CN102719519B - Composition and kit for detection of New Delhi metallo-beta-lactamase-1 gene - Google Patents
Composition and kit for detection of New Delhi metallo-beta-lactamase-1 gene Download PDFInfo
- Publication number
- CN102719519B CN102719519B CN201110077025.8A CN201110077025A CN102719519B CN 102719519 B CN102719519 B CN 102719519B CN 201110077025 A CN201110077025 A CN 201110077025A CN 102719519 B CN102719519 B CN 102719519B
- Authority
- CN
- China
- Prior art keywords
- sequence
- primer
- new delhi
- type new
- lactamase gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a composition and a kit for the detection of a New Delhi metallo-beta-lactamase-1 gene, comprising related sequences shown in SEQ ID No: 1-2 or nucleotide fragments comprising at least continuous 10 nucleotides of the sequences shown in SEQ ID No: 1-2, or specific primers with at most 5 nucleotides different from the sequences showed in SEQ ID No: 1-2 and the nucleotide fragments comprising at least continuous 10 nucleotides of sequences shown in SEQ ID No: 1-2; and a sequence showed in SEQ ID No: 3 or a complementary sequence thereto or nucleotide fragments comprising at least continuous10 nucleotides of the sequence showed in SEQ ID No: 3 or of the complementary sequence thereto, or specific primers with at most 5 nucleotides different from the sequence showed in SEQ ID No: 3, the complementary sequence thereto and the nucleotide fragments comprising at least continuous10 nucleotides of the sequence showed in SEQ ID No: 3 or of the complementary sequence thereto. The composite and the kit is characterized by high sensitivity, good specificity, quick reaction, few false positives and low cost, and is suitable for large scale detecting and screening; thereby realizes quick, effective and accurate detection of the New Delhi metallo-beta-lactamase-1 gene, thus ensuring timely diagnosis and treatment of cases of illness, accurate aetiology investigation and scientific policymaking of prevention and control of the illness.
Description
Technical field
The present invention relates to a kind of composition for detection of β-lactamase gene and test kit, particularly, the present invention relates to composition and test kit for detection of I type New Delhi metallo-β-lactamase gene.
Background technology
β-lactamase can be hydrolyzed beta-lactam antibacterials, can be divided into A, B, C and tetra-large classes of D according to its molecular structure.Wherein, category-B β-lactamase claims again metallo-β-lactamase, and its substrate that can be hydrolyzed comprises the microbiotic such as penicillin, cephamycin and carbapenems.The metallo-β-lactamase of having found comprises the types such as IMP, VIM, GIM, SIM, SPM.
New Delhi metal-beta-lactamase (New Delthi Metallo-β-Lactamase I, NDM-1) gene is a kind of new metal beta lactamase gene; The bacterium (mostly being Gram-negative bacteria) of carrying this gene can produce resistance to nearly all microbiotic, is commonly called as " superbacteria ".Described NDM-1 gene can also lateral transport be given other pathogenic bacterium, and presents same resistance, greatly increases the difficulty for the treatment of.Described NDM-1 gene originates from the Indian subcontinent, and the antibiotic abuse phenomenon in this area is extremely serious.The pathogenic bacterium of carrying at present this gene have been transmitted to multiple countries, have found more than 200 cases of infection, and have many cases death.The first case example was found in China Hongkong in 2009.At present, China mainland has been found the existence of NDM-1 gene, has found that case there is no the popular medical history that can examine, considers that China also exists the phenomenon of serious abuse of antibiotics, and producing the general drug-resistant bacteria of NDM-1 may exist in China's certain limit.
But because for the new drug of NDM-1 gene, especially still there is hysteresis for the Gram-negative bacteria microbiotic that carries NDM-1 gene in research and development; Once therefore occur by the wide-scale distribution of the caused disease of pathogenic bacterium that carries NDM-1 gene, will face the situation almost pasting medical help.Therefore, NDM-1 gene is the significant threat of human health.
To sum up need the product that can realize fast, effectively and accurately detect I type New Delhi metallo-β-lactamase gene badly for case diagnosis and treatment, Etiological and prevention and control policy making.
Summary of the invention
The object of the invention is to solve the problem that prior art lacks the product that detects I type New Delhi metallo-β-lactamase gene, a kind of composition for detection of I type New Delhi metallo-β-lactamase gene is provided, use said composition can realize the detection fast, effectively and accurately to I type New Delhi metallo-β-lactamase gene, guarantee the prevention and control policy making of case diagnosis and treatment timely, accurately Etiological and science.
Second object of the present invention is to provide the test kit for detection of I type New Delhi metallo-β-lactamase gene that comprises described composition.
The invention provides a kind of composition for detection of I type New Delhi metallo-β-lactamase gene, wherein, described composition comprises following sequence:
1) length is first primer for pcr amplification I type New Delhi metallo-β-lactamase gene of 10-19 Nucleotide, and the sequence of this primer comprises:
A) sequence shown in SEQ ID No:1,
B) the continuous fragment of at least 10 Nucleotide of the sequence shown in SEQ ID No:1, or
C) and a) or b) there is the sequence of 5 nucleotide differences at the most;
2) length is second primer for pcr amplification I type New Delhi metallo-β-lactamase gene of 10-18 Nucleotide, and the sequence of this primer comprises:
A) sequence shown in SEQ ID No:2,
B) the continuous fragment of at least 10 Nucleotide of the sequence shown in SEQ ID No:2, or
C) and a) or b) there is the sequence of 5 nucleotide differences at the most;
3) length be 10-24 Nucleotide with 1) and 2) oligonucleotide probe of the pcr amplification product hybridization of described primer, the sequence of this probe comprises:
A) sequence shown in SEQ ID No:3 or its complementary sequence, or
B) the continuous fragment of at least 10 Nucleotide of the sequence shown in SEQ ID No:3,
C) the continuous fragment of at least 10 Nucleotide of the complementary sequence of sequence shown in SEQ ID No:3,
Or d) and a) or b) or c) there is the sequence of 5 nucleotide differences at the most;
Wherein, 3) described probe at 5 ' end with mutually different fluorescence report group, and on any one position except 5' end with fluorescent quenching group.
The present invention also provides a kind of test kit for detection of I type New Delhi metallo-β-lactamase gene, and this test kit contains polymerase chain reaction liquid and hot resistant DNA polymerase, and wherein, described test kit also contains composition of the present invention.
Composition and test kit for detection of I type New Delhi metallo-β-lactamase gene of the present invention, susceptibility is high, specificity good, reaction is quick, false positive is few and cost is low, is applicable to large-scale detection and examination; The detection fast, effectively and accurately to I type New Delhi metallo-β-lactamase gene can be realized, thereby the prevention and control policy making of case diagnosis and treatment timely, accurately Etiological and science can be guaranteed.Accompanying drawing explanation
Fig. 1 is the electrophoresis photo of the embodiment of the present invention 1 gained pcr amplification product after the metallo-β-lactamase gene target nucleic acid sequence of PCR primer amplification I type New Delhi;
Fig. 2 is 10
2copies/ml, 10
3copies/ml, 10
4copies/ml, 10
5copies/ml, 10
6copies/ml, 10
7copies/ml, 10
8copies/ml, 10
9copies/ml and 10
10the quantitative fluorescent PCR figure of the I type New Delhi metallo-β-lactamase gene masculine reference substance of copies/ml;
Fig. 3 is the quantitative fluorescent PCR figure that the embodiment of the present invention 1 detects preparation example 1 and simulate I type New Delhi metallo-β-lactamase gene in sample to be tested;
Fig. 4 is the quantitative fluorescent PCR figure that the embodiment of the present invention 1 detects I type New Delhi metallo-β-lactamase gene in mouse intestinal fecal matter sample;
Fig. 5 is the quantitative fluorescent PCR figure that the embodiment of the present invention 2 detects I type New Delhi metallo-β-lactamase gene in mouse intestinal fecal matter sample;
Fig. 6 is the quantitative fluorescent PCR figure that the embodiment of the present invention 3 detects I type New Delhi metallo-β-lactamase gene in mouse intestinal fecal matter sample;
Fig. 7 is the quantitative fluorescent PCR figure that the embodiment of the present invention 4 detects I type New Delhi metallo-β-lactamase gene in mouse intestinal fecal matter sample;
Fig. 8 is the quantitative fluorescent PCR figure that the embodiment of the present invention 5 detects I type New Delhi metallo-β-lactamase gene in mouse intestinal fecal matter sample;
Fig. 9 is the quantitative fluorescent PCR figure that the embodiment of the present invention 6 detects I type New Delhi metallo-β-lactamase gene in mouse intestinal fecal matter sample;
Figure 10 is the quantitative fluorescent PCR figure that the embodiment of the present invention 7 detects I type New Delhi metallo-β-lactamase gene in mouse intestinal fecal matter sample.
Embodiment
The invention provides a kind of composition for detection of I type New Delhi metallo-β-lactamase gene, wherein, described composition comprises following sequence:
1) length is first primer for pcr amplification I type New Delhi metallo-β-lactamase gene of 10-19 Nucleotide, and the sequence of this primer comprises:
A) sequence shown in SEQ ID No:1,
B) the continuous fragment of at least 10 Nucleotide of the sequence shown in SEQ ID No:1, or
C) and a) or b) there is the sequence of 5 nucleotide differences at the most;
2) length is second primer for pcr amplification I type New Delhi metallo-β-lactamase gene of 10-18 Nucleotide, and the sequence of this primer comprises:
A) sequence shown in SEQ ID No:2,
B) the continuous fragment of at least 10 Nucleotide of the sequence shown in SEQ ID No:2, or
C) and a) or b) there is the sequence of 5 nucleotide differences at the most;
3) length be 10-24 Nucleotide with 1) and 2) oligonucleotide probe of the pcr amplification product hybridization of described primer, the sequence of this probe comprises:
A) sequence shown in SEQ ID No:3 or its complementary sequence, or
B) the continuous fragment of at least 10 Nucleotide of the sequence shown in SEQ ID No:3,
C) the continuous fragment of at least 10 Nucleotide of the complementary sequence of sequence shown in SEQ ID No:3,
Or d) and a) or b) or c) there is the sequence of 5 nucleotide differences at the most;
Wherein, 3) described probe at 5 ' end with mutually different fluorescence report group, and on any one position except 5' end with fluorescent quenching group.
In the present invention, " primer " can be oligonucleotide natural, synthetic or that the two is chimeric.Primer can be used as the starting point that induce dna copies under certain condition.Can bring out under these conditions the primer extension product with target nucleic acid chain complementation, under four kinds of different triphosphoric acid dezyribonucleosides and a kind of polymerization agent (archaeal dna polymerase or reversed transcriptive enzyme) existence, in a kind of suitable damping fluid, at suitable temperature, carry out above-mentioned amplification.Preferred primer is strand oligodeoxyribonucleotide.The appropriate length of primer depends on the designed use of this primer, but generally between 10-20 (preferably 10-19 or 10-18) Nucleotide, shorter primer molecule needs lower temperature conventionally, thereby forms fully stable hybridization complex with template.Primer needn't reflect the accurate sequence of template, but must be fully complementary, to hybridize with template and to cause DNA and synthesize.
In the present invention, term " probe " refers to one section of single stranded DNA or the RNA molecule of the tape label that can identify specific nucleotide sequence, and it is only combined with detected specific nucleotide sequence.Probe location is positioned as close to upstream primer.For guaranteeing binding specificity, the appropriate length of probe is generally between 10-25 (preferably 10-24) Nucleotide.
In addition, as well known to those skilled in the art, the variation of minority nucleotide residue on primer and probe, the change of the minority Nucleotide that especially primer and probe occur at 5 ' end, can only cause the mispairing of this Nucleotide, but can not cause whole DNA replication dna building-up process to carry out, and then can not cause the obvious fluctuation of PCR product output.Therefore also can obtain correct enough PCR fluorescent signals by above-mentioned " with a) or b) having the sequence of 5 nucleotide differences at the most " and " with a) or b) or c) having the sequence of 5 nucleotide differences at the most ", therefore described sequence also should comprise in the present invention.
In addition, can implement the modification of this area routine to primer/probe of the present invention to improve its stability, for example, sulfuration (the non-bridging oxygen atom on phosphoric acid skeleton is replaced by sulphur atom), methylate, form peptide nucleic acid(PNA) and introduce as the substituting group of methyl and/or fluorine etc. in 2 ' position of ribose etc.
Preferably, composition of the present invention comprises following sequence:
1) length is first primer for pcr amplification I type New Delhi metallo-β-lactamase gene of 15-19 Nucleotide, and the sequence of this primer comprises:
A) sequence shown in SEQ ID No:1,
B) the continuous fragment of at least 15 Nucleotide of the sequence shown in SEQ ID No:1, or
C) and a) or b) there is the sequence of 2 nucleotide differences at the most;
2) length is second primer for pcr amplification I type New Delhi metallo-β-lactamase gene of 15-18 Nucleotide, and the sequence of this primer comprises:
A) sequence shown in SEQ ID No:2,
B) the continuous fragment of at least 15 Nucleotide of the sequence shown in SEQ ID No:2, or
C) and a) or b) there is the sequence of 2 nucleotide differences at the most;
3) length be 15-24 Nucleotide with 1) and 2) oligonucleotide probe of the pcr amplification product hybridization of described primer, the sequence of this probe comprises:
A) sequence shown in SEQ ID No:3 or its complementary sequence, or
B) the continuous fragment of at least 15 Nucleotide of the sequence shown in SEQ ID No:3,
C) the continuous fragment of at least 15 Nucleotide of the complementary sequence of sequence shown in SEQ ID No:3,
Or d) and a) or b) or c) there is the sequence of 2 nucleotide differences at the most;
Wherein, 3) described probe at 5 ' end with mutually different fluorescence report group, and on any one position except 5' end with fluorescent quenching group.
Further preferably, composition of the present invention is made up of following sequence:
1), for pcr amplification I type New Delhi metallo-β-lactamase gene the first primer, the sequence of this primer is the sequence as shown in SEQ ID No:1;
2), for pcr amplification I type New Delhi metallo-β-lactamase gene the second primer, the sequence of this primer is the sequence as shown in SEQ ID No:2;
3) with 1) and 2) oligonucleotide probe that the pcr amplification product of described primer is hybridized, the sequence of this probe is sequence or its complementary sequence as shown in SEQ ID No:3;
Wherein, 3) described probe at 5 ' end with mutually different fluorescence report group, and on any one position except 5' end with fluorescent quenching group.
On composition middle probe of the present invention with described fluorescence report group and described fluorescent quenching group can be the conventional material as fluorescence report group and fluorescent quenching group in this area.As long as meet described fluorescence report gene in the upstream of described fluorescent quenching group, and the emission wavelength of described fluorescence report group is less than the absorbing wavelength of described fluorescent quenching group.Described fluorescence report group and described fluorescent quenching group can select free 6-Fluoresceincarboxylic acid (6-carboxyfluorescein according to mentioned above principle, FAM), tetrachloro-6-Fluoresceincarboxylic acid (tetrachloro-6-carboxyfluorescein, TET), chlordene-6-methyl fluorescein (Hexachloro-6-methylfluorescein, HEX), 6-carboxyl tetramethyl-rhodamine (6-carboxytetramethylrhodamine, TAMRA), sulphonyl rhodamine (Sulforhodamine101, Texas Red), carboxyl-X-rhodamine (Carboxy-x-rhodamine, ROX), flower cyanines 3(cyanine3, Cy3), flower cyanines 3.5(cyanine3.5, Cy3.5), flower cyanines 5(cyanine5, Cy5), flower cyanines 5.5(cyanine5.5, Cy5.5), biological search technique (the Biosearch Technologies of company, Inc) black hole quencher 1(Black Hole Quencher1, BHQ1), black hole quencher 2(Black Hole Quencher2, BHQ2), black hole quencher 3(Black Hole Quencher3, BHQ3), 4-(4-dimethylamino phenylazo-) phenylformic acid (4-(4 '-dimethylaminophenylazo) benzoic acid, DABCYL), 6-carboxyl-4 ', 5 '-bis-chloro-2 ', 7 '-dimethoxy fluorescein succinimide ester (6-Carboxy-4 ', 5 '-dichloro-2 ', 7 '-dimethoxyfluorescein, JOE) and in the group that forms of the VIC fluorescence dye of Applied biosystems.Preferably, described fluorescence report group selects free 6-Fluoresceincarboxylic acid, chlordene-6-methyl fluorescein, VIC fluorescence dye, tetrachloro-6-Fluoresceincarboxylic acid, carboxyl-X-rhodamine, 6-carboxyl tetramethyl-rhodamine, sulphonyl rhodamine, 6-carboxyl-4 ', in the group that 5 '-bis-chloro-2 ', 7 '-dimethoxy fluorescein succinimide esters, Hua Jing 3, Hua Jing 5 and Hua Jing 5.5 form; Described fluorescent quenching group selects in the group that free 6-carboxyl tetramethyl-rhodamine, 4-(4-dimethylamino phenylazo-) phenylformic acid, BHQ1, BHQ2 and BHQ3 form.More preferably, according to selecting fluorescence report group and fluorescent quenching group shown in following table 1.
Table 1
| Fluorescent quenching group | Fluorescence report group |
| DABCYL | 6-FAM, TET, JOE and HEX, one or more in Cy3 |
| TAMRA | 6-FAM, TET, one or more in JOE and HEX |
| BHQ1 | 6-FAM, TET, JOE and HEX, one or more in Cy3 |
| BHQ2 | TAMRA, Cy3, one or more in ROX and Texas Red |
| BHQ3 | Cy5 and/or Cy5.5 |
Most preferably, described fluorescence report group is 6-FAM; Described fluorescent quenching group is BHQ1.
Can, by having required the synthetic company of primer in synthetic primer and probe, add described fluorescence report group and fluorescent quenching group as fluorescent mark.Described primer Synesis Company includes but not limited to, for example, Bai Ye trade (Shanghai) Co., Ltd. (Bioneer), Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, precious biotechnology (Dalian) company limited, Shanghai Ying Jun Bioisystech Co., Ltd etc.
Can adopt the conventional PCR instrument in this area to complete fluorescent PCR quantitative and qualitative analysis process of the present invention.Described PCR instrument includes but not limited to, for example, and Applied biosystems (ABI): ABI7000 type, 7300 types, 7500 types, 7700 types, 7900 types and StepOne type quantitative real time PCR Instrument etc.; The Mastercycler ep realplex of Eppendorf AG of Germany (Eppendorf AG) etc.; Roche Holding Ag of Switzerland (Roche Group): LightCycler2.0, LightCycler480 and Rotor-Gene3000 etc.; Stratagene company of the U.S.: Mx3005P, Mx3000P, Mx4000 etc.; Reach peace gene: DA7600 etc.; Rich day: LineGene I, LineGene II, LineGene K, LineGene3310/3320 and LineGene9600 etc.; And the SLAN of grand stone etc.
The present invention also provides a kind of test kit for detection of I type New Delhi metallo-β-lactamase gene, and this test kit contains polymerase chain reaction liquid and hot resistant DNA polymerase, and wherein, described test kit also contains composition of the present invention.Test kit of the present invention is except using composition of the present invention as primer and probe, and other moietys of test kit can be used the conventional PCR detection method composition used in this area.Such as using this area conventional polymerase chain reaction liquid and hot resistant DNA polymerase.In addition,, due to the specificity of test kit of the present invention and highly sensitive, even if do not use positive reference substance, if biological specimen to be measured has produced PCR fluorescent signal, patient diagnosed infects has the accuracy rate of superbacteria also can reach more than 90%.Therefore test kit of the present invention can not contain positive reference substance.In addition, test kit of the present invention can also not contain negative control product.
Certainly, test kit of the present invention can comprise positive reference substance, for example, in the group that the NDM-1 complete genome sequence from GenBank shown in SEQ ID No.4 (GenBank Nucleotide accession number (nucleotide accession number) FN396876) and I type New Delhi metallo-β-lactamase gene amplification product form.Described I type New Delhi metallo-β-lactamase gene amplification product can be the continuous gene fragment that at least comprises SEQ ID No:5 of I type New Delhi metallo-β-lactamase complete genome.Be that positive reference substance can be the complete genome shown in SEQ ID No:4, gene amplification product shown in SEQ ID No:5, and than the length of sequence shown in SEQ ID No:5 and other I type New Delhi metallo-β-lactamase gene amplification products shorter than I type New Delhi metallo-β-lactamase complete genome sequence.Described positive reference substance is preferably the I type New Delhi metallo-β-lactamase gene amplification product as shown in SEQ ID No:5.The concentration of described positive reference substance reaches and can produce enough fluorescent signals.Test kit of the present invention both can carry out qualitative detection to the I type New Delhi metallo-β-lactamase gene in sample to be tested, also can carry out detection by quantitative to the I type New Delhi metallo-β-lactamase gene in sample to be tested.In the time carrying out qualitative detection, only need to use the positive reference substance of a concentration, and the fluorescent signal that the fluorescent signal that sample to be tested is obtained and positive reference substance obtain relatively; In the time carrying out detection by quantitative, need to use the positive reference substance of a series of gradient concentrations, obtaining after their typical curves, the fluorescent signal that sample to be tested is obtained quantizes to compare with condition after the same method.Preferably, described positive criteria product are 10
3-10
8the I type New Delhi metallo-β-lactamase gene plasmid DNA solution of copies/ml.They can form from 10
3copies/ml to 10
8the concentration gradient of copies/ml, between every two adjacent gradients, concentration differs 10 times.Preferably the concentration of positive criteria product is 10
5-10
8copies/ml.
DNA fragmentation is connected on plasmid, is conducive to the stable preservation of DNA fragmentation.I type of the present invention New Delhi metallo-β-lactamase gene plasmid DNA is made up of I type New Delhi metallo-β-lactamase gene DNA fragment and plasmid vector, in the group that complete genome and the I type New Delhi metallo-β-lactamase gene amplification product that described I type New Delhi metallo-β-lactamase gene DNA fragment is the I type New Delhi metallo-β-lactamase as shown in SEQ ID No:4 formed.Described I type New Delhi metallo-β-lactamase gene amplification product can be the continuous gene fragment that at least comprises SEQ ID No:5 of I type New Delhi metallo-β-lactamase complete genome.Be that described I type New Delhi metallo-β-lactamase gene DNA fragment can be the complete genome shown in SEQ ID No:4, gene amplification product shown in SEQ ID No:5, and than the length of sequence shown in SEQ ID No:5 and other I type New Delhi metallo-β-lactamase gene amplification products shorter than I type New Delhi metallo-β-lactamase complete genome sequence.Described I type New Delhi metallo-β-lactamase gene DNA fragment is preferably the I type New Delhi metallo-β-lactamase gene amplification product as shown in SEQ ID No:5.Described I type New Delhi metallo-β-lactamase gene amplification product as shown in SEQ ID No:5 increases from the complete genome of I type New Delhi metallo-β-lactamase.Described plasmid vector can, for sticky end cloning vector, can be also blunt ends cloning vector.The nonrestrictive example of described plasmid vector comprises pKK plasmid (Clonetech), pUC plasmid, pET plasmid, pTriex plasmid (Novagen, Inc., Madison, Wl), pRSET, pREP plasmid (Invitrogen, San Diego, CA), pMAL plasmid (New England Biolabs, Beverly, MA), and pEASY T plasmid (Beijing Quanshijin Biotechnology Co., Ltd).Particularly, pEASY T plasmid can be the plasmid that is selected from pGCsi-U6/Hygro/GFP, pDC316-EGFP-U6, pRNAT-U6.2/Lenti, PDC315, PDC316, PDC316-IRES-EGFP, PDC316-CMV-EGFP, PDC316-Myc-CMV-EGFP, pLV3-lacZ alpha, psnav2.0, pSNAV2.0-IRES-EGFP-LacZ alpha2 and psnav1.0-CMV-EGFP.
Can adopt the method for this area routine to prepare plasmid DNA solution, DNA fragmentation (I type New Delhi metallo-β-lactamase gene is the sequence shown in SEQ ID No:4) is connected on plasmid.For example DNA fragmentation (can add that synthetic joint is to produce sticky end at blunt end), after two kinds of endonuclease double digestions, is inserted into and adopts on the sticky end plasmid vector processed of same two enzymes or DNA fragmentation is directly connected on pEASY T plasmid (blunt ends cloning vector) by T4 phage DNA ligase enzyme.Described endonuclease can use the conventional endonuclease in this area, for example Aat II, Acc I, Acc II (FnuD II), Acc III (BspM II), Afa I (Rsa I), Afl II, Alu I, Aor13H I (BspM II, Acc III), Aor51H I (Eco47III), Apa I, ApaL I, Bal I, BamH I, Ban II (HgiJ II), BciT130I (EcoR II), Bcn I (Cau II), Bgl I, Bgl II, Bln I (Avr II), BmeT110I (Ava I), BmgT120I (Asu I, Cfr13I), Bpu1102I (Esp I), Bsp1286I (Sdu I), Bsp1407I, BspT104I (Asu II, Nsp V), BspT107I (HgiC I), BssH II (BseP I), Bst1107I (Sna I), BstP I (BstE II, EcoO65I), BstX I, Cfr10I, Cla I, Cpo I (Rsr II), Dra I (Aha III), Eae I (Cfr I), Eam1105I, Eco52I (Xma III), Eco81I (Sau I), EcoO109I (Dra II), EcoO65I (BstE II, BstP I), EcoR I, EcoR V, EcoT14I (Sty I), EcoT22I (Ava III), Fba I (Bcl I), Fok I, Hae II, Hae III, Hap II (Hpa II, Msp I), Hha I, Hin1I (Acy I, Bbi II), Hinc II (Hind II), Hind III, Hinf I, Hpa I, Kpn I, Mbo I (Sau3A I), Mbo II, Mfl I (Xho II), Mlu I, Msp I (Hpa II, Hap II), Mun I (Mfe I), Nae I, Nco I, Nde I, Nhe I, Not I, Nru I, Nsb I (Avi II, Mst I), PmaC I, PshA I, PshB I (Vsp I), Psp1406I (Acl I), Pst I, Pvu I, Pvu II, Sac I, Sac II, Sal I, Sau3A I (Mbo I), Sca I, Sfi I, Sma I, Smi I (Swa I), SnaB I, Spe I, Sph I, Sse8387I, Ssp I, Stu I, Taq I (TthHB8I), Tth111I, Van91I (PflM I), VpaK11B I (Ava II), Xba I, Xho I and Xsp I (Bfa I, Mae I).
Certainly, test kit of the present invention can also comprise negative control product.The described negative control product of test kit of the present invention can be the conventional various negative control product in this area, only otherwise produce interfering fluorescent signal.Described negative control product are generally water, are preferably selected from the group being made up of distilled water, deionized water, water for injection, redistilled water and ultrapure water.
Test kit of the present invention can also comprise the working instructions of test kit.The using method that the working instructions of described test kit are recorded can be the using method of the conventional test kit in this area.Preferably, the working instructions of described test kit have been recorded the PCR method that coordinates primer and the probe with different lengths.For example, the different PCR condition of recording in following examples.
Can extract the total DNA in sample to be tested according to the method for this area routine and condition, take this total DNA as masterplate, add composition of the present invention, complete pcr amplification process.The method of for example recording in " Li Jinming, real-time fluorescence PCR technology, People's Medical Officer Press, 2007 ".Being suitable for using the sample to be tested of test kit of the present invention can be under animal body (comprising human body) state of health and the various body fluid that produce under pathological state, for example: tumour hydrops of blood, lymph liquid, celiolymph, gastric juice and various Digestive system, seminal fluid, saliva, tear, sweat, urine, vaginal secretion, milk, amniotic fluid, bile, pleura hydrops (claim not only hydrothorax), segmental bronchus liquid, folliculi liquor, seroperitoneum (but also claiming ascites), pericardium hydrops, hydrarthrosis, each organ etc., and various elutants, for example nasal cavity elutant.Preferably, the sample that described test kit detects selects in the group that free enteron aisle movement, blood, saliva and nasal cavity elutant form.In addition, in order to obtain more detection copy, preferably, with condition, the sample of clinical collection is carried out to separating of bacterium and cultivation according to the method for this area routine, then the bacterial cultures or the enrichment liquid that separate and/or cultivate are extracted to total DNA, take this total DNA as masterplate, add composition of the present invention afterwards, complete pcr amplification process.
Primer/probe involved in the present invention can obtain by the method for pcr amplification method, recombination method or synthetic conventionally.For example, those skilled in the art, according to the nucleotide sequence of primer/probe involved in the present invention, can be easy to utilize PCR to increase and obtain relevant sequence.When sequence is longer, can carry out twice or pcr amplification repeatedly, then gained fragment be pressed to proper order splicing.In addition, also can synthesize relevant nucleotide sequence by the synthetic method of known artificial chemistry.For example, primer is synthetic can adopt solid phase tris phosphite method, and the purification process that is synthesized primer is polyacrylamide gel (PAGE) electrophoresis.Primer after dilution, uses ultraviolet spectrophotometer to detect before use, again quantitative, guarantees its A260/A280>1.7.The synthetic of probe can adopt solid phase tris phosphite method, and fluorescence report group (Reporter) is connected up with fluorescent quenching group (Quencher).What probe purification process adopted is sex change high performance liquid chromatography (dHPLC) purifying on polyacrylamide gel (PAGE) electrophoresis basis, the first step is before connecting fluorescent quenching group, remove most of impurity with PAGE electrophoresis, the impurity that particularly can be connected with fluorescent quenching group, to improve the efficiency of connection and purifying work of fluorescent quenching group.Second step is after having connected fluorescent quenching group, to have used PAGE electrophoresis under certain condition by other Impurity removals again, to obtain the product that purity is higher.The 3rd step is carried out purifying by probe by dHPLC, and check product after purifying its go out peak position and purity, then use ultraviolet spectrophotometer under 260nm wavelength quantitatively.Probe after dilution, uses ultraviolet spectrophotometer to detect before use, again quantitative, guarantees its A260/A280>1.7.
Below in conjunction with drawings and Examples, the present invention is further detailed explanation.
Following examples are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in embodiment, conventionally with reference to normal condition, the people such as such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.Unless stated otherwise, all ingredients that the present invention uses all can be purchased, and also can adopt the conventional method preparation in this area.
Preparation example 1 adopts solid phase tris phosphite method to synthesize I type New Delhi metallo-β-lactamase gene (Genbank Accession:FN396876) fragment, then obtains this full length gene by splicing, i.e. DNA sequence dna shown in SEQ ID No:4.The DNA sequence dna of gained is directly connected on pSTV28DNA carrier by T4 phage DNA ligase enzyme, and pSTV28DNA carrier is purchased from precious biological (Takara) company.
Then the plasmid vector with complete NDM-1 gene is transformed to intestinal bacteria (using the Trans5 α Chemically Competent Cell of Beijing Quanshijin Biotechnology Co., Ltd), after screening positive clone, extract plasmid (using the little extraction reagent kit of high purity plasmid of TIANGEN Biotech (Beijing) Co., Ltd., TIANpure Mini Plasmid Kit).A part of amplified production to gained plasmid DNA checks order, and proves that the DNA fragmentation that described amplification obtains has the sequence shown in SEQ ID No:4.Plasmid vector with complete NDM-1 gene is transformed to intestinal bacteria and cultivate in a large number, extract plasmid, the simulation sample to be tested of making 106 copies/ml is for subsequent use.
Preparation example 2
After the conversion intestinal bacteria enlarged culturing of the plasmid vector with complete NDM-1 gene that preparation example 1 is obtained, centrifugal removal substratum, and collect viable bacteria body, with 0.9% physiological saline washing three times, be then prepared into 10 with 0.9% physiological saline
4the bacteria suspension of cells/ml.Prepare in addition 10
4the intestinal bacteria bacteria suspension and 10 that does not transform any plasmid of cells/ml
4the only conversion of cells/ml is the intestinal bacteria bacteria suspension of free plasmid vector.
The kunming mice (purchased from Department Of Medicine, Peking University) that body weight is 25～30 grams is divided into three groups at random, and 20 every group, male and female half and half, normal drinking water, simultaneously 1 milliliter of intestinal bacteria bacteria suspension of gavage.Wherein, A group is as blank group, and gavage gives the intestinal bacteria bacteria suspension that does not transform any plasmid of 1 milliliter, and B group is as negative control group, gavage give 1 milliliter only transform the intestinal bacteria bacteria suspension that is free plasmid vector.C group gives the conversion intestinal bacteria bacteria suspension of the plasmid vector with complete NDM-1 gene that the preparation example 1 of 1 milliliter obtains as to be measured group of gavage.Collect respectively mouse after first 1 day of gavage, gavage the 1st day, the 5th day, the enteron aisle movement of the 10th day and the 20th day.
Add respectively the physiological saline of 10 times of volumes to gained enteron aisle fecal matter sample, after stirring, leave standstill, get on the LB solid plate substratum that 100 μ l supernatant liquors are seeded to chlorampenicol resistant 37 ℃ of incubated overnight for every kind.Three groups of mouse, in gavage all enteron aisle fecal matter sample of collecting of first 1 day, all do not separate and obtain any bacterium colony on solid plate.As the A group of blank group, gavage gives the intestinal bacteria bacteria suspension that does not transform any plasmid of 1 milliliter, after gavage the 1st day, the 5th day, the 10th day and the enteron aisle fecal matter sample collected for the 20th day did not yet all separate and obtain any bacterium colony on solid plate.
As the B group of negative control group with as the C group of to be measured group, after gavage the 1st day, the 5th day, the 10th day and the enteron aisle fecal matter sample collected for the 20th day all separated and have obtained positive colony bacterium colony on solid plate.Picking positive colony bacterium colony, extracts respectively total DNA of above-mentioned sample according to Section of four method that 73-74 page is recorded of the 4th chapter in " Li Jinming, real-time fluorescence PCR technology, People's Medical Officer Press, 2007 ", it is for subsequent use that every increment originally obtains total DNA solution 20 μ l.Wherein B1, B5, B10 and B20 represent that respectively 20 mouse of B group were at the 1st day, the 5th day, the 10th day and the sample that samples for the 20th day these four days; C1, C5, C10 and C20 represent that respectively 20 mouse of C group were at the 1st day, the 5th day, the 10th day and the sample that samples for the 20th day these four days.
(1) adopt the cited sequence of solid phase tris phosphite method synthetic table 2:
Table 2
| Primer/probe | Sequence (5 ' → 3 ') |
| I type New Delhi metallo-β-lactamase gene the first primer | CAGCCACCAAAAGCGATGT |
| I type New Delhi metallo-β-lactamase gene the second primer | CGGCCACACCAGTGACAA |
| I type New Delhi metallo-β-lactamase gene probe | FAM-5’-CCGTCGATCCCAACGGTGATATTG-3’-BHQ1 |
(2) PCR reaction amplified target sequence, prepare positive reference substance:
DNA masterplate: simulation sample to be tested 3 μ l prepared by preparation example 1;
The each 0.25 μ mol/L of two kinds of primers shown in table 2;
The TaqMan genetic expression premixed liquid (TaqMan Gene Expression Master Mix) of Applied biosystems (ABI), 20 μ l
Be supplemented to 40 μ l with purified water.
94 ℃, 4 minutes, 1 circulation,
94 ℃, 15 seconds, 60 ℃, 35 seconds, 40 circulations.
To the DNA cloning product obtaining, at 80V, under the condition of 50 minutes, carry out 1.5% agarose gel electrophoresis, electrophoresis result is shown in Fig. 1.In Fig. 1, two swimming lanes are respectively PCR product and the DNA molecular amount mark (marker) of I type New Delhi metallo-β-lactamase gene from right to left.DNA marker is the 100bp DNA ladder shape mark (Ladder Marker) of precious biological (Takara) company, and band is from top to bottom followed successively by 1500bp, 1000bp, 900bp, 800bp, 700bp, 600bp, 500bp, 400bp, 300bp, 200bp and 100bp.
PCR product is cut after glue purification and (used Germany's sepharose fast and essence (Qiagen) company limited to reclaim test kit, MinElute Gel Extraction Kit), after single band is reclaimed, (use the T plasmid kit of Beijing Quanshijin Biotechnology Co., Ltd with T plasmid respectively, pEASY-T3Cloning Kit) be connected, transform intestinal bacteria (using the Trans5 α Chemically Competent Cell of Beijing Quanshijin Biotechnology Co., Ltd), after screening positive clone, extract plasmid and (use the little extraction reagent kit of high purity plasmid of TIANGEN Biotech (Beijing) Co., Ltd., TIANpure Mini Plasmid Kit), and detect with quantitative with ultraviolet spectrophotometer.A part of amplified production to gained plasmid DNA checks order, and proves that the DNA fragmentation that described amplification obtains has the sequence shown in SEQ ID No:5.
To the remaining part stepwise dilution of plasmid DNA, obtain successively 10 respectively
2, 10
3, 10
4, 10
5, 10
6, 10
7, 10
8, 10
9, 10
10the concentration gradient of copies/ml, obtains the positive reference substance of gradient concentration.The operation more than relating to completes according to the method for recording in " molecular cloning experiment guide " (third edition, 2002[U.S. of Science Press] J. Pehanorm Brooker D.W Russell work, Huang Peitang etc. translate).
(3) fluorescent PCR detects sample to be tested
DNA masterplate: the simulation sample to be tested plasmid DNA solution that preparation example 1 obtains, 5 μ l
Or the enteron aisle fecal matter sample total DNA extraction liquid of preparation 2 separation that obtain, 5 μ l
Or the positive reference substance of step (2), 5 μ l(concentration gradient solution)
The first primer 0.5 μ mol/L shown in table 2;
The second primer 0.25 μ mol/L shown in table 2;
Kind probe 0.5 μ mol/L shown in table 2;
The TaqMan genetic expression premixed liquid (TaqMan Gene Expression Master Mix) of Applied biosystems (ABI), 12.5 μ l
Be supplemented to 25.0 μ l with purified water.
94 ℃, 4 minutes, 1 circulation,
94 ℃, 15 seconds, 60 ℃, 35 seconds, 40 circulations.
The PCR instrument adopting is ABI PRISM7500PCR fluorescence detector, and selected to detect fluorescence be FAM passage, and in the time of 60 ℃ of PCR circulations, starts real-time collecting fluorescent signal.As shown in Figure 2, wherein the corresponding plasmid concentration of S type amplification curve is respectively 10 to the detected result of the positive reference substance of gradient concentration from left to right
10copies/ml, 10
9copies/ml, 10
8copies/ml, 10
7copies/ml, 10
6copies/ml, 10
5copies/ml, 10
4copies/ml and 10
3copies/ml, and 10
2copies/ml gradient detects and is negative (being the flat line substantially overlapping with baseline).
The detected result of the simulation sample to be tested that preparation example 1 obtains as shown in Figure 3.As can be seen from Figure 3, preparation example 1 is simulated fluorescence intensity curves in sample to be tested to be had and beats, and shows that in detected sample, I type New Delhi metallo-β-lactamase gene exists.Preparation example 1 is simulated the integral result of the fluorescence intensity curves of sample to be tested acquisition, with the integral result comparison of step (2) gained fluorescence intensity curves that positive reference substance obtains, has obtained the quantitative result 10 of analog D NA solution
6copies/ml.Illustrate that composition of the present invention and test kit can either qualitative detection samples to be tested, also can detection by quantitative sample to be tested.
The detected result of the mouse intestinal fecal matter sample that preparation example 2 obtains as shown in Figure 4.Wherein, the amplified fluorescence curve of the sample of B1, B5, B10 and B20 is the flat line substantially overlapping with baseline; Article four, the S type amplification curve sample of corresponding C1, C5, C10 and C20 respectively, and every curve is the superposed average fluorescent signal from 20 mouse.As can be seen from Figure 4, the sample fluorescence intensity curves of C1, C5, C10 and C20 has beats, and shows that in detected sample, I type New Delhi metallo-β-lactamase gene exists.Illustrate that composition of the present invention can detect from animal body integral level and separate the sample to be tested obtaining with test kit.
Embodiment 2-7
Table 3-8 has listed respectively primer and probe that embodiment 2-7 adopts.Other step and methods of embodiment 2-7 are identical with embodiment 1.
Table 3
| Primer/probe | Sequence (5 ' → 3 ') |
| I type New Delhi metallo-β-lactamase gene the first primer | CAGCCACCAAAAGCGA |
| I type New Delhi metallo-β-lactamase gene the second primer | CGGCCACACCAGTGA |
| I type New Delhi metallo-β-lactamase gene probe | Cy3-5’-TCGATCCCAACGGTGATATTG-3’-BHQ2 |
Table 4
| Primer/probe | Sequence (5 ' → 3 ') |
| I type New Delhi metallo-β-lactamase gene the first primer | CCACCAAAAGCGATGT |
| I type New Delhi metallo-β-lactamase gene the second primer | CCACACCAGTGACAA |
| I type New Delhi metallo-β-lactamase gene probe | FAM-5’-CCGTCGATCCCAACGGTGATA-3’-BHQ1 |
Table 5
| Primer/probe | Sequence (5 ' → 3 ') |
| I type New Delhi metallo-β-lactamase gene the first primer | CAGCCACCAAAAGCG |
| I type New Delhi metallo-β-lactamase gene the second primer | CGGCCACACCAGTGAC |
| I type New Delhi metallo-β-lactamase gene probe | TAMRA-5’-CCGTCGATCCCAACGGTGA-3’-BHQ2 |
Table 6
| Primer/probe | Sequence (5 ' → 3 ') |
| I type New Delhi metallo-β-lactamase gene the first primer | CAGCCACCATAAGCGTTGT |
| I type New Delhi metallo-β-lactamase gene the second primer | CGGCCACACGAGTCACAA |
| I type New Delhi metallo-β-lactamase gene probe | FAM-5’-CCGTCGATCCGAACGGAGATATTG-3’-DABCYL |
Table 7
| Primer/probe | Sequence (5 ' → 3 ') |
| I type New Delhi metallo-β-lactamase gene the first primer | AGCCAGCAAATGCGAT |
| I type New Delhi metallo-β-lactamase gene the second primer | GCCACAGCTGTGACA |
| I type New Delhi metallo-β-lactamase gene probe | FAM-5’-TCGAACCCAACGGAGAT-3’-BHQ1 |
Table 8
| Primer/probe | Sequence (5 ' → 3 ') |
| I type New Delhi metallo-β-lactamase gene the first primer | CAGCCACCAAAAGCGATG |
| I type New Delhi metallo-β-lactamase gene the second primer | GGCCACACCAGTGACAA |
| I type New Delhi metallo-β-lactamase gene probe | Cy5-5’-CCGTATCCCAACGGTGAT-3’-BHQ3 |
The detected result of the mouse intestinal fecal matter sample that the composition of embodiment 2-7 and test kit detection preparation example 2 obtain respectively as shown in Figure 5-10.Wherein, the amplified fluorescence curve of the sample of B1, B5, B10 and B20 is the flat line substantially overlapping with baseline; Article four, the S type amplification curve sample of corresponding C1, C5, C10 and C20 respectively, and every curve is the superposed average fluorescent signal from 20 mouse.Can find out from Fig. 5-10, the sample fluorescence intensity curves of C1, C5, C10 and C20 has beats, and shows that in detected sample, I type New Delhi metallo-β-lactamase gene exists.In addition,, although embodiment 1-7 primer is different with probe sequence, the fluorescent signal difference that uses, the result of measuring for same sample is all consistent.
Scope of the present invention is not subject to the restriction of described specific embodiments, and described embodiment, only as the single example of illustrating all respects of the present invention, also comprises method and the component of functional equivalent in the scope of the invention.In fact,, except content as herein described, those skilled in the art can easily grasp multiple improvement of the present invention with reference to description and accompanying drawing above.Within described improvement also falls into the scope of appended claims.
Claims (5)
1. for detection of the composition of I type New Delhi metallo-β-lactamase gene, it is characterized in that, described composition is made up of following sequence:
1) for the first primer of pcr amplification I type New Delhi metallo-β-lactamase gene;
2) for the second primer of pcr amplification I type New Delhi metallo-β-lactamase gene;
3) with 1) and 2) pcr amplification product of the described primer oligonucleotide probe of hybridizing;
Wherein, 3) described probe at 5 ' end with mutually different fluorescence report group, and on any one position except 5 ' end with fluorescent quenching group;
Wherein, the sequence of described the first primer, described the second primer, described probe is respectively:
(1) sequence of described the first primer is the sequence as shown in SEQ ID No:1, the sequence of described the second primer is the sequence as shown in SEQ ID No:2, the sequence of described probe is sequence or its complementary sequence as shown in SEQ ID No:3, described probe is held with 6-Fluoresceincarboxylic acid 5 ', and holds with BHQ1 3 '; Or
(2) sequence of described the first primer is CAGCCACCAAAAGCGA, the sequence of described the second primer is CGGCCACACCAGTGA, the sequence of described probe is TCGATCCCAACGGTGATATTG, and described probe is held with flower cyanines 35 ', and holds with BHQ2 3 '; Or
(3) sequence of described the first primer is CCACCAAAAGCGATGT, the sequence of described the second primer is CCACACCAGTGACAA, the sequence of described probe is CCGTCGATCCCAACGGTGATA, and described probe is held with 6-Fluoresceincarboxylic acid 5 ', and holds with BHQ1 3 '; Or
(4) sequence of described the first primer is CAGCCACCATAAGCGTTGT, the sequence of described the second primer is CGGCCACACGAGTCACAA, the sequence of described probe is CCGTCGATCCGAACGGAGATATTG, described probe is held with 6-Fluoresceincarboxylic acid 5 ', and holds with 4-(4-dimethylamino phenylazo-) phenylformic acid 3 '; Or
(5) sequence of described the first primer is AGCCAGCAAATGCGAT, the sequence of described the second primer is GCCACAGCTGTGACA, the sequence of described probe is TCGAACCCAACGGAGAT, and described probe is held with 6-Fluoresceincarboxylic acid 5 ', and holds with BHQ1 3 '; Or
(6) sequence of described the first primer is CAGCCACCAAAAGCGATG, the sequence of described the second primer is GGCCACACCAGTGACAA, the sequence of described probe is CCGTATCCCAACGGTGAT, and described probe is held with flower cyanines 55 ', and holds with BHQ3 3 '.
2. for detection of the test kit of I type New Delhi metal 3-lactamase gene, this test kit contains polymerase chain reaction liquid and hot resistant DNA polymerase, it is characterized in that, described test kit also contains composition claimed in claim 1.
3. test kit according to claim 2, wherein, described test kit also comprises positive reference substance, described positive criteria product are 10
3-10
8the I type New Delhi metallo-β-lactamase gene plasmid DNA solution of copies/ml, wherein, described I type New Delhi metallo-β-lactamase gene plasmid DNA is made up of I type New Delhi metallo-β-lactamase gene DNA fragment and plasmid vector, in the complete genome of the free I type New Delhi metallo-β-lactamase as shown in SEQ ID No:4 of described I type New Delhi metallo-β-lactamase gene DNA fragment choosing and the group that I type New Delhi metallo-β-lactamase gene amplification product is formed; Described test kit also comprises negative control product, and described negative control product are water.
4. test kit according to claim 3, wherein, described positive criteria product are 10
5-10
8the I type New Delhi metallo-β-lactamase gene plasmid DNA solution of copies/ml; Described I type New Delhi metallo-β-lactamase gene DNA fragment is the I type New Delhi metallo-β-lactamase gene amplification product as shown in SEQ ID No:5; Described negative control product select in the group that free distilled water, deionized water, water for injection, redistilled water and ultrapure water form.
5. test kit according to claim 2, wherein, the sample that described test kit detects selects in the group that free enteron aisle movement, blood, saliva and nasal cavity elutant form.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110077025.8A CN102719519B (en) | 2011-03-30 | 2011-03-30 | Composition and kit for detection of New Delhi metallo-beta-lactamase-1 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110077025.8A CN102719519B (en) | 2011-03-30 | 2011-03-30 | Composition and kit for detection of New Delhi metallo-beta-lactamase-1 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102719519A CN102719519A (en) | 2012-10-10 |
| CN102719519B true CN102719519B (en) | 2014-07-02 |
Family
ID=46945385
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110077025.8A Active CN102719519B (en) | 2011-03-30 | 2011-03-30 | Composition and kit for detection of New Delhi metallo-beta-lactamase-1 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102719519B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114560914B (en) * | 2022-03-09 | 2023-10-20 | 丽水市中心医院 | Peptide nucleic acid for inhibiting blaNDM gene expression and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010130882A1 (en) * | 2009-05-15 | 2010-11-18 | Licentia Ltd. | A method and kit for detecting antibiotic resistant bacteria |
-
2011
- 2011-03-30 CN CN201110077025.8A patent/CN102719519B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010130882A1 (en) * | 2009-05-15 | 2010-11-18 | Licentia Ltd. | A method and kit for detecting antibiotic resistant bacteria |
Non-Patent Citations (2)
| Title |
|---|
| 徐利娟，黄敏."超级细菌"NDM-1的研究现状.《动物医学进展》.2010,第31卷(第11期),第100-103页. |
| 徐利娟,黄敏."超级细菌"NDM-1的研究现状.《动物医学进展》.2010,第31卷(第11期),第100-103页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102719519A (en) | 2012-10-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JPH0463679B2 (en) | ||
| WO2016078553A1 (en) | Kit for detecting and typing dengue viruses by reverse transcription pcr and detection method thereof | |
| CN106701984A (en) | Electrochemical luminescence nucleic acid detection method and kit based on branched DNA (Deoxyribonucleic Acid) amplification signal | |
| CN101624636A (en) | LAMP-LFD detection method of infectious spleen and kidney necrosis virus (ISKNV) | |
| CN106868142A (en) | Detect the loop-mediated isothermal amplification method of hickory nut dry rot germ | |
| CN108728581A (en) | The multiplex RT-PCR method of 5 kinds of sugarcane diseases of detection and its primer and kit simultaneously | |
| CN107805675B (en) | Potato virus detection kit | |
| CN101775443A (en) | LAMP kit for detecting PRV and preparation method thereof | |
| CN104195269B (en) | A kind of method detecting tomato spotted wilf virus | |
| CN100537780C (en) | The TaqMan probe of qualitative and quantitative analysis blue tongue rims | |
| CN105002169A (en) | DHAV-3 fluorescent quantitation RT-LAMP detection reagent kit and application and method thereof | |
| CN102719519B (en) | Composition and kit for detection of New Delhi metallo-beta-lactamase-1 gene | |
| CN106350581A (en) | Method for detecting bacterial vaginosis by using detection kit | |
| CN101824471B (en) | Composition and kit for simultaneously detecting mycoplasma urealytium, mycoplasma hominis and mycoplasma genitalium | |
| CN107653308A (en) | One group is used to distinguishing active tuberculosis patient and is combined with the primer pair of non-tuberculous pneumonia patient and kit | |
| CN101280343B (en) | Primer for quantitative and qualitative determination of blue tongue virus | |
| CN104017886A (en) | Nested polymerase chain reaction (PCR) detection kit for cylindrocladium scoparium and using method of detection kit | |
| CN102605071B (en) | LAMP (Loop-Mediated Isothermal Amplification) assay kit for identifying virulent and avirulent strains of mycoplasma gallisepticum | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| CN108486279A (en) | A method of pigeon with newcastle disease is detected based on fluorescent quantitative PCR technique | |
| CN103361444A (en) | Kit for testing Marek's disease virus of chicken by using MEQ gene and detection method thereof | |
| CN102586489B (en) | Detection of infection of avian anemia viruses in pathologic material by combination of polymerase chain reaction (PCR) and nucleic acid probe and dot blot hybridization technology | |
| CN101824487A (en) | Method for detecting virus infection in pathological sample by combining PCR (Polymerase Chain Reaction) with nucleic acid probe dot hybridization technology | |
| US7465543B1 (en) | Multiplex DNA identification of clinical yeasts using flow cytometry | |
| CN102559938B (en) | Method for detecting infection of Marek's disease virus serotype 1 (MDV-1) in pathological material by combining polymerase chain reaction (PCR) with nucleic acid probe dot hybridization technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |