CN102719553B - Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof - Google Patents
Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof Download PDFInfo
- Publication number
- CN102719553B CN102719553B CN201210245759.7A CN201210245759A CN102719553B CN 102719553 B CN102719553 B CN 102719553B CN 201210245759 A CN201210245759 A CN 201210245759A CN 102719553 B CN102719553 B CN 102719553B
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- medicines
- specific primer
- substance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method and a chip for detecting multidrug-resistant mycobacterium tuberculosis. The method and the chip disclosed by the invention relate to detection of katG315 mutant I and/or II or rpoB526 mutant I and/or II, rpoB531 mutant I and/or II, and inhA-15 mutant. The invention also provides a primer for detecting the mutants.
Description
Technical field
The present invention relates to medicine bioengineering field, in particular to the detection of substance of medicines-resistant branched tubercle bacillus.
Background technology
Resistance to multiple medicines tuberculosis is high at global sickness rate, mortality ratio is high, especially occurs in Asia, particularly the nations of China and India.Now tuberculosis is treated to general selection medicament benemicin (RIF) and vazadrine (INH), as long as these two kinds of medicines are produced to resistance simultaneously, be diagnosed as resistance to multiple medicines tuberculosis (MDR, Multi-drug-resistant tuberculosis) clinically.The tuberculotherapy of resistance to multiple medicines is very difficult, almost becomes incurable disease.So medical circle is equal to cancer serious resistance to multiple medicines tuberculosis.
Cause resistance to multiple medicines to be called substance of medicines-resistant branched tubercle bacillus in conjunction with sick conjugate branch bacillus.In present stage, extensively adopt traditional medicament sensitivity test to detect substance of medicines-resistant branched tubercle bacillus, the method is based on phenotype resistance, in the tubercule bacillus containing inoculating logarithmic phase on the solid medium of multiple related drugs, when growing under the lowest drug concentration (MIC) that suppresses tubercule bacillus growth, tubercule bacillus is defined as substance of medicines-resistant branched tubercle bacillus, the requirement of the method culture condition is high, workload is large, sense cycle is long, recall rate is low, can not meet clinical requirement.
In recent years, the molecular diagnostic techniques of some PCR-based is applied in substance of medicines-resistant branched tubercle bacillus detection gradually, and these class methods are that substance of medicines-resistant branched tubercle bacillus is determined in the transgenation by checking.These class methods of great majority be take nylon membrane and are carried out nucleic acid hybridization as carrier, and the method support pretreatment is complicated, and the time is longer, and sensitivity is not high, and result needs artificial judgement, and is difficult for storing.
Allele-specific PCR, according to Taq archaeal dna polymerase, can not repair primer in this principle of base mispairing of 3 ' end, when 3 ' terminal nucleotide of primer and allelotrope sequence complete complementary, template is amplified, this technology cannot judge which kind of base is detection site be mutated into, and result judges by nucleic acid electrophoresis, sensitivity is low, easily produce false positive.
PCR-linear probe hybridization technique (PCR-LiPA), its principle is the reverse hybridization of nucleic acid, according to results of hybridization, judges that whether sudden change exists.Based on this principle, be useful in the market the commercialization diagnostic kit that detects drug-tolerant gene mutation, mainly comprise Genotype MTBDR(Hain Lifescience, GmbH, Nehren, Germany) and INNO-LiPA Rif.TB(Innogenetics, Ghent, Belgium) two kinds.This class test kit can detect substance of medicines-resistant branched tubercle bacillus substantially effectively, but can only carry out scalping to rpoB gene, its data are difficult for storing, it is larger that result is affected by subjective factor, and experimental expenses is expensive, need accurate laboratory apparatus, in low income, high incidence country, be difficult to promote.And due to substance of medicines-resistant branched tubercle bacillus mutational site is selected, in these method detected results, false positive and/or false negative are higher.
The detection method that also has a kind of Xpert MTB of listing adopts one section of special MTB sequence of half-nest type real time quantitative PCR method amplification rpoB gene in addition, thus this sequence as the molecular beacon of a probe and the sudden change of rifampicin resistance determining area in conjunction with obtaining detected result.The method can only detect the sudden change of rpoB gene, and because the variation of experiment condition comprises that laboratory apparatus and treatment condition make experimental result unstable as temperature-time etc. changes, the method has adopted a lot of advanced persons' hardware device simultaneously, this has increased testing cost undoubtedly greatly, a large amount of inputs of fund make some developing countries be difficult to bear, and this instrument can not detect for other aspects in addition.
Tradition solid phase chip, the DNA chip of diagnosing tubercle bacillus resistance is to be fixed on fixing DNA probe on slide, silicon chip, film, polymeric carrier material.For it is fixed on carrier, probe and carrier are all needed to activation.Sample is carried out to pcr amplification, carries out fluorescent mark, then with DNA chip hybridization.Can detect by special-purpose laser chip scanner.The image that scanning obtains, uses the power of the hybridization signal in each gene probe site of chip image dedicated analysis software analysis, thereby determines whether Mycobacterium tuberculosis target dna undergos mutation.Because this testing environment is solid phase, be unfavorable for the combination of PCR product and probe, and to detect carrier be slide, volume is far longer than micron level, when sample size is many, can not effectively carry out high-throughout detection.In addition, although the method is short detection time, instrument and technician are required high, poor repeatability, can not effectively carry out high throughput testing.
Therefore, in this area, need that a kind of accuracy is high, susceptibility is high, the method for high specificity, simple, the quick and high-throughout detection substance of medicines-resistant branched tubercle bacillus of step.
Summary of the invention
The inventor is through repeatedly attempt finding, by detecting katG315 saltant type I and/or II, rpoB526 saltant type I and/or II, rpoB531 saltant type I and/or II, substance of medicines-resistant branched tubercle bacillus can be effectively detected in inhA-15 mutational site.
In order to realize method of the present invention, the inventor is through many experiments, specific primer sequence for detection of katG315 saltant type I and/or II, rpoB526 saltant type I and/or II, rpoB531 saltant type I and/or II, inhA-15 mutational site is provided, comprise: for the SEQ ID NO.12 in katG315 wild-type site, for the SEQ ID NO.13 in katG315 saltant type I site, for the SEQ ID NO.14 in katG315 saltant type II site; For the SEQ ID NO.15 in rpoB526 wild-type site, for the SEQ ID NO.16 in rpoB526 saltant type I site, for the SEQ ID NO.17 in rpoB526 saltant type II site; For the SEQ ID NO.18 in rpoB531 wild-type site, for the SEQ ID NO.19 in rpoB531 saltant type I site, for the SEQ ID NO.20 in rpoB531 saltant type II site; For the SEQ ID NO.21 of inhA-15 wild-type, for the SEQ ID NO.22 of inhA-15 saltant type.These these primer sequence high specificities, can distinguish range gene type exactly, and multidigit point detects simultaneously and do not have cross interference.
In addition, the inventor is through many experiments, the amplimer of the target sequence that also providing increases contains katG315, rpoB526, rpoB531, inhA-15 site, described amplimer comprises: for SEQ ID NO.34 and the SEQ ID NO.35 in katG gene 315 codon sites, for SEQ ID NO.36 and the SEQ ID NO.37 in rpoB gene 526 codons, rpoB gene 531 codon sites, for SEQ ID NO.38 and the SEQ ID NO.39 in site, inhA gene promoter-15.
Therefore, an object of the present invention is to provide a kind of method of using above-mentioned specific primer sequence and amplimer to detect substance of medicines-resistant branched tubercle bacillus.
In one aspect, the invention provides a kind of method of using above-mentioned specific primer sequence and amplimer to detect substance of medicines-resistant branched tubercle bacillus, comprise the following steps:
1) thereby use amplimer increases, the DNA of a sample obtains amplified production, and amplified production described in purifying, and the sequence of described amplimer is SEQ ID NO.34-SEQ ID NO.39;
2) with Auele Specific Primer, to carrying out above-mentioned extension product, extend, described Auele Specific Primer is SEQ ID NO.12-SEQ ID NO.22,
If SEQ ID is NO.12, SEQ ID NO.21, SEQ ID NO.15 and SEQ ID NO.18 do not extend, and in SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.22, one of at least extend and SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.19 and SEQ ID NO.20 in one of at least extend, in so described sample, there is substance of medicines-resistant branched tubercle bacillus.
Another object of the present invention is to provide a kind of liquid-phase chip that detects substance of medicines-resistant branched tubercle bacillus, and this liquid-phase chip can be used for detecting wild gene type and known 7 kinds of common saltant types of katG gene 315 codons, rpoB gene 526 codons, rpoB gene 531 codons, inhA gene promoter-15.
On the other hand, the invention provides a kind of liquid-phase chip that detects substance of medicines-resistant branched tubercle bacillus, comprise
1) Auele Specific Primer of tape label sequence, the Auele Specific Primer of each tape label sequence is comprised of the sequence label of 5 ' end and the specific primer sequence of 3 ' end, and described specific primer sequence is selected from respectively SEQ ID NO.12-SEQ ID NO.22; Described sequence label is selected from SEQ ID NO.1-SEQ ID NO.11, and different primers sequence connects different sequence labels;
2) be coated with respectively the microballoon of tag complement, described tag complement is 1) in the complementary sequence of sequence label, described tag complement is selected from SEQ ID NO.23-SEQ ID NO.33.
In a specific embodiments, liquid-phase chip of the present invention also comprises:
3) for increasing, contain the amplimer of the target sequence in katG315, rpoB526, rpoB531, inhA-15 site, described amplimer includes for the SEQ ID NO.34 in katG gene 315 codon sites and SEQ ID NO.35, for SEQ IDNO.36 and the SEQ ID NO.37 in rpoB gene 526 codons, rpoB gene 531 codon sites, for SEQ ID NO.38 and the SEQ ID NO.39 in site, inhA gene promoter-15.
Another object of the present invention is to provide a kind of method of using above-mentioned liquid-phase chip to detect substance of medicines-resistant branched tubercle bacillus.
In one aspect, the invention provides a kind of method of using above-mentioned liquid-phase chip to detect substance of medicines-resistant branched tubercle bacillus, comprise the following steps:
1) thus the DNA that is beneficial to a sample of described amplimer sequence amplification obtains amplified production;
2) described amplified production is carried out to digestion process with exonuclease I and shrimp alkaline phosphotase (SAP);
3) with the Auele Specific Primer of described tape label sequence, carry out extension, in extension process, carry out mark;
4) described microballoon and the above-mentioned extension product that is coated with tag complement carried out to hybridization, different tag complement are coated on the microballoon that can mutually distinguish;
5) detect the microballoon that hybridization occurs;
6) by distinguishing microballoon, obtain by the interact type of the Auele Specific Primer that is connected with microballoon of sequence label and tag complement, thus determining step 3) in there is the Auele Specific Primer type of extending,
If SEQ ID is NO.12, SEQ ID NO.21, SEQ ID NO.15 and SEQ ID NO.18 do not extend, and in SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.22, one of at least extend and SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.19 and SEQ ID NO.20 in one of at least extend, in so described sample, there is substance of medicines-resistant branched tubercle bacillus.
For example, in one embodiment, in above-mentioned steps 3) in, mix biotin labeled dCTP, thereby make a plurality of biotin labelings on reacted product band; And in step 5), by reacting with SA-PE, then by fluorescence detector, detect.
Drug Resistance of Mycobacterium Tuberculosis of the present invention detects liquid-phase chip and detection method major advantage is:
1. accuracy is high: with the identical rate of sequencing up to 100%;
2. susceptibility is strong: detection limit is minimum may reach 0.01pg/ml, and template consumption is few, and PCR product only needs 2-4 μ l can complete subsequent detection;
3. high specificity: the type that can distinguish exactly each site;
4. step is simple: a step multi-PRC reaction can complete 4 amplifications with the target sequence in SNP site;
5. detection time is short: the testing process operating time is 4.5-5.5 hour, far less than conventional sequencing technologies required detection time;
6. flux is high: a check-out console can carry out 96 clinical samples simultaneously, and can carry out continuous detecting with a plurality of check-out consoles.
The present invention is the combination of molecular biology and emerging liquid chip technology, by the allele specific primer to several gene PCR products, extend (ASPE) method, in conjunction with the microballoon of isolabeling not, can in a reaction system, detect the detection of multidrug resistant gene type simultaneously.First the method for Luminex liquid chip is used for to the detection to mycobacterium tuberculosis multidrug-resistance.
Embodiment
In the present invention, substance of medicines-resistant branched tubercle bacillus refers to the mycobacterium tuberculosis to Rifampin (RIF) and vazadrine (INH) generation resistance simultaneously.
In the present invention, katG315 is the abbreviation of katG gene 315 codons, and rpoB526 is the abbreviation of rpoB gene 526 codons, and rpoB531 is the abbreviation of rpoB gene 531 codons, and inhA-15 is the abbreviation of inhA gene promoter-15.
In the present invention, mycobacterium tuberculosis shows as katG315 and inhA-15 wild gene type simultaneously, is the responsive mycobacterium tuberculosis in vazadrine, and this two check point one or both of shows as saltant type, is Isoniazid-resistant mycobacterium tuberculosis; Mycobacterium tuberculosis shows as rpoB526 and rpoB531 wild gene type simultaneously, is the responsive mycobacterium tuberculosis of Rifampin, and this two check point one or both of shows as saltant type, is rifampin-resistance mycobacterium tuberculosis.Mycobacterium tuberculosis katG315 and inhA-15 one or both of show as saltant type, and rpoB526 and rpoB531 one or both of show as saltant type, are substance of medicines-resistant branched tubercle bacillus.
The sick investigation result of learning of row shows: in substance of medicines-resistant branched tubercle bacillus, 90% to Rifampin (RIF) and/or to vazadrine (INH), produce resistance at present, and our selected 4 detection site nearly covers the sudden change of all drug resistant genes.We prove in an embodiment: detect 4 numerical value difference there was no significant differences when detecting single-point simultaneously; But in an embodiment, verified that by experiment increase detection site has interference to detected result.
The primer sequence SEQ ID NO.12-SEQ ID NO.22 using is in the present invention: for the SEQ ID NO.12 in katG315 wild-type site, for the SEQ ID NO.13 in katG315 saltant type I site, for the SEQ ID NO.14 in katG315 saltant type II site; For the SEQ ID NO.15 in rpoB526 wild-type site, for the SEQ ID NO.16 in rpoB526 saltant type I site, for the SEQ ID NO.17 in rpoB526 saltant type II site; For the SEQID NO.18 in rpoB531 wild-type site, for the SEQ ID NO.19 in rpoB531 saltant type I site, for rpoB531 saltant type II site SEQ ID NO.20; For the SEQ ID NO.21 of inhA-15 wild-type, for the SEQ ID NO.22 of inhA-15 saltant type.
In the present invention, the amplimer of the target sequence that amplification contains katG315, rpoB526, rpoB531, inhA-15 site comprises: for SEQ ID NO.34 and the SEQ ID NO.35 in katG gene 315 codon sites, for SEQ ID NO.36 and the SEQ ID NO.37 in rpoB gene 526 codons, rpoB gene 531 codon sites, for SEQ ID NO.38 and the SEQ ID NO.39 in site, inhA gene promoter-15.
In a specific embodiments, the Auele Specific Primer of the tape label sequence described in the present invention is selected from respectively: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.12 of katG gene 315 codons, the sequence being formed by SEQ ID NO.2 and SEQ ID NO.13, the sequence being formed by SEQ ID NO.3 and SEQ ID NO.14; For the sequence being formed by sequence SEQ ID NO.4 and SEQ ID NO.15 of rpoB gene 526 codons, the sequence being formed by SEQ ID NO.5 and SEQ ID NO.16, and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.17; The sequence being formed by sequence SEQ ID NO.7 and sequence SEQ ID NO.18 for rpoB gene 531 codons, the sequence being formed by sequence SEQ ID NO.8 and sequence SEQ ID NO.19, and the sequence being formed by sequence SEQ ID NO.9 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.10 and SEQ ID NO.21 of inhA gene promoter-15 and the sequence being formed by SEQ ID NO.11 and SEQ ID NO.22.
The DNA cloning method relating in the present invention, from the method for sample extraction DNA, can be any methods availalbe this area.Described method can be selected as the case may be by those skilled in the art.
In the present invention, the detection principle of the liquid chip (luminex xTAG) using is as follows: object fragment to be detected, through pcr amplification, carry out allele-specific extension, hybridize with specificity fluorescent coding microball, the phycoerythrin (SAPE) that adds avidin to modify is fluorescent reporter molecule, through two laser systems, detects.The method can detect the sudden change of a plurality of sites, polygene type simultaneously.
In one embodiment of the invention, described liquid-phase chip technology can be to take the suspension liquid-phase chip technology that microballoon is carrier.For example, in a specific embodiment, the core of this technology is that the polystyrene sphere that is 5.6 μ m diameter is encoded by the method for fluorescent dye, by regulating the different proportionings of two kinds of fluorescence dyes to obtain, can reach at most 100 kinds of microballoons with different characteristics fluorescence Spectra, then by every kind of coding microball covalent cross-linking for the capture molecules such as antigen, antibody or nucleic acid probe of particular detection thing.During application, first the coding microball that detects thing for difference is mixed, add micro-sample to be checked, the crosslinked capture molecules generation specific binding of target molecule and microsphere surface in suspension can complete the most nearly 100 kinds of different detection reaction in a reacting hole simultaneously again.Finally analyze, instrument is identified respectively the coding of microballoon by two bundle laser and is detected the fluorescence intensity of reporter molecules on microballoon.
In the present invention, the selection principle of sequence label and tag complement be exactly make between microballoon as far as possible, do not occur between microballoon and the Auele Specific Primer of tape label sequence non-specific crosslinked; And and between species gene group DNA without similarity.The selection of sequence label and tag complement is that those skilled in the art can realize.In addition, can also be by commercial acquisition.For example, microballoon is commercially available, and sequence is that manufacturer designs, and microsphere surface has been coated with tag complement, and the tag complement on every kind of microballoon is specificity nucleotide sequence, at utmost guarantees between microballoon not crosslinked mutually.Sequence label on the Auele Specific Primer of tape label sequence and the tag complement on microballoon are complementary, and in process, having a step hybridization is exactly to make special microballoon identify the specificity product of special tape label sequence, reaches microballoon and sequence object one to one.In this, wherein said sequence label length is preferably 10 to 50 Nucleotide.
In the present invention, in the middle of described tag complement is connected with microballoon, can there is no intervening sequence, also can be provided with spacerarm sequence, spacerarm interval is between microballoon and tag complement.For example, described spacerarm sequence can be 5-10 T.For example, or described spacerarm sequence can be from the supplier that microballoon is provided, Luminex company.
The liquid-phase chip of detection substance of medicines-resistant branched tubercle bacillus of the present invention and method can be used for detecting substance of medicines-resistant branched tubercle bacillus genome in the sample in multiple source, and described sample can be from the body fluid of human or animal body, for example sputum, tear, urine; From laboratory sample, the substance of medicines-resistant branched tubercle bacillus in substratum for example; From medical treatment product, for example medical article, blood products; From environment, soil for example, water; From food, the food for example polluting, beverage; From animals products, animal-feed for example.
Propose following examples, to make those of ordinary skills understand better the present invention, described embodiment, only for exemplary purpose, is not intended to limit the scope of the present disclosure.
Embodiment 1 detects the liquid-phase chip of substance of medicines-resistant branched tubercle bacillus, comprises
One, the Auele Specific Primer of tape label sequence
For substance of medicines-resistant branched tubercle bacillus related locus katG531, rpoB526, rpoB531, inhA-15, design respectively specific primer sequence.The Auele Specific Primer of tape label sequence is comprised of " sequence label+specific primer sequence ".The specific primer sequence of tape label sequence is as shown in the table:
The specific primer sequence (sequence label+specific primer sequence) of table 1 tape label sequence
Bracket inner digital represents SEQ ID NO.; Wt represents wild-type; M represents saltant type; M1 represents saltant type I; M2 represents saltant type II.
The Auele Specific Primer of every band sequence label comprises two parts, and 5 ' end is the specificity sequence label for tag complement on relative microballoon, and 3 ' end is saltant type or wild-type specific primer sequence (as shown in Table 1).The Auele Specific Primer of all tape label sequences is synthetic by Shanghai Shan Jing molecular biotechnology institute.Every primer after synthetic is used respectively two H of steaming of sterilizing
2o is mixed with the storage liquid of 10 μ M.
Two, the coated microballoon of tag complement
The microballoon using in the present embodiment is all purchased from U.S. Luminex company.
According to the specificity specific primer sequence of designed tape label sequence, select sequence label, reduce to greatest extent between the tag complement of each microballoon and secondary structure that the specificity specific primer sequence of sequence label and tape label sequence may form, on 13 kinds of microballoons numberings of selection and microballoon, corresponding tag complement is as shown in table 2:
Table 2
Wt represents wild-type; M represents saltant type; M1 represents saltant type I; M2 represents saltant type II.
11 kinds of microballoons selecting are purchased from U.S. Luminex company, and tag complement is coated in microsphere surface in advance, makes 2.5 * 10
5the storage liquid of/ml.
Three, amplify the primer of the target sequence with detection site:
Target detect site comprises katG315, rpoB526, rpoB531, inhA-15, relates to katG gene, rpoB gene and inhA promoter region, and wherein rpoB526 and rpoB531 can be increased simultaneously and be obtained by same group of primer.Utilize three pairs of primers (in Table 3) can amplify respectively three target sequences with specific detection site.
Table 3
All primers are synthetic by Shanghai Shan Jing molecular biotechnology institute.Every primer after synthetic is used respectively two H of steaming of sterilizing
2o is mixed with the storage liquid of 10 μ M.
Substance of medicines-resistant branched tubercle bacillus described in embodiment 2 use embodiment 1 detects liquid-phase chip and detects clinical sample
The formula of described various solution is as follows:
2 * Tm hybridization buffer:
After filtration in 4 ℃ of storages.
1 * Tm hybridization solution:
Filter rear and 4 ℃ of storages.
In the present embodiment, platinum Taq enzyme is purchased from Invitrogen company; ExoSAP-IT test kit is purchased from U.S. USB company; DATP, dTTP, dGTP are purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd; Biotin labeled dCTP is purchased from Invitrogen company; Tsp enzyme is purchased from Invitrogen company; Other pharmaceutical chemicalss are all from Beijing ancient cooking vessel state.
The present embodiment has been used 15 tuberculosis patients (correspondence is sample 1-15 below) that are diagnosed as hospital care after tuberculosis, and 5 suitable normal peoples of age are (correspondence is sample 16-20 below) in contrast.
The step and the result that with substance of medicines-resistant branched tubercle bacillus, detect liquid-phase chip detection clinical sample are as follows.
One, sample DNA extracts
DNA sample extraction is from the sputum sample of tuberculosis patient and contrast.Step is as follows: a little sputum of (1) picking is put into the eppendorf pipe of 1.5ml, adds 5mo1/L NaOH 500 μ l to mix, and makes sputum thinning, shakes 20 minutes in room temperature.(2) add 1mo1/L NaH
2pO
4600 μ l mix, and neutralize centrifugal 5 minutes of 10,000r/min.(3) remove supernatant liquor, add TE(10mmol/l Tris-Cl, 1mmol/l EDTA) mix to 500 μ l, add a little N,O-Diacetylmuramidase (Invitrogen company).(4) put 37 ℃ of digestion 30 minutes.(5) add isopyknic phenol, chloroform, primary isoamyl alcohol (25:24:1) mixed solution, shake up 20 minutes.Centrifugal 5 minutes of (6) 10,000r/min, move to supernatant liquor in the eppendorf pipe of another clean 1.5ml, add isopyknic phenol, chloroform, primary isoamyl alcohol (25:24:1) mixed solution, continue to shake up 20 minutes.Centrifugal 5 minutes of (7) 10,000r/min, move supernatant liquor in another tubule, add equal-volume Virahol to shake up.Centrifugal 5 minutes of (8) 10,000r/min, remove supernatant liquor, put air drying, add 30 μ l TE dissolution precipitation things, put 4 ℃ of refrigerators standby.
Two, the pcr amplification of testing sample
Utilize multiplex PCR one step to amplify the totally three objective sequences containing katG315, rpoB526, rpoB531, inhA-15, product size is respectively 414bp, 512bp, 615bp.Multiple PCR primer sequence (SEQ NO.34-39) is shown in shown in above-mentioned table 3.
The multi-PRC reaction system of each sample is 25 μ l, and its composition is as follows:
| Templet gene group | 1μl |
| 10 * damping fluid | 2.5μl |
| 10mM dNTP | 0.5μl |
| 50mM MgSO 4 | 1μl |
| Multiple PCR primer (each 10 μ M) | Totally 6 of each 0.5 μ l() |
| Platinum Taq enzyme (5U/ μ l) | 0.1μl |
| Two steaming H 2O | 16.9μl |
Pcr amplification program is: 94 ℃ of 2min; 94 ℃ of 30s, 58 ℃ of 30s, 68 ℃ of 30s, 40 circulations; 68 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
The reacted product of 5 μ l PCR, adds 2 μ l ExoSAP-IT enzymes (U.S. USB company), mixes.This mixture is hatched to 15min in 37 ℃.Hatch 15min for 80 ℃, with the enzyme of deactivation remnants.Product after ExoSAP-IT enzyme is processed is directly used in the Auele Specific Primer extension of next step tape label sequence.
Four, site-specific primer extension reaction (the Auele Specific Primer reaction of tape label sequence)
Utilize the Auele Specific Primer of above-mentioned tape label sequence to carry out extension, in reaction process, mix biotin labeled dCTP, from but a plurality of biotin labelings reacted product band.
The Auele Specific Primer reaction system of the tape label sequence of each sample is 20 μ l, and its composition is as follows:
The Auele Specific Primer response procedures of tape label sequence is: 94 ℃ of 2min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s, 10 circulations; 89 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 30s, 20 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Five, hybridization
1,, according to the Auele Specific Primer of the tape label sequence of design, (microballoon concentration is 2.5 * 10 to select corresponding 11 kinds of optimum microballoons
5individual/ml).Every kind of microballoon is encoded with the fluorescence dye of different colours respectively.Simultaneously every kind of microballoon shows to be coated with respectively the specific oligonucleotide sequences SEQ NO.22-33(tag complement of 24bp), these tag complement can be respectively and Auele Specific Primer 5 ' the endmost tag sequence SEQ NO:1-11 specific binding of corresponding tape label sequence;
2, each detection reaction, every kind of microballoon is got 2500, i.e. and 10 μ l, in 1.5ml Eppendorf pipe;
3, mix various microballoons, in >=the centrifugal 2min of 8000g;
4, supernatant discarded, by 100 microballoons of each component of every μ l, with 2 * Tm hybridization buffer, mixture of microspheres is resuspended, vortex 3-5 mixes second;
5, get the above-mentioned microballoon suspension of 25 μ l in 96 hole PCR Sptting plates, control wells adds the two H of steaming of 25 μ l
2o;
6, at the corresponding specific reaction product that adds 5-25 μ l tape label sequence in hole that detects, add two H of steaming
2o adjusts final volume to 50 μ l;
7, with masking foil, encase 96 hole PCR Sptting plates with lucifuge, 96 ℃ of 60s, 37 ℃ of 15min, react in microwell plate vibrator and carry out, rotating speed 300rpm;
8, the microballoon after hybridization is in >=centrifugal the 3min of 2250g, supernatant discarded;
9, every hole is resuspended by microballoon with 75 μ l 1 * Tm hybridization buffers;
10, microballoon is in >=centrifugal the 3min of 2250g, supernatant discarded;
11, with the 1 * Tm hybridization buffer of the 75 μ l containing 2 μ g/ml SA-PEs (SA-PE, purchased from Invitrogen company), microballoon is resuspended;
12,37 ℃ of lucifuge reaction 15min, react in microwell plate vibrator and carry out, rotating speed 300rpm;
13,, on Luminex instrument, the step providing according to manufacturer detects.
Six, result detects
The step that reaction after product provides according to manufacturer by Luminex 200 instruments detects, and detected result is as shown in table 4.Wherein, fluorescent value (MFI) and data processing are had to following requirement:
1,, for each check point of sample, if certain genotypic MFI value is greater than 800 and be greater than negative control MFI and this site other genotype MFI value more than 7 times simultaneously, can think that this site is for this genotype;
2, show as katG315-wt and inhA-15-wt genotype, be vazadrine sensitive strain simultaneously, and this two check point shows as one or both saltant types, is Isoniazid-resistant bacterial strain; Show as rpoB526-wt and rpoB531-wt genotype, be Rifampin sensitive strain simultaneously, and this two check point shows as one or both saltant types, is rifampin-resistance bacterial strain.
In order to compare, also from tuberculosis patient and control sample, carry out phenotype analytical and sequencing analysis.
One. phenotype analytical
All participants are carried out to Phenotypic examination according to < < Laboratory Science Procedure of Diagnostic Bacteriology in Tuberculosis > > chapter 5 mycobacterium determination of drug sensitivity method.In brief, separate branches bacillus from tubercular's sputum specimen, at modified Russell medium (Sodium Glutamate (purity is more than 95%) 7.2g, KH
2pO
414g, MgSO
47H
2o0.24g, magnesium citrate 0.6g, glycerine 12ml, distilled water 600ml, yam starch 30g, fresh ovum gallinaceum liquid 1000ml, 2% malachite green solution 20ml, preparation method is shown in < < Laboratory Science Procedure of Diagnostic Bacteriology in Tuberculosis > >) middle cultivation.The tolerance to vazadrine (INH) and Rifampin (RFP) with Absolute concentration method and scaling method test mycobacterium tuberculosis respectively, drug level is as following table (μ g/ml):
Absolute concentration method test is as follows: first prepare 1mg/ml bacteria suspension, be diluted to 10ug/ml, with micropipet inoculation 0.1ml, to contrast and pastille substratum, cultivate after 4 weeks and report the result at 37 ℃; The mycobacterium report responsive (-) of not growing of lower concentration pastille substratum, raw elder reports resistance (+).
Scaling method is as follows: the same preparation 1mg/ml bacteria suspension, be diluted to 10ug/ml and 0.1ug/ml, with standard inoculation ring, with method of scoring, be seeded to contrast and pastille substratum respectively, at 37 ℃, cultivate after 4 weeks observationss and calculate resistance per-cent (on resistance per-cent=pastille substratum in colony number/control medium colony number * 100), <1% reports responsive, and >1% is resistance.Phenotype experimental result is in Table 7.
Two. sequencing analysis data,
The DNA sample of the present embodiment is served to Hai Shenggong and check order, sequencing analysis the results are shown in Table 5.
Interpretation of result
Liquid-phase chip and the sequencing result goodness of fit and finally judge whether resistance respectively in Table 6, table 7.
The contrast of detected result in table 4 and the sequencing result in table 5, result is consistent, and this shows that method of the present invention can distinguish the type of these detection site exactly.In table 6, shown liquid-phase chip detected result and the sequencing result rate 100% of coincideing.In a word, these results and order-checking and Phenotypic examination result have 100% identical rate, prove that present method can detect the sudden change of resistance related locus exactly, thereby detect substance of medicines-resistant branched tubercle bacillus, and result is reliable and stable.And, in experimental procedure, can find out, each PCR primer, each ASPE primer mixes respectively, that is to say, and each walks all testing processes and all carries out together simultaneously.A sample can detect each detection site simultaneously, as long as detect in hole and just can detect a sample at one.Check-out console is exactly 96 orifice plates, so a maximum plate can detect 96, also can detect by a plurality of check-out consoles simultaneously.About each 30 seconds pattern detection time.
The result of this embodiment shows, sample 1-3,5,6,8 and 9 has represented resistance to multiple medicines mycobacterium, and method of the present invention can be distinguished these genotype effectively.In above-mentioned experimental result, more than 10 doubly (it is generally acknowledged that difference is positive at 5 times) with the difference of background, result is as the criterion with data, has got rid of the deviation that artificial judgement can produce, and result is easy to store, and the detection of different detection site is independent of each other.And detected result is consistent with sequencing result, consistent with Phenotypic examination result.This embodiment shows, the detection to resistance to multiple medicines mycobacterium can be realized in the mutational site of four genes of the present invention.
In time, within the method 5-6 hour, can complete, order-checking needs 2 weeks, and Phenotypic examination needs 2 months.
Table 4: liquid-phase chip detects substance of medicines-resistant branched tubercle bacillus
1-10: drug resistance of tuberculosis patient (detected result: different loci has sudden change)
11-15: the non-resistance patient of tuberculosis (detected result: different loci is wild-type)
16-20: non-tuberculosis, normal people's (not detecting mycobacterium tuberculosis gene)
Table 5: sample sequencing result
Table 6: liquid-phase chip detected result and the sequencing result situation of coincideing
| Sample number into spectrum | katG315 | rpoB526 | rpoB531 | inhA-15 |
| Blank | √ | √ | √ | √ |
| 1 | √ | √ | √ | √ |
| 2 | √ | √ | √ | √ |
| 3 | √ | √ | √ | √ |
| 4 | √ | √ | √ | √ |
| 5 | √ | √ | √ | √ |
| 6 | √ | √ | √ | √ |
| 7 | √ | √ | √ | √ |
| 8 | √ | √ | √ | √ |
| 9 | √ | √ | √ | √ |
| 10 | √ | √ | √ | √ |
| 11 | √ | √ | √ | √ |
| 12 | √ | √ | √ | √ |
| 13 | √ | √ | √ | √ |
| 14 | √ | √ | √ | √ |
| 15 | √ | √ | √ | √ |
| 16 | √ | √ | √ | √ |
| 17 | √ | √ | √ | √ |
| 18 | √ | √ | √ | √ |
| 19 | √ | √ | √ | √ |
| 20 | √ | √ | √ | √ |
Table 7: liquid-phase chip, order-checking and the Phenotypic examination detected result comparison to drug tolerance of strain
Note: "+" represents resistance, "-" represents responsive;
Embodiment 3: detect described 4 sites simultaneously and detect respectively the comparison in described 4 sites
As above experimental procedure, carries out respectively the detection in 4 sites to 10 resistance samples, and with embodiment 2 in the result that simultaneously described 4 sites detected in a reaction system compare.Detected result is compared as follows table 8.The result of table 8 shows: no matter be, react separately or in a reaction system, described 4 sites detected experimental result there was no significant difference simultaneously.
Table 8: 10 resistance samples are detected the result (sample number 1-10) in 4 sites simultaneously and detect respectively the result (sample number 1A-10A) in 4 sites.
Embodiment 4: detect 5 sites simultaneously and detect the result comparison in 4 sites simultaneously
In order to verify that whether increase site is necessary on the impact of the sensitivity detecting and increase site, newly-increased site inhA-8, wild-type T, saltant type G.For sample 1-20, contrasted the result that detects 5 sites simultaneously and detect 4 sites simultaneously.
Experimental procedure as above, but has increased inhA-8 wild-type (inhA-8-wt) microballoon coding NO.42; InhA-8 saltant type (inhA-8-m) microballoon coding NO.63.InhA-8-wt primer: sequence label: CACTACACATTTATCATAACAAAT; Specific primer sequence: TGGCAGTCACCCCGACAA.InhA-8-m primer: sequence label: CTAAATCACATACTTAACAACAAA; Specific primer sequence: TGGCAGTCACCCCGACAC.The results are shown in following table 9.From table 9 pair two groups of Data Comparisons, when newly adding a detection site, can disturb other sites to detect, and the shared mutation frequency in the site newly adding is very little, so there is no need newly to add detection site, can detect Drug resistance status.This shows, the mutational site of four genes of the present invention is better to the detection of resistance to multiple medicines mycobacterium.
Table 9: detect the result (sample number into spectrum 1B-20B) in 5 sites simultaneously and compare with the result (sample number into spectrum 1-20) that detects 4 sites simultaneously
Claims (12)
1. substance of medicines-resistant branched tubercle bacillus detects a liquid-phase chip, comprising:
1) Auele Specific Primer of tape label sequence, the Auele Specific Primer of each tape label sequence is comprised of the sequence label of 5 ' end and the specific primer sequence of 3 ' end, described specific primer sequence is SEQ ID NO.12-SEQ ID NO.22, and different primers sequence connects different sequence labels;
2) be coated with respectively the microballoon of tag complement, described tag complement is 1) in the complementary sequence of sequence label.
2. the substance of medicines-resistant branched tubercle bacillus of claim 1 detects liquid-phase chip, also comprises:
3) amplimer sequence, described amplimer sequence is: SEQ ID NO.34-SEQ ID NO.39.
3. claim 1 or 2 substance of medicines-resistant branched tubercle bacillus detect liquid-phase chip, and wherein said sequence label length is 10 to 50 Nucleotide.
4. claim 1 or 2 substance of medicines-resistant branched tubercle bacillus detect liquid-phase chip, and described sequence label is SEQ ID NO.1-SEQ ID NO.11, and described tag complement is SEQ ID NO.23-SEQ ID NO.33.
5. the substance of medicines-resistant branched tubercle bacillus of claim 4 detects liquid-phase chip, the Auele Specific Primer of described tape label sequence is respectively: the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.12, the sequence being formed by SEQ ID NO.2 and SEQ ID NO.13, the sequence being formed by SEQ ID NO.3 and SEQ ID NO.14; The sequence being formed by sequence SEQ ID NO.4 and SEQ ID NO.15, the sequence being formed by SEQ ID NO.5 and SEQ ID NO.16, the sequence being formed by SEQ ID NO.6 and SEQ ID NO.17; The sequence being formed by sequence SEQ ID NO.7 and sequence SEQ ID NO.18, the sequence being formed by sequence SEQ ID NO.8 and sequence SEQ ID NO.19, the sequence being formed by sequence SEQ ID NO.9 and SEQ ID NO.20; The sequence being formed by SEQ ID NO.10 and SEQ ID NO.21, the sequence being formed by SEQ ID NO.11 and SEQ ID NO.22.
6. claim 1 or 2 substance of medicines-resistant branched tubercle bacillus detect liquid-phase chip, and described tag complement is connected centre and is also provided with spacerarm sequence with microballoon.
7. the Drug Resistance of Mycobacterium Tuberculosis of claim 6 detects liquid-phase chip, and wherein said spacerarm sequence is 5-10 T.
8. substance of medicines-resistant branched tubercle bacillus detects a liquid-phase chip, comprising:
1) Auele Specific Primer of tape label sequence, it is:
The sequence being formed by SEQ ID NO.1 and SEQ ID NO.12, the sequence being formed by SEQ ID NO.2 and SEQ ID NO.13, the sequence being formed by SEQ ID NO.3 and SEQ ID NO.14;
The sequence being formed by SEQ ID NO.4 and SEQ ID NO.15, the sequence being formed by SEQ ID NO.5 and SEQ ID NO.16, the sequence being formed by SEQ ID NO.6 and SEQ ID NO.17;
The sequence being formed by SEQ ID NO.7 and SEQ ID NO.18, the sequence being formed by SEQ ID NO.8 and SEQ ID NO.19, the sequence being formed by SEQ ID NO.9 and SEQ ID NO.20;
The sequence being formed by SEQ ID NO.10 and SEQ ID NO.21, the sequence being formed by SEQ ID NO.11 and SEQ ID NO.22;
2) be coated with respectively the microballoon of specificity tag complement, described tag complement is 1) in the complementary sequence of sequence label, described tag complement is SEQ ID NO.23-SEQ ID NO.33, in the middle of described tag complement is connected with microballoon, is also provided with spacerarm sequence;
3) amplimer, it is:
SEQ ID NO.34 and SEQ ID NO.35,
SEQ ID NO.36 and SEQ ID NO.37,
SEQ ID NO.38 and SEQ ID NO.39.
9. detect a method for substance of medicines-resistant branched tubercle bacillus, described method, for non-diagnostic purpose, said method comprising the steps of:
1) thereby use amplimer increases, the DNA of a sample obtains PCR product, and PCR product is carried out to purifying, and the sequence of described amplimer is SEQ ID NO.34-SEQ ID NO.39;
2) with described Auele Specific Primer, to carrying out above-mentioned extension product, carry out Auele Specific Primer extension, described Auele Specific Primer is SEQ ID NO.12-SEQ ID NO.22,
If SEQ ID is NO.12, SEQ ID NO.21, SEQ ID NO.15 and SEQ ID NO.18 do not extend, and in SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.22, one of at least extend and SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.19 and SEQ ID NO.20 in one of at least extend, there is substance of medicines-resistant branched tubercle bacillus in so described sample.
10. right to use requires liquid-phase chip described in 1-7 any one to detect a method for substance of medicines-resistant branched tubercle bacillus, and described method, for non-diagnostic purpose, said method comprising the steps of:
1) DNA of a sample of multiplex PCR amplification;
2) described PCR product is carried out to digestion process with exonuclease I and shrimp alkaline phosphotase;
3) with the Auele Specific Primer of described tape label sequence, carry out extension, in extension process, carry out mark;
4) described microballoon and the above-mentioned extension product that is coated with tag complement carried out to hybridization, different tag complement are coated on the microballoon that can mutually distinguish;
5) detect the microballoon that hybridization occurs;
6) by distinguishing microballoon, obtain by the interact type of the Auele Specific Primer that is connected with microballoon of sequence label and tag complement, thus determining step 3) in there is the Auele Specific Primer type of extending,
If SEQ ID is NO.12, SEQ ID NO.21, SEQ ID NO.15 and SEQ ID NO.18 do not extend, and in SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.22, one of at least extend and SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.19 and SEQ ID NO.20 in one of at least extend, there is substance of medicines-resistant branched tubercle bacillus in so described sample.
The method of 11. claims 10, wherein the mark of step 3) is by mixing biotin labeled dCTP so that a plurality of biotin labelings on reacted product band; The detection of step 5) is, after reacting with SA-PE, by fluorescence detector, to detect.
12. primer sequences, described primer sequence is: SEQ ID NO.12-SEQ ID NO.22 and SEQ ID NO.34-SEQ ID NO.39.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210245759.7A CN102719553B (en) | 2012-07-16 | 2012-07-16 | Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210245759.7A CN102719553B (en) | 2012-07-16 | 2012-07-16 | Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102719553A CN102719553A (en) | 2012-10-10 |
| CN102719553B true CN102719553B (en) | 2014-07-30 |
Family
ID=46945418
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210245759.7A Active CN102719553B (en) | 2012-07-16 | 2012-07-16 | Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102719553B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111419720A (en) * | 2019-01-09 | 2020-07-17 | 济宁医学院 | Sputum specimen preservation box for tuberculosis patients and preservation solution in sputum specimen preservation box |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101285062A (en) * | 2008-04-29 | 2008-10-15 | 博奥生物有限公司 | Process for abstracting bacterial DNA from phlegm, kit and uses thereof |
| CN102010907A (en) * | 2010-11-09 | 2011-04-13 | 广州益善生物技术有限公司 | Specific primer and liquid-phase chip for katG, inhA and ndh genetic mutation detection |
| CN102424859A (en) * | 2011-12-31 | 2012-04-25 | 广东凯普生物科技股份有限公司 | Mycobacterium tuberculosis drug-resistant mutant gene detection kit |
-
2012
- 2012-07-16 CN CN201210245759.7A patent/CN102719553B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101285062A (en) * | 2008-04-29 | 2008-10-15 | 博奥生物有限公司 | Process for abstracting bacterial DNA from phlegm, kit and uses thereof |
| CN102010907A (en) * | 2010-11-09 | 2011-04-13 | 广州益善生物技术有限公司 | Specific primer and liquid-phase chip for katG, inhA and ndh genetic mutation detection |
| CN102424859A (en) * | 2011-12-31 | 2012-04-25 | 广东凯普生物科技股份有限公司 | Mycobacterium tuberculosis drug-resistant mutant gene detection kit |
Non-Patent Citations (4)
| Title |
|---|
| 周林甫.液相芯片技术在中枢神经系统感染性疾病诊断中的应用研究.《中国优秀硕士学位论文全文数据库》.2012,(第4期), |
| 液相芯片技术在中枢神经系统感染性疾病诊断中的应用研究;周林甫;《中国优秀硕士学位论文全文数据库》;20120415(第4期);全文 * |
| 液相芯片技术在耐多药结核病检测中的应用;韩明明;《中国优秀硕士学位论文全文数据库》;20121015(第10期);全文 * |
| 韩明明.液相芯片技术在耐多药结核病检测中的应用.《中国优秀硕士学位论文全文数据库》.2012,(第10期),全文. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102719553A (en) | 2012-10-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100569956C (en) | Detect the method and the test kit of mycobacterium tuberculosis and drug-tolerant gene mutation thereof | |
| ES2587604T3 (en) | Multiplexed genomic gain and loss tests | |
| Oliveira et al. | Differentiation of Candida albicans and Candida dubliniensis by fluorescent in situ hybridization with peptide nucleic acid probes | |
| CN102277419B (en) | Method, kit and application for diagnosing thalassemia based on liquid phase chip system | |
| JP2024026210A (en) | Polymerase chain reaction primers and probes for Mycobacterium Tuberculosis | |
| CN110878343A (en) | Cpf1 kit for quickly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof | |
| CN101487051B (en) | Detecting probe and liquid phase chip for BRAF gene mutation and detecting method thereof | |
| CN113584167B (en) | CrRNA, isothermal amplification primer and kit for detecting FLT3-F691L mutation | |
| WO2007083928A1 (en) | Dna chip for diagnosis of corneal dystrophy | |
| CN112899383A (en) | Yersinia pestis detection kit based on real-time fluorescence RPA technology and application thereof | |
| CN105349664A (en) | Gene chip and kit for detecting pathogenic bacteria in cerebrospinal fluid of central nervous system bacterial infected person | |
| EP1781812A1 (en) | Method of detecting mutations in the gene encoding cytochrome p450-2c9 | |
| CN101348829A (en) | Gene chip for detecting Mycotoruloides | |
| CN102719553B (en) | Method for detecting multidrug-resistant mycobacterium tuberculosis, and related primer and liquid-phase chip thereof | |
| CN102719537A (en) | Multidrug-resistant mycobacterium tuberculosis non-fluorescent DNA (deoxyribonucleic acid) microarray detection method and kit | |
| CN103045716B (en) | Method for detecting isoniazid drug resistance of mycobacterium tuberculosis by using pyrosequencing technology | |
| EP3312293A1 (en) | Method for examining microorganism, kit for examining microorganism, microarray for examining microorganism, carrier for detecting mold, method for detecting mold and kit for detecting mold | |
| CN101705301A (en) | Special probe and gene chip used for identifying pathogenic aspergillus | |
| CN105112510A (en) | Gene chip for typing mycobacteria and application method thereof | |
| JP2010515451A (en) | DNA chip for E. coli detection | |
| CN105331718A (en) | Gene chip and kit for detecting pathogenic bacteria in cerebrospinal fluid of fungal infected person in central nervous system | |
| CN102031314A (en) | Primer and probe sequence for human metapneumovirus nucleonic acid detection | |
| WO2010030243A1 (en) | Gene sequences for the detection of chikungunya and dengue fever | |
| KR102276396B1 (en) | A composition and RT-qPCR based chip for detecting avian influenza viruses and method for detecting avian influenza viruses using the same | |
| WO2022216821A1 (en) | Cdi rapid test for covid-19 variants of concern |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |