5.0	1×
Outer primer F3	20μmol/L	0.5	0.2μmol/L
				Outer primer B3	20μmol/L	0.5	0.2μmol/L
Inner primer FIP	20μmol/L	2.0	0.8μmol/L
				Inner primer BIP	20μmol/L	2.0	0.8μmol/L
dNTPs	10mmol/L	8.0	1.6mmol/L
				Sal epsom	50mmol/L	2.0	2.0mmol/L
Trimethyl-glycine	5mol/L	8.0	0.8mol/L
				The Bst archaeal dna polymerase	8U/μl	1	0.16U/μl
Dna profiling	-	2	-
				Deionized water	-	19	-

The B reaction process:

Press the said preparation reaction system of table 1,60～65 ℃ of water bath with thermostatic control 1h.

The each reaction of C should be provided with negative control, blank and positive control.

Blank is made as with sterilized water and substitutes dna profiling.

Negative control replaces template DNA with the TE damping fluid.

Positive control preparation: sour soil ring grease genus bacillus reference culture is inoculated in YSG liquid nutrient medium (yeast extract paste 2g, glucose 1g, Zulkovsky starch 2g; Be dissolved in the 1L zero(ppm) water; Using 1-2N sulfuric acid or hydrochloric acid to regulate pH is 3.7 ± 0.1, and is sub-packed in the triangular flask, 121 ℃ of sterilization 15min; Cooling) 45 ℃ ± 1 ℃ overnight cultures in is diluted to about 10 with SPSS ⁶CFU/mL～10 ⁸CFU/mL (Maxwell turbidity 0.4 approximately) presses embodiment 2 (1) and extracts the template of template DNA as the LAMP reaction.

(3) result judges---color developing detection:

In above-mentioned reaction tubes, add 1 μ L developer, gently mixing and under black background, observing.

At blank and negative control reaction tubes liquid is orange, under the greeny condition of positive control reaction tubes liquid:

It is green that A example reaction pipe to be checked liquid is, and this sample result is that sour soil ring grease genus bacillus primary dcreening operation is positive.

B example reaction pipe to be checked liquid is orange can report that then sour soil ring grease genus bacillus assay is negative.

If be not inconsistent with above-mentioned condition, then this detected result is invalid, should change reagent and detect again by present method.

Claims (2)

1. sour soil ring grease genus bacillus detection kit is characterized in that comprising:

1) loop-mediated isothermal amplification liquid;

Said loop-mediated isothermal amplification liquid contains 10 * Thermopol reaction buffer, 10mmol/L dNTP, 50mmol/L sal epsom, 20 μ mol/L sour soil ring grease genus bacillus upper reaches inner primers, 20 μ mol/L sour soil ring grease genus bacillus downstream inner primers, 20 μ mol/L sour soil ring grease genus bacillus upper reaches outer primers, 20 μ mol/L sour soil ring grease genus bacillus downstream outer primers;

Sour soil ring grease genus bacillus upper reaches outer primer F3:

CGGGTAGGCATCTACTTGTG；

Sour soil ring grease genus bacillus downstream outer primer B3:

GCGGAAGATTCCCTACTGC；

Sour soil ring grease genus bacillus upper reaches inner primer FIP:

GCCGTTACCTCACCAACTAGCTGAAAGATGCAACTGCATCGC；

Sour soil ring grease genus bacillus downstream inner primer BIP:

GATGCGTAGCCGACCTGAGAGTGCCTCCCGTAGGAGTCT；

2) Bst archaeal dna polymerase: contain 8 activity units (U)/μ l;

3) developer: SYBR GREEN I optical dye, 1000 *.

2. detect the method for sour soil ring grease genus bacillus, it is characterized in that using sour soil ring grease genus bacillus detection kit according to claim 1, said method comprising the steps of:

1) extraction of DNA of bacteria:

2) ring mediated isothermal amplification;

3) color developing detection.