CN102732437A - Saccharomyces cerevisiae engineering bacterium and its application in production of ethanol - Google Patents
Saccharomyces cerevisiae engineering bacterium and its application in production of ethanol Download PDFInfo
- Publication number
- CN102732437A CN102732437A CN2012101809940A CN201210180994A CN102732437A CN 102732437 A CN102732437 A CN 102732437A CN 2012101809940 A CN2012101809940 A CN 2012101809940A CN 201210180994 A CN201210180994 A CN 201210180994A CN 102732437 A CN102732437 A CN 102732437A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- seed culture
- ethanol
- yeast
- wood sugar
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Abstract
The invention discloses a Saccharomyces cerevisiae engineering bacterium and its application in the production of ethanol. The invention provides Saccharomyces cerevisiae W32N55, and the preservation number of the Saccharomyces cerevisiae W32N55 is CGMCC NO.6090. The invention also provides an application of the Saccharomyces cerevisiae W32N55 in the preparation of ethanol. Experiments of the invention prove that the engineering bacterium W32N55 provided in the invention is obtained through obtaining the Saccharomyces cerevisiae engineering bacterium by the introducing xylose reductase gene (XYL1) and xylitol dehydrogenase gene (XYL2) to an original strain and by improving the activity of xylulokinase (XK), and through allowing the engineering bacterium containing the XYL1, the XYL2 and XK gene to undergo adaptive acclimation.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of saccharomyces cerevisiae engineered yeast and the application in producing ethanol thereof.
Background technology
Day by day exhausted along with the current energy, rising steadily and Global warming that Greenhouse effect brought of oil price forces People more and more to pay attention to the development and utilization for sustainable energy.Current, the xylogen resource becomes global more rich renewable resources, if the xylogen resource can make full use of, and realizes the conversion of clean energy, will become the most favourable substitute of oil.
With the alcohol fuel be main biofuel as a kind of cleaning and reproducible traffic fuel, be one of the most feasible at present, that usage quantity is maximum biological transport fuel, reduce one of effective means of fossil fuel oil consumption and greenhouse gas emission especially.The cellulose fuel ethanol technology need not consume grain resource, does not occupy cultivated land yet, and raw material sources are extensive, and is cheap, is the technology of an environmental friendliness, Sustainable development.
The applicating history of a century had the ethanol production height on yeast saccharomyces cerevisiae had in zymamsis industry, and characteristics such as strong stress resistance are the requisite production bacterial strains of current ethanol produce industry.The lignocellulose resource of all plant origins all includes abundant Mierocrystalline cellulose, semicellulose, xylogen etc.Behind pre-treatment and enzymolysis, what obtain is glucose mostly, also contains a certain amount of five-carbon sugar (being mainly wood sugar) simultaneously.Want to utilize lignocellulose resource fermentative prodn alcohol industry, simultaneously glucose capable of using and wood sugar transform generation alcohol just to require bacterial strain.Natural yeast saccharomyces cerevisiae can not utilize wood sugar growth fermentation, but can xylulose be changed into ethanol, possesses from xylulose to the alcoholic acid pathways metabolism.Compare with the natural wood sugar yeast that can utilize, yeast saccharomyces cerevisiae has lacked the pathways metabolism from the wood sugar to the xylulose.
The research about the saccharomyces cerevisiae engineered yeast strain that makes up wood sugar capable of using has been engaged in domestic and international many laboratories at present; But most saccharomyces cerevisiae engineered yeast strain can only be carried out wood-sugar fermentation under aerobic and limit oxygen condition; And because the growing amount of by product Xylitol is bigger, its wood sugar is relatively low for alcoholic acid sugar alcohol transformation efficiency, effectively metabolism wood sugar (Kuype etc.; FMES Yeast Research, 2004; Mervi H.T. etc., Metabolic Engineering, 2001).
Cellulosic hydrolysate is an ideal alcohol production raw material, owing to needing the processing through soda acid in the process that is hydrolyzed into liquid glucose at it, therefore contain the acetate of high density, and inhibitions such as furfural have limited bacterial strain and fermented for alcoholic acid.Current in the world seldom for the report that utilizes wood sugar engineering strain fermented cellulose hydrolyzed solution, mainly be since bacterial strain itself relatively poor for the tolerance of hydrolyzed solution inhibition.The one Accharomyces cerevisiae engineering strain of releasing Nancy Ho. team of university structure from sufferings is the bacterial strain of present cellulosic hydrolysate fermentative production of ethanol capable of using; This bacterial strain can utilize glucose and wood-sugar fermentation ethanol altogether in hydrolyzed solution; And the ethanol yield is higher relatively; Inoculum size is 10g dry wt/L (Ming W.Lau etc., PNAS, 2009) but this bacterial strain needs the common hydrolyzed solution fermentation of higher inoculum size when fermentation.These factors have all limited the process of cellulosic ethanol industrialization greatly.
Summary of the invention
An object of the present invention is to provide an Accharomyces cerevisiae.
Yeast saccharomyces cerevisiae provided by the invention (Saccharomyces cerevisiae) W32N55, its preserving number is CGMCC NO.6090.
The application of above-mentioned yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) W32N55CGMCC NO.6090 in preparation ethanol also is the scope that the present invention protects.
Another object of the present invention provides a kind of production alcoholic acid method.
Method provided by the invention is liquid fermenting yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) W32N55CGMCC NO.6090, collects tunning, promptly obtains ethanol.
In the aforesaid method, the substratum that said liquid fermenting adopts is fermention medium or corn straw cellulase hydrolysis liquid;
Said fermention medium prepares according to following method: yeast powder, peptone, wood sugar and water are mixed, obtain fermention medium; The concentration of said yeast powder in said fermention medium is 1-10g/L, and the concentration of said peptone in said fermention medium is 1-20g/L, and the concentration of said wood sugar in said fermention medium is 5-100g/L;
Glucose and wood sugar total content in the said corn straw cellulase hydrolysis liquid are 50-200g/L, and the glucose in the said corn straw hydrolyzed solution and the mass ratio of wood sugar are 1:1-10:1.
Above-mentioned corn straw cellulase hydrolysis liquid is according to the preparation of following method: adopt the method for gas explosion to obtain the gas explosion product earlier corn straw, wherein gas explosion condition is 2.3Mpa, 3min, 50% water cut; (cellulase 100000U/ml), obtains corn straw cellulase hydrolysis liquid available from the grand mcroorganism Engineering Co., Ltd in Shandong to adopt cellulase to carry out enzymolysis 96h the gas explosion product again.The glucose in the above-mentioned corn straw cellulase hydrolysis liquid and the ratio (mass ratio) of wood sugar are 3:1, and the total sugar content of glucose and wood sugar is about 200g/L.
In the aforesaid method, said liquid fermenting comprises the steps:
1) earlier said yeast saccharomyces cerevisiae (Saccharomyces cerevisiac) W32N55CGMCC NO.6090 is inoculated in the seed culture medium and cultivates, obtain seed culture fluid; Again with the centrifugal collection thalline of said seed culture fluid;
2) said thalline is inoculated in said fermention medium or the said corn straw cellulase hydrolysis liquid according to the amount of 3g dry weight/L ferments, collect tunning.
In the aforesaid method, in the step 1), said culture condition is that 30 ℃, 250rpm were cultivated 18h hour; Centrifugal is 4500rpm, centrifugal 7min, centrifugal radius 3cm;
Step 2) in, the time of said fermentation is 30h-72h; The temperature of said fermentation is 30 ℃-40 ℃, and said fermentation is an anaerobically fermenting.
In the aforesaid method, in the step 1), said seed culture medium prepares according to following method: yeast powder, peptone, glucose and water are mixed, obtain seed culture medium; The concentration of said yeast powder in said seed culture medium is 1-10g/L, and the concentration of said peptone in said seed culture medium is 1-20g/L, and the concentration of said glucose in said seed culture medium is 1-20g/L.
In the aforesaid method, in said step 2) after also comprise the steps: the centrifugal collection supernatant of said tunning is obtained ethanol.Above-mentioned centrifugal rotation speed is 13000rpm, and centrifugal (centrifugal radius the is 3cm) time is 2min.
So above-mentioned bacterial strains W32N55; Be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 11st, 2012 and (be called for short CGMCC; The address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City; Institute of Microorganism, Academia Sinica), preservation registration number is CGMCC NO.6090, its called after yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) of classifying.
Of the present inventionly experiment showed, that engineering bacteria W32N55 provided by the invention is through in starting strain, importing Xylose reductase gene (XYL1) and xylose dehydrogenase gene (XYL2), and make it to give expression to activity; Improve the activity of xylulokinase (XK) simultaneously, obtain saccharomyces cerevisiae engineered yeast; And then the engineering bacteria that will contain Xylose reductase gene (XYL1), xylose dehydrogenase gene (XYL2) and xylulokinase (XK) gene carries out flexibility domestication and obtains.The constructed saccharomyces cerevisiae engineered yeast W32N55 of the present invention under anaerobic, but fermentation 57h completely consumed 45g/L wood sugar produces 16g/L ethanol; Adopt fermentation-membrane sepn coupling technique, when utilization contained total reducing sugar for the corn straw hydrolyzed solution fermentation of 200g/L, the 72h total reducing sugar utilization ratio of fermenting can reach 88%, producing and ethanol 74g/L, and total reducing sugar sugar alcohol transformation efficiency is about 0.42g/g.
Description of drawings
Fig. 1 is the structural representation of plasmid pXYL1-2u (LEU2)-XYL2-XK
Fig. 2 is an engineering strain W32N55 wood-sugar fermentation synoptic diagram
Fig. 3 is an engineering strain W32N55 cellulosic hydrolysate fermentation synoptic diagram
Embodiment
Employed experimental technique is ordinary method like no specified otherwise among the following embodiment.
Used material, reagent etc. like no specified otherwise, all can obtain from commercial sources among the following embodiment.
The acquisition of embodiment 1, recombinant bacterial strain W32N55
One, the structure of recombinant bacterial strain
1, the structure of plasmid
1) plasmid pXYL1-2 μ (LEU2)
(carrier plasmid-2 μ (LEU2) is for to change pYES2 carrier ura selection markers into the leu selection markers in order xyl1 gene (http://www.ncbi.nlm.nih.gov/nuccore/X59465.1) is inserted carrier plasmid-2 μ (LEU2) for plasmid pXYL1-2 μ (LEU2); The GAL1 promotor changes the GPD promotor into and obtains; Wherein the pYES2 carrier is available from the Catalog no.V825-20 of Invitrogen company, and the sequence of carrier plasmid-2 μ (LEU2) is seen sequence table 1) BamH I restriction enzyme site between the carrier that obtains.
Concrete construction process is following: from pichia stipitis DNA, clone Xylose reductase gene (xyl1); BamH I site is added at two ends; After carrier plasmid-2 μ (LEU2) cut with BamH I enzyme, xyl1 was connected with gene, obtains plasmid pXYL1-2 μ (LEU2).
2）pXYL2-2u(LEU2)
Plasmid pXYL2-2u (LEU2) is for inserting xyl2 gene (http://www.ncbi.nlm.nih.gov/nucleotide/3262 report=genbank&log$=nucltop&blast_rank=4&RID=W65ST4K501S) in the carrier that obtains between the BamH I restriction enzyme site of plasmid-2 μ (LEU2) carrier.
Concrete construction process also can be following: the clone obtains xyl2 gene (two ends are BamH I sites) from pichia stipitis DNA, replaces the xyl1 gene among the plasmid pXYL1-2u (LEU2), is built into plasmid pXYL2-2u (LEU2).
3）pXK-2u(LEU2)
Plasmid pXK-2u (LEU2) is for inserting xk gene (http://www.ncbi.nlm.nih.gov/nucleotide/296145226 report=genbank&log$=nucltop&blast_rank=2&RID=W6615HT601N) in the carrier that obtains between the BamH I restriction enzyme site of plasmid-2 μ (LEU2) carrier.
Concrete construction process also can be following: the clone obtains xk gene (two ends are BamH1 sites) from yeast saccharomyces cerevisiae DNA, replaces the xyl1 gene among the plasmid pXYL1-2u (LEU2), is built into plasmid pXK-2u (LEU2).
4）pXYL1-2u(LEU2)-XYL2-XK
With plasmid pXYL2-2u (LEU2) is template; With F-5'CGAGCTCAGCTCAGTTTATCATTA 3'; R-5'CGAGCTCCAGCTTGCAAATTAAAGC 3' is primer (primer has the sacI restriction enzyme site); Carry out pcr amplification, obtain 2085bp product (expression cassette that contains xyl2 gene, promotor and terminator); Above-mentioned 2085bp product is cut the pXYL1-2 μ (LEU2) that cuts with the same enzyme of process through the SacI enzyme be connected, obtain plasmid pXYL12-2u (LEU2);
With plasmid pXK-2u (LEU2) is template; With F-5'ATTTGCGGCCGCAGCTCAGTTTATCATTA3'R-5'ATTTGCGGCCGCCAGCT TGCAAATTAAAGC 3' is primer (primer has the NotI restriction enzyme site); Carry out pcr amplification, obtain 2735bp product (expression cassette that contains xk gene, promotor and terminator); Above-mentioned 2735bp is cut the pXYL12-2u (LEU2) that cuts with the same enzyme of process through the NotI enzyme be connected, obtain plasmid pXYL1-2u (LEU2)-XYL2-XK, structural representation is as shown in Figure 1.
Through order-checking, plasmid pXYL1-2u (LEU2)-XYL2-XK is the carrier that obtains between the SacI of the 2 insertion plasmid-2 μ (LEU2) of the sequence in the sequence table and NotI restriction enzyme site.
Above-mentioned sequence 2 is made up of xyl2 expression cassette, xyl1 expression cassette and xk expression cassette successively;
The xyl2 expression cassette is made up of xyl2 promotor, xyl2 gene and xyl2 terminator; Wherein the xyl2 promotor is that sequence 2 is held the double chain DNA fragment shown in the Nucleotide of 1971-2647 position from 5 ' in the sequence table; The xyl2 gene be in the sequence table sequence 2 from the double chain DNA fragment shown in 5 ' the terminal 2654-3745 position Nucleotide, the xyl2 terminator be in the sequence table sequence 2 from the double chain DNA fragment shown in 5 ' the terminal 3752-4006 position Nucleotide;
The xyl1 expression cassette is made up of xyl1 promotor, xyl1 gene and xyl1 terminator; Wherein the xyl1 promotor be in the sequence table sequence 2 from the double chain DNA fragment shown in 5 ' the terminal 1284-1960 position Nucleotide; The xyl1 gene is that sequence 2 is from the double chain DNA fragment shown in 5 ' the terminal 319-1272 position Nucleotide in the sequence table, and the xyl1 terminator is that sequence 2 is held the double chain DNA fragment shown in the Nucleotide of 1-255 position from 5 ' in the sequence table;
The xk expression cassette is made up of xk promotor, xk gene and xk terminator; Wherein the xk promotor is that sequence 2 is held the double chain DNA fragment shown in the Nucleotide of 4013-4689 position from 5 ' in the sequence table; The xk gene be in the sequence table sequence 2 from the double chain DNA fragment shown in 5 ' the end 4690-6492 position Nucleotide, the xk terminator be in the sequence table sequence 2 from the double chain DNA fragment shown in 5 ' the terminal 6493-6747 position Nucleotide.
2, the preparation of yeast saccharomyces cerevisiae competent cell
1 yeast saccharomyces cerevisiae W303-1B of picking (2N) is (available from European yeast saccharomyces cerevisiae bacterial classification storehouse from the flat board; EUROpean Saccharomyces Cerevisiae numbering 20000D bacterial strain BMA64; Network address is http://web.uni-frankfurt.de/fb15/mikro/euroscarf/data/w303.html) F-strain of single bacterium colony, be inoculated in the 3ml YPD substratum, 30 ℃ of shaking tables are cultivated 16h; Switching is spent the night bacterium in 50mlYPD, the inoculative proportion inoculation by 2%.30 ℃ of shaking tables are cultured to OD
600=1.0.Centrifugal, 4500rpm, 5min collects thalline, and washs three times.With the sterilized water of the second time, use the sorbyl alcohol of precooling for the third time for the first time, dissolve in ice-cold sorbyl alcohol at last, obtain the yeast saccharomyces cerevisiae competent cell with precooling.
3, the acquisition of recombinant Saccharomyces cerevisiae engineering bacteria
1) evaluation of yeast saccharomyces cerevisiae conversion and transformant
About 50ng plasmid pXYL1-2u (LEU2)-XYL2-XK mixes with 80ul yeast saccharomyces cerevisiae competent cell, changes in the 0.2cm electricity revolving cup of precooling.Adopt U.S. BIO-RAD company electricity conversion instrument, the yeast saccharomyces cerevisiae parameter preset according to making electricity consumption conversion instrument shocks by electricity.Add immediately after electric shock finishes in 1M sorbyl alcohol to the electric shock cup of 1ml precooling, the solution in the cup that will shock by electricity then all is transferred in the aseptic centrifuge tube, hatches 2h for 30 ℃; Get different concns coating SC and select dull and stereotyped (yeast nitrogen base 0.67%; 2% glucose adds uridylic, Histidine; Tryptophane) cultivates 4 days until the bacterium colony appearance in 30 ℃ of inversions, obtain transformant.
Extract the plasmid of transformant, through order-checking, this plasmid is pXYL1-2u (LEU2)-XYL2-XK, contains the positive recombinant bacterial strain of transformant of pXYL1-2u (LEU2)-XYL2-XK.
2) evaluation of recombinant Saccharomyces cerevisiae engineering bacteria
Above-mentioned positive recombinant bacterial strain and control strain W303-1B (2N) be inoculated in respectively (substratum contains 0.67% yeast nitrogen base in the SC substratum; 2% glucose has added necessary amino acid) 30 ℃, 220rpm overnight cultures (12h); Centrifugal collection thalline also adopts granulated glass sphere concussion crush method lysing cell (" yeast genetics Methods Instruction "; 87-88), high speed centrifugation is also collected the albumen supernatant, and cryopreservation is surveyed enzyme and lived.
With the wood sugar is substrate, NADPH as coenzyme at A
340It is active to measure Xylose reductase under the nm condition, is substrate with the Xylitol, NAD
+For coenzyme at A
340Measure the wood sugar dehydrogenase activity under the nm condition.And through Xylene Brilliant Cyanine G method mensuration protein concentration.
Xylose reductase generates NAD than enzyme (U/mg) alive with oxidation NADH in every milligram of total protein PM
+Micromole's numerical table show.
Xylitol dehydrogenase than enzyme (U/mg) alive with reduction NAD in every milligram of total protein PM
+The micromole's numerical table that generates NADH shows
The Xylose reductase activity that the fermentation of the positive recombinant bacterial strain of result obtains is 0.528 ± 0.11U/mg, and the xylitol dehydrogenase activity is 0.32 ± 0.09U/mg.
Two, the wood sugar flexibility of recombinant bacterial strain domestication
Above-mentioned checking had positive recombined engineering bacteria strain ceaselessly switching on wood sugar substratum (yeast nitrogen base 0.67%, 2% wood sugar adds uridylic, Histidine, tryptophane) that the expression enzyme is lived; Initial growth is under logical fully oxygen condition, and shaking table revolution 220rpm is after switching several times; Bacterial strain utilizes the wood sugar growth velocity obviously to accelerate; Progressively reduce the shaking table revolution and continue domestication, through nearly 210 days domestication, final screening obtains engineering strain W32N55; (the shaking table revolution is 100rpm) wood sugar sole carbon source substratum (above-mentioned wood sugar substratum) is cultivated 48h, OD under the limit oxygen condition
600Can reach about 4.This bacterial strain utilizes the performance of wood sugar growth in the domestication process of not stopping, to be significantly improved, and its growth is not also being lacked reduction for the demand of oxygen.
Therefore above-mentioned bacterial strains W32N55 is yeast saccharomyces cerevisiae (Saccharomyces cerevisiae); Be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on May 11st, 2012 and (be called for short CGMCC; The address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City; Institute of Microorganism, Academia Sinica), preservation registration number is CGMCC NO.6090, its called after yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) of classifying.
Embodiment 2, the application of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) W32N55 CGMCC NO.6090 in producing ethanol
One, yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) W32N55 CGMCC NO.6090 xylose-fermenting is produced ethanol
1, the acquisition of seed culture fluid
W32N55CGMCC NO.6090 is inoculated in the 5mlYPD substratum with yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), and 30 ℃, the 250rpm overnight cultures is to saturated; By 2% inoculum size, insert (yeast powder 10g/L, peptone 20g/L in the 100mlYPD substratum that 250ml shakes bottle is housed; Glucose 20g/L); 30 ℃, 250rpm (rotation radius 3cm) cultivates 18h, as seed culture fluid.
2, fermentation
With the above-mentioned 1 seed culture fluid 4500rpm that obtains, centrifugal 7min, centrifugal radius 3cm; Above-mentioned seed culture fluid is collected thalline, is that 3g dry weight/L is resuspended in (yeast powder 10g/L, peptone 20g/L, wood sugar 45g/L) in the YPX substratum that 100ml is housed with thalline according to inoculum size; Fermented liquid is got in the following 30 ℃ of fermentations of anaerobic condition at set intervals, carries out fermented liquid centrifugal; 13000rpm, normal temperature (25 ℃) centrifugal (centrifugal radius 3cm) 2min goes up appearance and detects behind the 0.22 μ m membrane filtration; Analyze the fermented liquid component with HPLC, moving phase is the 0.5mM dilute sulphuric acid, adopts Bio-rad HPX-87H pillar; Flow rate of mobile phase is 0.55ml/min, and it is 30min that it's the post time is past each sample.
According to conventional wood-sugar fermentation product, the configuration standard sample is crossed post, and standard substance comprise glucose, wood sugar; Xylitol, acetate, glycerine; Alcohol mixture, sample is chromatographically pure, and every kind of substances content is 10g/L; According to the standard substance appearance time, primary product is ethanol and Xylitol in the tunning, and appearance time is respectively 22.6min and 13.3min.
The result is as shown in Figure 2, can find out, fermentation 24h and 48h be producing and ethanol 11g/l and 15.2g/l respectively; Through the 57h fermentation, whole wood sugars of using up, producing and ethanol 16g/L produces Xylitol 9.37g/L, and wood sugar is 0.36g/g to ethanol yield.
Two, yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) W32N55CGMCC NO.6090 fermented cellulose hydrolyzed solution is produced ethanol
1, the acquisition of seed culture fluid
Identical with above-mentioned one.
2, the preparation of corn straw hydrolyzed solution (cellulosic hydrolysate)
Because yeast saccharomyces cerevisiae itself does not possess unique wood sugar translocator; Need to rely on the translocator of hexose to transport wood sugar; When glucose in the substratum and wood sugar coexistence, because therefore translocator preferentially utilizes glucose to the avidity of glucose much larger than the avidity to wood sugar.
The preparation of corn straw hydrolyzed solution (cellulosic hydrolysate): corn straw adopts the method for gas explosion to obtain the gas explosion product earlier, and wherein gas explosion condition is 2.3Mpa, 3min, 50% water cut; (cellulase is available from the grand mcroorganism Engineering Co., Ltd in Shandong to adopt cellulase to carry out enzymolysis 96h the gas explosion product again; Be 100000U/ml); Obtain the corn straw hydrolyzed solution; Mainly contain glucose and wood sugar, wherein the ratio of glucose and wood sugar (mass ratio) is 3:1, and the total sugar content of glucose and wood sugar is about 200g/L.
3, fermentation
With the above-mentioned 1 seed culture fluid 4500rpm that obtains, centrifugal 7min, centrifugal radius 3cm, above-mentioned seed culture fluid is collected thalline; Is that 3g dry weight/L is inoculated in the above-mentioned 2 corn straw hydrolyzed solutions that obtain with thalline according to inoculum size, adopts fermentation to separate coupled technology, goes into the ethanol infiltration vaporization membrane in a termination of fermentor tank; Utilize vacuum pump that liquid in the fermentor tank is extracted separation, will remove the alcoholic acid fermented liquid again in the blowback fermentor tank, ethanol is then collected by receiving device; The temperature of fermentation is 30 ℃, and anaerobically fermenting is got fermented liquid at set intervals; Fermented liquid is carried out centrifugal, 13000rpm, the centrifugal 2min of normal temperature (25 ℃); Detect 0.22 go up appearance behind the μ m membrane filtration, detect other by products in ethanol and the fermentor tank with HPLC, condition is the same.
According to conventional wood-sugar fermentation product, the configuration standard sample is crossed post, and standard substance comprise glucose, wood sugar; Xylitol, acetate, glycerine; Alcohol mixture, sample is chromatographically pure, and every kind of substances content is 10g/L; According to the standard substance appearance time, primary product is ethanol and Xylitol in the tunning, and appearance time is respectively 22.6min and 13.3min.
The result is as shown in Figure 3, can find out, strain fermentation 72h can reach 88% to the total reducing sugar utilization ratio, and alcoholic acid output is 74g/L; Total reducing sugar sugar alcohol transformation efficiency (total reducing sugar of ethanol/consumption) is at 0.42g/g.
Claims (8)
1. yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) W32N55, its preserving number is CGMCC NO.6090.
2. the application of the described yeast saccharomyces cerevisiae of claim 1 (Saccharomyces cerevisiae) W32N55 CGMCC NO.6090 in preparation ethanol.
3. producing the alcoholic acid method for one kind, is the described yeast saccharomyces cerevisiae of liquid fermenting claim 1 (Saccharomyces cerevisiae) W32N55 CGMCC NO.6090, collects tunning, promptly obtains ethanol.
4. method according to claim 3 is characterized in that:
The substratum that said liquid fermenting adopts is fermention medium or corn straw cellulase hydrolysis liquid;
Said fermention medium prepares according to following method: yeast powder, peptone, wood sugar and water are mixed, obtain fermention medium; The concentration of said yeast powder in said fermention medium is 1-10g/L, and the concentration of said peptone in said fermention medium is 1-20g/L, and the concentration of said wood sugar in said fermention medium is 5-100g/L;
Glucose and wood sugar total content in the said corn straw cellulase hydrolysis liquid are 50-200g/L, and the glucose in the said corn straw hydrolyzed solution and the mass ratio of wood sugar are 1:1-10:1.
5. according to claim 3 or 4 described methods, it is characterized in that:
Said liquid fermenting comprises the steps:
1) elder generation is inoculated in said yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) W32N55 CGMCC NO.6090 in the seed culture medium and cultivates, and obtains seed culture fluid; Again with the centrifugal collection thalline of said seed culture fluid;
2) said thalline is inoculated in said fermention medium or the said corn straw cellulase hydrolysis liquid according to the amount of 3g dry weight/L ferments, collect tunning.
6. according to arbitrary described method among the claim 3-5, it is characterized in that:
In the step 1) of said liquid fermenting, said culture condition is that 30 ℃, 250rpm were cultivated 18h hour;
Step 2) in, the time of said fermentation is 30h-72h; The temperature of said fermentation is 30 ℃-40 ℃, and said fermentation is an anaerobically fermenting.
7. according to arbitrary described method among the claim 3-6, it is characterized in that:
In the step 1), said seed culture medium prepares according to following method: yeast powder, peptone, glucose and water are mixed, obtain seed culture medium; The concentration of said yeast powder in said seed culture medium is 1-10g/L, and the concentration of said peptone in said seed culture medium is 1-20g/L, and the concentration of said glucose in said seed culture medium is 1-20g/L.
8. according to arbitrary described method among the claim 5-7, it is characterized in that:
In said step 2) after also comprise the steps: the centrifugal collection supernatant of said tunning is obtained ethanol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101809940A CN102732437B (en) | 2012-06-04 | 2012-06-04 | Saccharomyces cerevisiae engineering bacterium and its application in production of ethanol |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101809940A CN102732437B (en) | 2012-06-04 | 2012-06-04 | Saccharomyces cerevisiae engineering bacterium and its application in production of ethanol |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102732437A true CN102732437A (en) | 2012-10-17 |
| CN102732437B CN102732437B (en) | 2013-10-23 |
Family
ID=46988741
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101809940A Active CN102732437B (en) | 2012-06-04 | 2012-06-04 | Saccharomyces cerevisiae engineering bacterium and its application in production of ethanol |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102732437B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045655A (en) * | 2012-12-14 | 2013-04-17 | 国家海洋局第一海洋研究所 | Method for preparing bio-ethanol with suaeda salsa as raw material |
| CN103484388A (en) * | 2013-05-07 | 2014-01-01 | 大连理工大学 | Industrial saccharomyces cerevisiae bacterial strain realizing chromosome integrative expression of xylose metabolic pathways |
| CN106460022A (en) * | 2014-06-24 | 2017-02-22 | 加州大学董事会 | Methods for production of xylosyl-xylitol oligomers |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1141057A (en) * | 1993-11-08 | 1997-01-22 | 普渡研究基金会 | Recombinant yeasts for effective fermentation of glucose and xylose |
| CN1171641A (en) * | 1996-06-20 | 1998-01-28 | 株式会社友华 | Antenna and radio apparatus using same |
| CN101302535A (en) * | 2008-06-30 | 2008-11-12 | 黑龙江大学 | Construction method of plasmid expressing xylulokinase gene |
| CN102127512A (en) * | 2010-12-20 | 2011-07-20 | 浙江大学 | Saccharomyces cerevisiae engineering bacterium capable of fermenting xylose |
-
2012
- 2012-06-04 CN CN2012101809940A patent/CN102732437B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1141057A (en) * | 1993-11-08 | 1997-01-22 | 普渡研究基金会 | Recombinant yeasts for effective fermentation of glucose and xylose |
| CN1171641A (en) * | 1996-06-20 | 1998-01-28 | 株式会社友华 | Antenna and radio apparatus using same |
| CN101302535A (en) * | 2008-06-30 | 2008-11-12 | 黑龙江大学 | Construction method of plasmid expressing xylulokinase gene |
| CN102127512A (en) * | 2010-12-20 | 2011-07-20 | 浙江大学 | Saccharomyces cerevisiae engineering bacterium capable of fermenting xylose |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103045655A (en) * | 2012-12-14 | 2013-04-17 | 国家海洋局第一海洋研究所 | Method for preparing bio-ethanol with suaeda salsa as raw material |
| CN103484388A (en) * | 2013-05-07 | 2014-01-01 | 大连理工大学 | Industrial saccharomyces cerevisiae bacterial strain realizing chromosome integrative expression of xylose metabolic pathways |
| CN106460022A (en) * | 2014-06-24 | 2017-02-22 | 加州大学董事会 | Methods for production of xylosyl-xylitol oligomers |
| CN106460022B (en) * | 2014-06-24 | 2018-06-05 | 加州大学董事会 | The production method of xyloside xylitol oligomer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102732437B (en) | 2013-10-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sedlak et al. | Production of ethanol from cellulosic biomass hydrolysates using genetically engineered Saccharomyces yeast capable of cofermenting glucose and xylose | |
| CN101434913B (en) | Wine brewing yeast strain and method for producing ethanol by efficient stalk fermentation | |
| Zhu et al. | A comparison of the production of ethanol between simultaneous saccharification and fermentation and separate hydrolysis and fermentation using unpretreated cassava pulp and enzyme cocktail | |
| CN104774877B (en) | A kind of method of lignocellulose biomass co-producing ethanol, acetone and butanol | |
| Obata et al. | Ethanol production from brown seaweed using non-conventional yeasts | |
| Khan et al. | Fermentation of Biomass for Production of Ethanol: A Review. | |
| CN102876595B (en) | Heat-resistant engineered yeast strains for high-temperature high-efficiency xylose fermentation and application of heat-resistant engineered yeast strains | |
| WO2010072093A1 (en) | Method for producing cellulosic ethanol | |
| CN109706089A (en) | A kind of xylose-fermenting strains being resistant to mortifier and its construction method and application | |
| Sutanto et al. | Release of sugar by acid hydrolysis from rice bran for single cell oil production and subsequent in-situ transesterification for biodiesel preparation | |
| CN102719371A (en) | Clostridium beijerinckii and method for preparing biological butanol through fermentation of xylose residue serving as raw material thereof | |
| Cortivo et al. | Conversion of fermentable sugars from hydrolysates of soybean and oat hulls into ethanol and xylitol by Spathaspora hagerdaliae UFMG-CM-Y303 | |
| Salim | The Effect of pH on simultaneous saccharification and fermentation process of water hyacinth (Eichhornia crassipes (Mart.) Solms.) using Trichoderma harzianum an | |
| CN102250967B (en) | Method for preparing biofuel butanol from foodstuff wastes | |
| CN102732437B (en) | Saccharomyces cerevisiae engineering bacterium and its application in production of ethanol | |
| CN103374532A (en) | High-temperature-resistant saccharomycete for producing ethanol and application thereof | |
| CN102965291A (en) | Saccharomyces cerevisiae strain and application of strain in production of ethanol by co-fermentation of glucose and xylose | |
| CN104073525A (en) | Method for producing ethanol by virtue of simultaneous saccharification and co-fermentation | |
| CN102154382A (en) | Method for producing cellulosic ethanol by using 1308 Saccharomyces cerevisiae | |
| CN105368731A (en) | Saccharomyces cerevisiae strain for expressing xylose isomerase and construction method | |
| CN104073526B (en) | A kind of method utilizing lignocellulose raw material to produce acetone/butanol | |
| CN104561132B (en) | The method that bacterium produces ethanol is mixed in the presence of a kind of inhibitor | |
| CN104745499A (en) | Amplification culture method for producing ethanol microorganisms by virtue of co-fermentation of C5 and C6 | |
| CN103103221A (en) | Method for converting cellulose into ethanol by use of mixed culture of genetically recombinant yeast | |
| CN101886092B (en) | Method for fermenting cellulosic ethanol by taking DDGS as nutrient |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |