CN102719461A - Gene sequence and amino acid sequence of snake venom plasmin of agkistrodon blomhoffii ussurensis - Google Patents
Gene sequence and amino acid sequence of snake venom plasmin of agkistrodon blomhoffii ussurensis Download PDFInfo
- Publication number
- CN102719461A CN102719461A CN2012101529920A CN201210152992A CN102719461A CN 102719461 A CN102719461 A CN 102719461A CN 2012101529920 A CN2012101529920 A CN 2012101529920A CN 201210152992 A CN201210152992 A CN 201210152992A CN 102719461 A CN102719461 A CN 102719461A
- Authority
- CN
- China
- Prior art keywords
- plasmin
- sequence
- gene
- primer
- amino acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
Plasmin is obtained from agkistrodon blomhoffii ussurensis by isolation and purification. Ten amino acid sequence at N terminal of the plasmin are measured, according to which forward primer is designed; and reverse primer is designed according to a region, wherein the region is much higher similar to the non-coding region at 3' terminal of the snake venom plasmin of other vipers. Total RNA is extracted from a poison gland; gene is amplified from the RNA by PCR. The result of complete sequence determination after cloning indicates that c DNA of the maturation protein codes 708 nucleotides, that is, 236 amino acids. The successful clone of the gene and the determination of the gene sequence create favorable conditions for the development of gene engineering products.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of echidnotoxin plasmin coding gene sequence and aminoacid sequence thereof.
Background technology
Plasmin is meant the proteolytic ferment of the single-minded fibrin degradation gel of ability, is an important component in the fibrinolytic system.Body intravascular coagulation and fibrinolytic two systems are that interdependence is allo.In a single day body produces the blood coagulation reaction, has also almost activated fibrinolytic system simultaneously, and thrombus unnecessary in the body is removed, and through the reverse feedback effect the former level of body inner fibrin is reduced, thereby avoids fibrinous too much cohesion.The distribution of nevin fibrinolytic enzyme is very widely, has and reports that nearly all crotalin all has fibrinolysis component.Fuffado etc. had once detected 9 kinds of spearhead viper venoms and had found all to contain fibrinolytic.From Viperidae Elapidae and colubrid multiple snake venom, obtained the plasmin of purifying up to now; It is the widest wherein to distribute; What content was the abundantest is the Crotalinae nevin fibrinolytic enzyme in the Viperidae; Ability is former A α or the B β chain of fibrin degradation directly, even it is not also solidified in the presence of zymoplasm, great majority can be divided into α plasmin and β plasmin according to former A α of its preferential fibrin degradation or B β peptide chain by solution fibrin.Plasmin generally only acts on A α or B β peptide chain.Also can be divided into Tryase and metalloprotease according to the plasmin constructional feature.
Domestic employed clinically plasmin is in animal body and extracts at present; Purity is not high, has certain antigenicity, behind the entering human body; Possibly bring out a series of antigen antibody reaction; Existing report injection plasmin causes fixed drug eruption and Stevens Johnson syndrome drug rash, and can not realize intravenous administration, and medicine can not be played a role to greatest extent.Through clinical practice for many years, find that agkistrodon halys ussuriensis snake venom class plasmin has best curative effect.Yet the snake venom resource is very limited, if obtain product through genetically engineered, is a up-and-coming approach.For the exploitation of gene engineering product from now on, it is a significant research topic that white-browed viper venom plasmin is carried out gene sequencing.
For this reason; The objective of the invention is according to this section sequence and other snake kind plasmin homology structurally, to design and synthesize the upstream and downstream Oligonucleolide primers through measuring one section aminoacid sequence of agkistrodon halys ussuriensis snake venom class plasmin N end; From agkistrodon halys ussuriensis snake venom gland, separate relevant m RNA then as template; Obtain c DNA through reverse transcription, increase and cloned the full gene of plasmin, the complete sequence of assay determination gene with the PCR method.
Summary of the invention
The object of the present invention is to provide the coding gene sequence of agkistrodon halys ussuriensis nevin fibrinolytic enzyme.
Another object of the present invention provides the aminoacid sequence of agkistrodon halys ussuriensis nevin fibrinolytic enzyme.
For realizing above-mentioned purpose, the present invention adopts following technical scheme:
1, total RNA extracts
Downcut snakehead, take out poison gland immediately, with quick-frozen in the liquid nitrogen, place-70 ℃ subsequent use, adopt acid guanidine thiocyanate-phenol-chloroform single stage method (to consult Chomczynski P.et al.Analytical Biochemistry.1987,162:156) the total RNA of extracting poison gland.
2, design of primers foundation, primer synthetic method
According to the aminoacid sequence of the plasmin maturation protein N end of measuring, structure is VIGGDECNINEHRSL, has designed the upstream oligonucleotide primer, i.e. 5 ' GTCATTGGAGGTGATGAATGTAACATA 3 '; According to the structural homology of other snake kind plasmin (Arinos Magalhaes.; Beatriz Campos Brasil Da Fonsecaa; Et al; 1993.The complete amino acid sequence of a thrombin-like enzyme/gyroxin analogue from venom of the bushmaster snake (Lachesis muta muta) .Eur.J.Biochem.251,845 853.) the conservative section at 3 ' end has designed the downstream Oligonucleolide primers, that is:
5’TCACGGGGGGCATGTCA?3’。Primer is given birth to worker Bioisystech Co., Ltd in Shanghai synthetic, and primer is seen Fig. 2.
3, reverse transcription, pcr amplification and gene clone
With the total RNA of agkistrodon halys ussuriensis poison gland is template, and downstream primer is that primer is done reverse transcription.The reverse transcription test kit is available from sky root biochemical technology ltd, and operation is undertaken by its specification sheets.Go on foot gained c DNA is template in the past, carries out pcr amplification with synthetic upstream and downstream primer.Pcr amplification goes out the dna fragmentation of a treaty 700bp, sees Fig. 3 agarose gel electrophoretogram.Adopt day glue of root biochemical technology ltd to reclaim test kit and reclaim this PCR product.The PCR product that reclaims is inserted pGEM-T easy carrier (plasmid vector is available from Promega company), and change DH 5 α large intestine competent cells over to, cut evaluation, obtain 10 positive colonies through blue hickie screening and enzyme.Universal primer carries out dna sequencing through upstream and downstream, pGEM-T easy carrier cloning site with positive recombinant clone, obtains DNA (mRNA) sequence of agkistrodon halys ussuriensis nevin fibrinolytic enzyme encoding sox of the present invention.Use DNAMAN software,, draw the proteinic primary structure (aminoacid sequence) of this nevin fibrinolytic enzyme according to DNA (mRNA) sequence of this nevin fibrinolytic enzyme encoding sox.
The invention has the advantages that: agkistrodon halys ussuriensis is the distinctive snake kind of China; The vigor of its plasmin and curative effect are much better than the plasmin in other sources; Yet snake venom resource-constrained; The present invention clone obtains fibrinolytic enzyme gene and measures its gene order, has created good condition for developing gene engineering product from now on.
Below in conjunction with accompanying drawing and specific embodiment the present invention being described further, is not to not having the restriction of invention, all any this areas of doing according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.
Description of drawings
The Nucleotide and the aminoacid sequence of Fig. 1 agkistrodon halys ussuriensis nevin fibrinolytic enzyme.A: the nucleotide sequence of plasmin; B: the aminoacid sequence of plasmin.
Fig. 2 synthetic oligonucleotide upstream primer and downstream primer.
The agarose gel electrophoresis figure of Fig. 3 PCR product.1: the PCR product of plasmin; 2: negative control; 3:DL 2000Marker.
The amino acid of several kinds of venin-derived plasmins of Fig. 4 is formed.
The SDS-PAGE electrophorogram of plasmin behind Fig. 5 desaccharification.1: the plasmin behind the desaccharification; 2: protein standard Marker.
Embodiment
1, total RNA extracts
Downcut snakehead, take out poison gland immediately, quick-frozen in liquid nitrogen, place-70 ℃ subsequent use.Take out 100mg poison gland tissue, add the 1ml solution D and (contain the 4M guanidinium isothiocyanate, 25mM Trisodium Citrate, p H7.0; 5% sarcosyl (Sarcosyl); 0.1M beta-mercaptoethanol), in tissue homogenizer, after the abundant homogenate, homogenate is changed in the 10ml centrifuge tube; The sodium acetate (pH4) that adds 0.1ml 2M again; The water-saturated phenol of 1ml and the chloroform of 0.2ml: primary isoamyl alcohol (49: 1) mixture, behind the mixing that fully vibrates, leave standstill 15min on ice.Sample at Hitachi's refrigerated centrifuge (Hitach Centrifuge 20PR-52D) with 10000g in 4 ℃ of centrifugal 20min, draw the upper strata water, with equal-volume Virahol mixing, put-20 ℃ freezing at least 1 hour.With the centrifugal 20min collecting precipitation of 10000g and be dissolved in the 0.3ml solution D, add 0.03ml2M sodium acetate and 0.3ml Virahol, mixing, place-20 ℃ freezing 1 hour.Be dissolved in the H2O that 0.3ml coke diethyl phthalate (DEPC) was handled again with the centrifugal 20min collecting precipitation of 10000g, add 0.03ml sodium acetate and 0.75ml ethanol again, mixing; Place-20 ℃ freezing 1 hour; With the centrifugal 20min collecting precipitation of 10000g,, after the seasoning RNA is dissolved in the DEPC treated water with 75% washing RNA deposition; Packing, place-70 ℃ subsequent use.
2, design of primers foundation, primer synthetic method
The present invention is according to the aminoacid sequence of the plasmin maturation protein N end of measuring, and structure is VIGGDECNINEHRSL, and design upstream oligonucleotide primer is: 5 ' GTCATTGGAGGTGATGAATGTAACATA 3 '; According to the structural homology of other snake kind plasmin (Arinos Magalhaes.; Beatriz Campos Brasil Da Fonsecaa; Et al; 1993.The complete amino acid sequence of a thrombin-like enzyme/gyroxin analogue from venom of the bushmaster snake (Lachesis muta muta) .Eur.J.Biochem.251; 845853.) designed the downstream Oligonucleolide primers at the conservative section of 3 ' end, that is: 5 ' TCACGGGGGGCATGTCA 3 '.Primer is given birth to worker Bioisystech Co., Ltd in Shanghai synthetic, and primer is seen Fig. 2.
3, reverse transcription, pcr amplification and gene clone
With the total RNA of agkistrodon halys ussuriensis poison gland is template, and above-mentioned downstream primer is that primer is done reverse transcription.The reverse transcription test kit is available from sky root bio tech ltd, and operation is undertaken by its specification sheets.
Go on foot gained c DNA is template in the past, carries out pcr amplification with above-mentioned upstream and downstream primer.The TV of reaction is 30 μ l, 3 μ l, 10 * PCR damping fluid wherein, and the final concentration of d NTP is 0.2m M and 0.3 μ l Taq archaeal dna polymerase (available from Takara company).Reaction conditions is: 95 ℃ of sex change 5min, and 95 ℃ of sex change 30s then, 59 ℃ of annealing 40s, 72 ℃ are extended 30s, carry out 40 circulations; Last 72 ℃ of insulation 10min.Get 8 μ l reaction product through the inspection of 1% agarose electrophoresis.Pcr amplification goes out a dna fragmentation about 700bp, and the agarose gel electrophoresis of PCR product is seen Fig. 3.Product reclaims test kit with day glue of root biochemical technology ltd and carries out the glue recovery.
The PCR product that reclaims is inserted pGEM-T easy carrier (plasmid vector is available from Promega company), linked system 10 μ l, wherein PCR product 1 μ l; PGEM-T easy carrier 0.5, T4 ligase enzyme 1 μ l, 2 * connection damping fluid, 5 μ l; Dd H2O 2.5 μ l, 4 ℃ are spent the night.To connect product and change DH 5 α large intestine competent cells over to, cut evaluation, obtain 10 positive colonies through blue hickie screening and enzyme.Universal primer carries out dna sequencing through upstream and downstream, pGEM-T easy carrier cloning site with positive recombinant clone, obtains DNA (mRNA) sequence of agkistrodon halys ussuriensis nevin fibrinolytic enzyme encoding sox of the present invention.Use DNAMAN software,, draw the primary structure (aminoacid sequence) of this nevin fibrinolytic enzyme according to DNA (mRNA) sequence of this nevin fibrinolytic enzyme encoding sox.
1, plasmin vigor qualitative test: Fibrinogen is transformed into scleroproein under the effect of zymoplasm; In test tube, form the oyster white grumeleuse, add and contain the plasmin sample, plasmin acts on scleroproein; Make it to be transformed into soluble small molecular peptide and amino acid; Clot dissolution is liquid state, and the clot dissolution required time is relevant with the plasmin activity size.According to Pharmacopoeia of People's Republic of China two nineteen ninety-fives version; Slightly improve, add the Fg of 150ul 6.5mg/ml in the test tube, add 400ulGBSB damping fluid (gelatin-veronal-Nacl damping fluid) and 100ul testing sample again and put in 37 ℃ of waters bath with thermostatic control; Add 3u/ml T 100ul and 1.5u/ml Pg 100ul after 3 minutes; Mixing as early as possible, 37 ℃ are continued insulation, observe the different dissolution degrees of different time after grumeleuse forms in the test tube.
The result: after in scleroproein, adding the plasmin after extracting, scleroproein is transformed into soluble small molecular peptide and amino acid, and clot dissolution is liquid state, proves that this proteolytic enzyme has plasmin activity, is referred to as snake venom class plasmin.
The quantitatively determined that ratio is lived:
Stamp the aperture of diameter 1.5mm on the fibrin plate, testing sample is mixed with suitable concn, microsyringe is got several dropping in the hole, adds a cover, and measures the solusphere diameter after 12 hours for 37 ℃, can learn that with the typical curve contrast enzyme of testing sample is lived.
Urokinase typical curve: accurately prepare the urokinase normal concentration and be respectively 5,10,20,40; 60, each concentration of 80u/ml is got 10ml, and point is on the flat board that has configured, after adding a cover; 37 ℃ of constant temperature take out mutually perpendicular two diameters (mm) of measuring each solusphere after 12 hours, measure repeatedly 5 different time, tries to achieve MV then and list in the table; With standard urinary kinases concentration (u/ml) is X-coordinate, and the diameter product of solusphere (mm 2) is an ordinate zou, does the urokinase typical curve.
As surveying two kinds of methods of living, test tube method and flat band method all have certain susceptibility to the fibrinolytic material, better repeatability and stability.Test tube method is easy and simple to handle, quick, but quantitatively property is relatively poor, is suitable for the determination of activity of intermediate product.Flat band method is responsive, quantitative method is better than test tube method, is suitable for the vitality test of final product.But these two kinds of methods all have weak point for the vitality test of plasmin.Urokinase is an activation fiber albumen lyase, and the plasmin that we extract is direct solution fibrin, and mechanism of action is also incomplete same.But still not having the plasmin standard substance at present both at home and abroad, is one of methods of reality as standard substance with urokinase.
In small test tube, add a certain amount of sample, add 1ml 6mol/L HCl and a mercaptoethanol, the decompression tube sealing.Hydrolysis is 24 hours in 105-110 ℃ of baking oven, opens tube sealing, extracts HCl gas out, on automatic analyzer for amino acids L-8500, surveys amino acid and forms.
The amino acid of this nevin fibrinolytic enzyme is formed, and sees Fig. 4 with other albumen contrast situation of homology.The aminoacid sequence of the nevin fibrinolytic enzyme that is obtained by the present invention, its amino acid is formed consistent with measured value.
Though, the present invention has been done detailed description in the preceding text with general explanation, specific embodiments and experimental example, on basis of the present invention, can to some modifications of do or improvement, this will be apparent to those skilled in the art.Therefore, these modifications or the improvement on the basis of not departing from spirit of the present invention, made all belong to the scope that requirement of the present invention is protected.
Claims (3)
1. the coding gene sequence of an agkistrodon halys ussuriensis nevin fibrinolytic enzyme has the nucleotide sequence shown in the SEQ ID No.1 in the sequence table.
2. the aminoacid sequence of an agkistrodon halys ussuriensis nevin fibrinolytic enzyme has the aminoacid sequence shown in the SEQ ID No.2 in the sequence table.
3. artificial synthetic oligonucleotide's primer that designs for clone claim 1,2 described agkistrodon halys ussuriensis snake venom class fibrinolytic enzyme genes is characterized in that this primer sequence is following:
Upstream primer: 5 ' GTTATTGGTGGCGATGAATGTAATATC 3 '
Downstream primer: 5 ' GCACGTACTGTGGGGG 3 '
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101529920A CN102719461A (en) | 2012-05-16 | 2012-05-16 | Gene sequence and amino acid sequence of snake venom plasmin of agkistrodon blomhoffii ussurensis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101529920A CN102719461A (en) | 2012-05-16 | 2012-05-16 | Gene sequence and amino acid sequence of snake venom plasmin of agkistrodon blomhoffii ussurensis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102719461A true CN102719461A (en) | 2012-10-10 |
Family
ID=46945329
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101529920A Pending CN102719461A (en) | 2012-05-16 | 2012-05-16 | Gene sequence and amino acid sequence of snake venom plasmin of agkistrodon blomhoffii ussurensis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102719461A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1181421A (en) * | 1997-11-12 | 1998-05-13 | 中国科学院上海生物化学研究所 | Gene sequence of fibrin ferment of Agkistrodon acutus snakes |
| CN102021160A (en) * | 2010-11-11 | 2011-04-20 | 中国农业大学 | Snake venom serine protease and coding gene and application thereof |
-
2012
- 2012-05-16 CN CN2012101529920A patent/CN102719461A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1181421A (en) * | 1997-11-12 | 1998-05-13 | 中国科学院上海生物化学研究所 | Gene sequence of fibrin ferment of Agkistrodon acutus snakes |
| CN102021160A (en) * | 2010-11-11 | 2011-04-20 | 中国农业大学 | Snake venom serine protease and coding gene and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| JUNICHI SAKAI ET AL: "Primary structure of a thrombin-like serine protease, kangshuanmei, from the venom of Agkistrodon halys brevicaudus stejneger", 《TOXICON》 * |
| 薛雁等: "长白山白眉蝮蛇乌苏里亚种类凝血酶TLE基因克隆及分析", 《蛇志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nehmé et al. | Culture-independent characterization of archaeal biodiversity in swine confinement building bioaerosols | |
| CN102321588B (en) | Chinese hamster ovary genetic engineering cell line for performing high-level secretory expression on AcAPc2 | |
| Kumar et al. | Plant asparaginase-based asparagine biosensor for leukemia | |
| CN113615643B (en) | Construction method and application of inducible B cell defect mouse model | |
| CN105671167A (en) | Specific primer-probe set for porcine-derived real-time fluorescent PCR (polymerase chain reaction) detection | |
| Chen et al. | Ecological function of myroilysin, a novel bacterial M12 metalloprotease with elastinolytic activity and a synergistic role in collagen hydrolysis, in biodegradation of deep-sea high-molecular-weight organic nitrogen | |
| CN104031135A (en) | Tree frog defence peptide PopuDef as well as gene and application thereof | |
| CN108822196A (en) | A kind of rush blood coagulation polypeptide LGTX-F2 and its application | |
| CN101952423B (en) | Mutated nucleotide sequences of batroxobin, mutated alpha factor secretion signal sequence and processes for preparing batroxobin using same | |
| CN109679941B (en) | Cordyceps militaris fibrinolytic enzyme and preparation method and application thereof | |
| CN102719461A (en) | Gene sequence and amino acid sequence of snake venom plasmin of agkistrodon blomhoffii ussurensis | |
| CN104593393B (en) | Red woods ant AChE genes, red woods ant AChE and preparation method thereof | |
| CN102660565A (en) | Agkistrodon acutus hemocoagulase gene and methods for preparing expression vector, host cell and recombinant protein thereof | |
| US8017750B2 (en) | Haemocoagulase | |
| US20240180166A1 (en) | Keratinolytic polypeptides and methods of use | |
| Tang et al. | Biochemical and hemostatic mechanism of a novel thrombin-like enzyme | |
| CN102021160B (en) | Snake venom serine protease and coding gene and application thereof | |
| CN105018612A (en) | Quantitative detection method of garlic virus | |
| Kumar et al. | L-asparaginase extracted from Capsicum annum L and development of asparagine biosensor for leukemia | |
| Lin et al. | Expression and functional characterization of chitribrisin, a thrombin-like enzyme, in the venom of the Chinese green pit viper (Trimeresurus albolabris) | |
| CN101397567A (en) | Novel expression, renaturation of recombinant snake venom metalloproteinase and its biology activity | |
| CN104109679B (en) | A kind of formaldehyde dehydrogenase gene CcFALDH and application | |
| CN106047862A (en) | Reverse transcription method for reducing false negative rate of yeast two-hybrid cDNA library | |
| CN105646702B (en) | Hiruto Kazal type trypsin inhibitor Bdellin-HM and its encoding gene and application | |
| Lotto et al. | The absence of thrombin-like activity in Bothrops erythromelas venom is due to the deletion of the snake venom thrombin-like enzyme gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20121010 |