CN102719453A

CN102719453A - Human papilloma virus 18 L1 (HPV18L1) polynucleotide sequence and its expression vector, host cell and use

Info

Publication number: CN102719453A
Application number: CN201210013236XA
Authority: CN
Inventors: 王昌华; 杨珺; 齐怀丰; 李建; 王艳侠; 汪志良; 张涛; 宋立娜; 王玉香; 孙长海; 汪和睦
Original assignee: Tianjin Chaoran Biological Technollogy Co Ltd
Current assignee: Tianjin Xin INTHA Biological Technology Co. Ltd.
Priority date: 2012-01-16
Filing date: 2012-01-16
Publication date: 2012-10-10
Anticipated expiration: 2032-01-16
Also published as: CN102719453B

Abstract

The invention relates to a human papilloma virus 18 L1 (HPV18L1) polynucleotide sequence and its expression vector, host cell and use and especially relates to an amino acid sequence of an HPV L1 capsid protein, a synthetic nucleotide sequence for coding the amino acid sequence, a recombinant expression vector containing the synthetic nucleotide sequence, and a hansenula polymorpha expression host strain containing the synthetic nucleotide sequence. The invention also relates to a use of an HPV18L1 protein composed of the amino acid sequence and derivatives of the amino acid sequence in preparation of vaccines. Through modification of a nucleotide sequence of a gene of an HPV18L1 wide-type virus, a recombinant HPV18L1 capsid protein can be highly expressed in a hansenula polymorpha expression system and thus hansenula polymorpha expression system-based industrial production of an HPV18L1 capsid protein is realized. Compared with the existing eukaryotic expression systems, the HPV18L1 polynucleotide sequence and its expression vector and host cell have advantages of higher yield and lower cost.

Description

A kind of HPV18L1 polynucleotide sequence and expression vector, host cell and application

Technical field

The invention belongs to the genetically engineered field, especially relate to a kind of HPV18L1 polynucleotide sequence, also comprise the application aspect pharmacy and preparation of a kind of expression vector and host cell and polynucleotide sequence thereof, expression vector and host cell.

Background technology

Comprise sheep at multiple species, dog, rabbit, monkey, ox and philtrum have been found the infection of papilloma virus.Human papillomavirus (being called for short HPV) has been told up to a hundred types; If the L1 gene is lower than 90% with the identity of the L1 sequence of the type of identifying in the past; So this type can be confirmed as new type; Be hypotype if the L1 amino acid sequence identity is between 90 to 98%, identity is being variant [comparing with prototype (parental form)] more than 98%.

Human papillomavirus is one type and has strict host range and tissue-specific dna virus, found more than 100 kind of hypotype at present.The type of pathogenic HPV mainly contains 6,11,16,18 etc.Can be carcinogenic can it be divided into two types of carcinogenic high-risk-type and not carcinogenic low risks according to HPV.Low risk HPV mainly comprises 6,11,13,32,42,43,44 etc.High-risk HPV mainly comprises 16,18,45,52,56,58 etc.

The statistical information of the World Health Organization shows that cervical cancer occupies the second in global woman cancer mortality ratio, in some developing countries even occupy the first; The annual whole world nearly 500,000 routine New Development cases of cervical cancer, about 200,000 people die from cervical cancer, and wherein, 80% death occurs in developing country.According to incompletely statistics, the existing cervical cancer patient of China is about 13.8 ten thousand, has every year 50000 people to die from cervical cancer approximately.A large amount of research datas prove; The human papillomavirus of reproductive tract (HPV) infects with cervical cancer has the cervical cancer of ten minutes confidential relation-Yue 80% and the HPV of 4 types (16,18,31 types and 45 types) to infect relevant; Wherein, 50% cervical cancer infects relevant with HPV16.At present, the chemotherapy of centering advanced cervical cancer and surgical result are also undesirable.The recurrence rate of cervical cancer is higher and medical expense is also high.2005, the cervical cancer patient that the U.S. has 10,000 examples newly to make a definite diagnosis approximately had 3700 routine deaths approximately.At most of philtrums, human papillomavirus can be died away after infecting.Yet, under the few cases,, can cause cervical cancer if the human papillomavirus of some high-risk type is undetected and treatment.In addition, the human papillomavirus of some low danger type can cause pointed condyloma.In the U.S.; The expense that is used for cervical cancer examination and treatment every year is about 5.7 hundred million dollars; 1,000,000 routine pointed condylomas are arranged every year approximately; 4,700,000 women are arranged approximately because Pap smear inspection (Pap) results abnormity need be followed up a case by regular visits to, wherein, have at least 3,000,000 these type of abnormal resultses of example to cause by some human papillomavirus.

HPV is a kind of little dna virus, and diameter 45-55nm, capsid are the three-dimensional symmetry of icosahedron, do not have cyst membrane, and buoyant density is 1.34g/mL in the complete virion cesium chloride, when density gradient centrifugation, is prone to separate with the ghost (density 1.29g/mL) of no DNA.The HPV genome is a closed loop distrand DNA, molecular weight 5*106 dalton.Can be divided into (E district) in early days by function, late period (L district) and three zones of non-coding region (NCR), E divides into the E1-E7 open reading frame, main coding and virus replication, transcribe, regulation and control and cell transformation proteins associated.For example E1 albumen is a kind of dna helicase, participates in the initial of viral dna replication process, and E2 is a kind of modulin, control expression of virogene and duplicating of DNA.E2 is through its effect that had not only combined E1 but also combined the virus replication starting point, and E1 is assembled in that said starting point is local, thereby, stimulate the replication initiation of viral DNA.E4 albumen has multiple unfixed function, but combines the host cell skeleton to belong to above-mentioned functions, and E5 postpones intravital acidifying, causes the EGF expression of receptor of cell surface to increase, and known E6 and E7 can both combine cellular proteins p53 and pRB separately.E6 and E7 albumen form and the Cancer-Related HPV type of uterine neck, are known oncogene.NCR is the dna fragmentation of E district and L interval-6.4-1.0kp, can be responsible for the regulation and control of transcribing and duplicating.L distinguishes L1 and L2, encode respectively main capsid protein and less important capsid protein.Identified that L1 and L2 gene are good immunoprophylaxis targets; Show for continuous tail papilloma virus of rabbits (CRPV) and bovine papilloma virus (BPV) systematic research, with the L1 that expresses in the bacterium and L2 albumen or use the immunization method of vaccine carrier to watch for animals not to be infected by the virus.Expressing human papillomavirus L1 gene or use vaccine carrier cause assembling assembly virus-like particle (VLP) in baculovirus expression system, and this virus-like particle has been used to induce the high titer virus neutralizing antibody relevant with being protected from virus attack to reply.Big quantity research shows that VLPs has good immunogenicity and reactivity, and height induces body to produce the neutralizing antibody of high titre, and developing vaccine based on this seems very promising.The main capsid protein of L1 genes encoding can stimulate body to produce protection antibody, can avoid body to receive the infection with type HPV again.Vaccine is regarded as a kind of mode of prevention pathogenic infection in history always, if infect, vaccine can excite immunity system, with in the identification also and pathogenic agent.Vaccine comprises one or more antigen from pathogenic agent; Normally deactivation or attenuation complete organism; Or, when immunity system is exposed to antigen, produces and make the individual cell that keeps throughout one's life said antigen immune memory from the specific antigen peptide of said organism.The exposure phase synantigen comprises when infecting said pathogenic agent once more stimulates specific immune response, thereby removes the pathogenic agent that infects or make the pathogenic agent inactivation of infection.

The peak period of the fundamental research of relevant HPV is over and done with, and the application epoch comprise that the diagnosis and the clinical application of vaccine come up, and particularly high-risk-type such as HPV16,18 preventative vaccine product are about to obtain more and more widely clinical use or even extensively universal.So far; The cervical cancer vaccine of succeeding in developing in the world mainly is two kinds of preventative vaccines: the tetravalent vaccine of a kind of Merck of being (Merck) pharmaceutical factory development is primarily aimed at two HPV high-risk-types 16,18 that cause cervical cancer and two the HPV

low risks

6,11 that cause genital warts; Another kind is the bivalent vaccine of GSK (Ge Lansu) pharmaceutical factory development to HPV high-risk-type 16,18, successively obtains Europe in June, 2006 and goes on the market with the approval of U.S. FDA.Merck & Co., Inc. uses cereuisiae fermentum and the Human-papilloma Vaccine that the application insect cell-baculovirus is researched and developed of GlaxoSmithKline PLC company is gone on the market; Mainly in European immunization; The expense of one person-portion is 350 dollars, and this price is obviously too high in China, can not be accepted by ordinary populace.For the development of engineered protein vaccine, except the selection of goal gene, the selection of expression of recombinant proteins system is important too.For the expressed L1 albumen of integrative gene expression system, can the oneself be assembled into VLPs.Study more at present in the world; What be fit to suitability for industrialized production is yeast expression system; It not only has advantages such as prokaryotic expression system is quick and easy, expense is low; And have the characteristics such as translation post-treatment, modification of eukaryotic expression system concurrently, make the L1 albumen of expression the oneself be assembled into VLPs, have good antigenicity.

Host cell is debaryomyces hansenii (Hansenula polymorpha) in the expression system that uses among the present invention; Methanol yeast is a type of growing up gradually in recent years as the cell factory expression alien gene desirable host of eukaryotic gene particularly; Wherein multiple-shaped nuohan inferior yeast is current ideal heterologous gene expression system of generally acknowledging in the world; Be suitable for the large-scale industrial production foreign protein, the technical superiority of debaryomyces hansenii and commercial application are worth and can reduce:

(1) optimum growth temperature high (37～43 ℃, pichia spp and yeast saccharomyces cerevisiae are 28 ℃), growth velocity is fast, is beneficial to large scale fermentation production, can efficiently express many genes of efficiently expressing of being difficult in other systems.

(2) exogenous origin gene integrator is in cell chromosome, and recombinant bacterial strain mitotic division genetic stability is high.

(3) can utilize cheap chemosynthesis substratum to carry out the cell high density fermentation, need not add expensive natural constituents (like yeast powder, peptone), further reduce production cost and improved the expression of exogenous gene level.Be easy to cultivate, can cultivate at the cheap substrate middle-high density, cell density is up to 100～130g/L dry weight.

(4) have autonomously replicating sequence (HARS), the frequency of reorganization is high, and recombinant plasmid can be incorporated on the karyomit(e) by high copy, is prone to obtain the transformant that high copy is integrated.Debaryomyces hansenii can be integrated a plurality of genes than substep by certain gene dosage, and the reorganization bacterium can provide favourable condition to carrying out the polygene transformation by the required gene of the ratio expression of the best.

(5) multiple-shaped nuohan inferior yeast has that genetic manipulation is simple, copy number of foreign gene is high, foreign protein output advantages of higher, is a heterologous gene expression system that has obtained extensive concern.

(6) in secretion type expression, foreign protein can be accomplished translation post-treatment processes such as proteolyze maturation, glycosylation modified and disulfide linkage formation through Secretory Pathway, makes expressed albumen more near having the native protein form of BA.

(7) compare with yeast saccharomyces cerevisiae, multiple-shaped nuohan inferior yeast has significant advantage aspect the expression gp, and the sweet dew sugar chain total length of itself is shorter, glycosylation modified fairly simple, is easy to carry out glycosylation engineered.

(8) strong promoter such as methanol oxidase gene (MOX) promotor capable of using and formaldehyde dehydrogenase gene (FMD) promotor starts expression of exogenous gene efficiently.Proteic expression is carried out in peroxysome usually, can make its degraded of avoiding intracellular protease, and has reduced the toxic action of pair cell.

(9) high temperature resistant, optimum growth temperature is 37-43 ℃, and growth velocity is fast, and the incubation time of large scale fermentation is short.Be the sole carbon source and the energy with glycerine or methyl alcohol in the fermentation, can utilize the mikrobe of glycerine few, the mikrobe that can utilize methyl alcohol still less, fermentation microbiological contamination rate is low.

Summary of the invention

The purpose of this invention is to provide a kind of HPV18L1 polynucleotide sequence; This sequence encoding HPV18L1 aminoacid sequence; Utilize expressed by Hansenula yeast system industrial production HPV18L1 capsid protein to become a reality thereby make, have higher, the low cost and other advantages of productive rate with respect to other eukaryotic expression systems of present employing.

Another object of the present invention provides a kind of expression vector of correspondence.

Another object of the present invention provides a kind of host cell.

Another purpose of the present invention is to propose said HPV18L1 polynucleotide sequence and corresponding expression vector, the application of host cell aspect pharmacy and preparation.

The present invention is that technical scheme is following:

At first, a kind of HPV18L1 polynucleotide sequence is provided, shown in SEQID NO.2, this sequence is following:

ATGGCCCTGTGGAGACCATCCGACAACACCGTCTACCTGCCACCACCATCCGTCGCCAGAGTCGTCAACACCGATGACTACGTCACCAGAACCTCCATCTTCTACCACGCTGGCTCCTCCAGACTGCTGACCGTCGGCAACCCATACTTCAGAGTCCCAGCGGGCGGTGGCAACAAGCAGGACATTCCAAAGGTCTCCGCTTACCAGTACAGAGTCTTCAGAGTCCAACTGCCAGACCCAAACAAGTTCGGCCTCCCAGACACCTCCATCTACAACCCAGAGACCCAGAGACTGGTGTGGGCTTGCGCTGGCGTCGAGATCGGCAGAGGACAGCCACTGGGCGTTGGCCTGTCGGGCCACCCATTCTACAACAAGCTTGACGACACCGAGTCCTCCCACGCCGCCACCTCCAACGTCTCCGAGGATGTCAGAGACAACGTCTCCGTCGACTACAAGCAGACCCAGCTGTGCATCCTGGGCTGCGCCCCAGCCATCGGCGAGCACTGGGCCAAGGGCACCGCTTGCAAGTCCAGACCACTGTCCCAGGGCGACTGCCCACCACTGGAGCTGAAAAACACCGTCCTGGAAGACGGCGACATGGTCGACACCGGCTACGGCGCCATGGATTTCTCTACCCTGCAGGACACCAAGTGCGAGGTCCCACTCGACATCTGCCAGTCCATCTGCAAGTACCCAGACTACCTCCAAATGTCCGCCGACCCATACGGCGACTCCATGTTCTTTTGCCTGAGAAGAGAGCAGCTGTTCGCCAGACACTTCTGGAATAGAGCCGGCACCATGGGCGACACCGTCCCACAGTCCCTGTACATCAAGGGCACCGGCATGAGAGCCTCCCCTGGCTCCTGCGTCTACTCCCCATCCCCATCGGGCTCCATCGTCACCTCCGACTCCCAGCTGTTCAACAAGCCATACTGGCTGCACAAGGCCCAAGGCCACAACAACGGCGTCTGCTGGCACAACCAGCTGTTCGTCACCGTCGTCGACACCACCAGATCCACCAACCTGACCATCTGCGCCTCCACCCAGTCCCCAGTCCCAGGTCAGTACGACGCTACCAAGTTCAAGCAGTACTCCAGACACGTCGAAGAATACGACCTGCAGTTCATCTTCCAGCTGTGCACCATCACCCTGACCGCCGACGTCATGTCCTACATCCACTCCATGAACTCCTCCATTCTTGAGGATTGGAACTTTGGCGTCCCACCACCACCAACCACCTCCCTGGTCGACACCTACAGATTCGTCCAGTCCGTCGCCATCACCTGCCAGAAGGACGCTGCCCCAGCCGAGAACAAGGACCCATACGACAAGCTGAAATTCTGGAACGTGGACCTGAAGGAGAAGTTCTCGCTGGACCTTGACCAGTACCCACTGGGCAGAAAGTTCCTGGTGCAGGCAGGACTGAGAAGAAAGCCAACCATCGGCCCAAGAAAGAGATCCGCCCCATCCGCCACCACCTCCTCCAAGCCAGCCAAGAGAGTCAGAGTCAGAGCTAGAAAGTAA

The codon of this polynucleotide sequence uses to be optimized through the codon preference mode of expressive host bacterial strain debaryomyces hansenii gene.

Coding HPV18L1 polynucleotide sequence provided by the invention, the codon use-pattern obtains with reference to the artificial design of codon preference pattern of the debaryomyces hansenii gene of high expression level.Artificial design time hopes that the codon use of said polynucleotide sequence is more approaching with the codon use-pattern of the debaryomyces hansenii gene of high expression level.Said polynucleotide sequence is a double chain DNA sequence; Said preferred polynucleotide sequence encoding HPV 18 L1; Therefore; The invention provides a kind of synthetic gene, this gene comprises ORFs coding HPV18L1 aminoacid sequence, wherein through selecting to make the optimizing codon of the similar debaryomyces hansenii of codon that possibly be used for encode such amino acid sequences; So that the frequency of utilization utmost point of codon is similar to the debaryomyces hansenii gene of high expression level rather than human papilloma virus virus gene in synthetic gene.Said codon uses the maximum or inferior big codon with the debaryomyces hansenii gene coefficient of performance of high expression level.With HPV18L1 aminoacid sequence total length 508 amino acid; Convert the nucleotide sequence of debaryomyces hansenii preference codon pattern into, the debaryomyces hansenii preferences is in primary codon in first-selected degenerate code, uses mainly that the debaryomyces hansenii preferences is in the first deputy codon in degenerate code; Few cases uses tertiary codon to accomplish local adjustment; Utilize DNAMAN software to avoid long complementary sequence, Tumor-necrosis factor glycoproteins,, avoid the hairpin structure of long complicacy through the RNA structure prediction; Get rid of strong secondary structure, increase specific intramolecule stability.Also avoiding in the nucleotide sequence of gene occurring maybe be to genetic transcription, translate the sequence of efficient deleterious impact, like intron montage sequence, transcription termination sequence, internal promoter sequence (TATA) and ribosome bind site (GGAGG) etc.Transcription termination sequence mainly contains: ATTATTTTAT, TTTTTATA, TAG (being rich in T) TA (G) GT, (being rich in AT) TTT etc.The invention provides the polynucleotide sequence of sequence 2, aminoacid sequence shown in the respective figure 2 has kept the codon-bias of debaryomyces hansenii gene.

One peptide species also is provided, and it comprises described HPV18L1 polynucleotide sequence.This polypeptide comprises one or more point mutation, thereby makes one or more natural biological function representations of this polypeptide be beneficial to purifying process and follow-up vaccine production.

Further, said polypeptide comprises all or part of of HPV18 late gene product.

Further; Above-mentioned polynucleotide sequence; Preference codon coefficient of performance with the debaryomyces hansenii gene of high expression level is reference; The maximum codon of debaryomyces hansenii coefficient of performance in first-selected degenerate code uses mainly that the debaryomyces hansenii preferences is in the first deputy codon in degenerate code, and few cases is used tertiary codon.

Simultaneously, above-mentioned polynucleotide sequence is fragment or the analogue that has kept debaryomyces hansenii codon preference use-pattern.

The present invention also provides a kind of expression vector, and it comprises above-mentioned polynucleotide sequence, and this polynucleotide sequence and carrier regulating and controlling sequence can be operatively connected, and said regulating and controlling sequence can make this polynucleotide sequence of host cell expression.

Described expression vector, it can make said polynucleotide sequence in the debaryomyces hansenii host cell, express.

Expression vector provided by the present invention; The expression that it comprises polynucleotide sequence of the present invention and can guide this polynucleotide sequence; This polynucleotide sequence coding HPV18L1 aminoacid sequence, said expression vector is pMPT-HPV18L1, its construction process is shown in accompanying drawing 5.

The autonomously replicating sequence HARS of debaryomyces hansenii methanol oxidase gene (MOX) promotor that said expression vector also comprises, methanol oxidase gene (MOX) terminator, 1.0kb, uracil gene ScURA3 and the several elements of pBluescrip II plasmid gene.

Can the whole bag of tricks be used for molecular cloning, sudden change and the evaluation of said elements HPV18L1 gene.These methods comprise; But be not limited to; Constructed cDNA or the genome dna library that contains the bacterium (like JM109, DH5 α etc.) of HPV18L1 gene behind synthetic HPV18L1 artificial sequence can directly be accomplished the functional expression of HPV18L1 gene in the suitable expression system.Another method comprises that the part DNA with coding HPV18L1 screens cDNA that contains HPV18L1 or the genome dna library that the plasmid shuttle vectors makes up in bacterium or debaryomyces hansenii.This a part of DNA is the Oligonucleolide primers according to the design of the preferred HPV18L1 nucleotide sequence of above-mentioned debaryomyces hansenii, and increasing through special polymerase chain reaction (PCR), the dna fragmentation of HPV18L1 obtains.Another method is from the cellular segregation RNA that produces HPV18L1 and through translation system in external or the body RNA to be translated into protein.RNA is translated into the HPV18L1 albumen that peptide or protein will cause producing at least a portion, and this part HPV18L1 albumen can obtain through the immunoreactivity with anti-HPV18L1 antibody identifying.In this method, can analyze the existence of the RNA of a part of HPV18L1 that from the RNA storehouse that produces the HPV18L1 cellular segregation, encodes at least; Further fractional separation RNA storehouse is so that purifying HPV18L1RNA therefrom; Analyze peptide or protein that this method produces; So that aminoacid sequence to be provided; These aminoacid sequences are used to the primer of producing HPV18L1cDNA is provided, and maybe can analyze the RNA that is used to translate, and it provides the nucleotide sequence of coding HPV18L1 and produce and is used to screen the probe in HPV18L1cDNA library.These methods are known in the art and can in for example " molecular cloning " (cold spring harbor laboratory publishes, cold spring port, 1989 for laboratory manual, second edition), find.

The clone HPV18L1DNA or its two mutants fragment that obtain through molecular cloning method; Insert said expression vector, this carrier contain suitable (MOX) promotor and other suitable transcription regulatory element like (MOX) terminator, autonomously replicating sequence HARS, uracil base because of URA3 and pBluescrip II plasmid gene.Said expression vector makes up according to the routine of biology field; For example, can use DNA and suitable initiator codon, promotor; Enhanser and other element; For example necessary polyadenylation signal has adjusting function after they are connected with correct direction, so that realize proteic expression.Appropriate carriers is known for a person skilled in the art.

The present invention also provides a kind of host cell, and this host cell comprises above-mentioned polynucleotide sequence or expression vector.Said host is a kind of many types of debaryomyces hansenii F-strain of uracil auxotrophy of zero reverse mutation, the URA3-auxotrophy host cell strain HU-11 that the applying gene technology of knocking out is set up.Described host cell has expression vector can compensate the URA3 auxotrophy that is used for transformant screening.

The invention allows for the corresponding product of above-mentioned polynucleotide sequence is using aspect treatment or the prevention HPV infection preparation.

The invention allows for above-mentioned polynucleotide sequence or polypeptide or expression vector or host cell in treatment or prevention skin wart, ASC, dysplasia of cervix, the application of intracutaneous tumorigenesis or cervical cancer medicine aspect on the neck.

The invention further relates to expressed by Hansenula yeast HPV18L1 polypeptide, polypeptide fragment or its viruslike particle purposes in preparation cervical cancer vaccine.

Multiple suitable expressed by Hansenula yeast HPV18L1 polypeptide, polypeptide fragment or its viruslike particle purification process are arranged.Include but not limited to that the salt classification separates; Ion exchange chromatography; Sieve chromatography; Hydroxylapatite adsorption chromatography, hydrophobic interaction chromatography and affinity chromatography (are specific to mono-clonal or the immune affinity column that polyclonal antibody is processed of the polypeptide fragment of total length HPV18L1, HPV18L1 through use; Or the polypeptide fragment of the newborn HPV18L1 of the total length that merges the differential protein label, HPV18L1 uses the affinity column that is specific to label) various combinations or use respectively, dissolve born of the same parents' thing and the extracting solution purifying debaryomyces hansenii HPV18L1 albumen of recombinating from cell.

The DNA code has 4 kinds (A, T, C and G), and the codon that wherein per three letters are formed is represented the proteic amino acid of the coded by said gene of organism.Translated into amino acid whose linear order in the protein of said coded by said gene along the linearly aligned codon of dna molecular.Codon has the degeneracy of height, 20 kinds of natural amino acids of 61 kinds of codon codings.Therefore, Most amino-acids by more than one several amino acid of codon coding-in fact by 4 kinds or more kinds of different ciphers coding.Because genetic code is a degeneracy, more than one codon can be used for the specific amino acid of encoding, so aminoacid sequence can be by DNA oligonucleotide coding like any category.When more than one codon was encoded a kind of specific amino acid, different plant species showed different preferences aspect the selection of codon, and the use of codon also has significant difference between the gene of the high level expression of species and low expression level.The virogene of for example, in bacterium, yeast or mammalian cell, expressing has unsuitable codon distribution for effectively expressing.Found that numerical example changes to the situation that the preferred codon of host has improved the heterogenous expression level with codon rare among the host.If there is codon rare among the host in the allogeneic dna sequence, the low-level heterogenous expression possibility of heterologous gene in said host is very big so.

Effectively yeast expression system comprises two main elements: start exogenous gene high-efficient expressed carrier system and the host cell with particular screen mark.Because the frequency of multiple-shaped nuohan inferior yeast homologous recombination is lower; Just possibly utilize the gene disruption method that is similar to yeast saccharomyces cerevisiae to obtain the gene disruption mutant strain when having only homologous sequence when both sides greater than 1kb; Therefore at present mostly the auxotrophic strain that uses is to obtain through chemomorphosis; Their outstanding shortcomings are that genetic stability is lower, are difficult to obtain the ideal transformant, and possibly have the multiple mutation effect; Make cells physiological biochemical characteristic and wild-type cell have notable difference, for large-scale commercial prodn is made troubles.We have made up a kind of many types of debaryomyces hansenii F-strain of uracil auxotrophy of zero reverse mutation, and the patent of invention that the URA3-auxotrophy host cell strain HU-11 (CGMCC No.1218) that the applying gene technology of knocking out is set up has applied for is CN1651570A.The reorganization multiple-shaped nuohan inferior yeast host strain of constructed inheritance stability, uracil auxotrophy; Multiple-shaped nuohan inferior yeast bacterium (Hansenula polymorpha) HU-11 CGMCC No.1218 particularly; This bacterial strain is higher than used both at home and abroad at present auxotrophy host bacterium genetic stability; Reverse mutation rate is low, is convenient to carry out the screening of genetic transformation and recombinant bacterial strain, and has kept the physio-biochemical characteristics of wild type strain; Help the cultivation of recombinant bacterial strain and efficiently expressing of foreign protein, have higher industrial application value.

Can include but not limited to transform through many technology, transfection, lipofection, protoplastis melts and electroporation imports to expression vector in the host cell.Cell and each that clonal propagation contains expression vector are analyzed to confirm whether they change the synthetic HPV18L1 gene of above-mentioned artificial design or its two mutants (fragment of fragment or fusion tag or total length) over to; Whether generation reorganization HPV18L1 polypeptide or polypeptide fragment, even whether form the polymer of this polypeptide.Can identify that to HPV18L1 expression host cell clone these approach include but not limited to, with the immunoreactivity of anti-HPV18L1 antibody through several approach.Can reclaim HPV18L1 albumen and further accomplish evaluation, include but not limited to the method for electron microscopic examination, molecular-weight determination, mass spectrum, isoelectric point determination, dynamic light scattering of light target protein with the HPV18L1 that purified form is provided.

Advantage and positively effect that the present invention has are: the present invention is through the transformation to HPV18L1 wild-type virus gene nucleotide series; Make reorganization HPV18L1 capsid protein in the debaryomyces hansenii system, efficiently express, and what reach through the electron microscopic examination proof list is to have the viruslike particle about identical immunogenicity and antigenic 50nm with the VLP of natural HPV18L1.The invention enables and utilize expressed by Hansenula yeast system industrial production HPV18L1 capsid protein to become a reality, the advantage that has that productive rate is higher, cost is low etc. with respect to other eukaryotic expression systems of present employing.

Description of drawings

Fig. 1 is the HPV18L1 nucleotide sequence and the amino acid sequence coded of encoding viral;

Fig. 2 is synthetic HPV16L1 nucleotide sequence of the present invention and amino acid sequence coded;

Fig. 3 is that the dna sequence dna shown in the sequence 2 is with virus code and debaryomyces hansenii preference codon mode profile comparable situation table;

Fig. 4 is that HPV18 brachymemma L1 composite coding gene pairs is answered aminoacid sequence;

Fig. 5 is the expression vector establishment synoptic diagram;

Fig. 6 is an agarose gel electrophoretogram;

Fig. 7 is west-blot (Western blot) figure;

Fig. 8 is HPV18L1 viruslike particle (VLPs) electromicroscopic photograph.

Embodiment

Embodiment 1:HPV18L1 gene order is optimized

With HPV18L1 aminoacid sequence total length 508 amino acid; Convert the nucleotide sequence of debaryomyces hansenii preference codon pattern into, the debaryomyces hansenii preferences is in primary codon in first-selected degenerate code, uses mainly that the debaryomyces hansenii preferences is in the first deputy codon in degenerate code; Few cases uses tertiary codon to accomplish local adjustment; Utilize DNAMAN software to avoid long complementary sequence, Tumor-necrosis factor glycoproteins,, avoid the hairpin structure of long complicacy through the RNA structure prediction; Get rid of strong secondary structure, increase specific intramolecule stability.Also avoiding in the nucleotide sequence of gene occurring maybe be to genetic transcription, translate the sequence of efficient deleterious impact, like intron montage sequence, transcription termination sequence, internal promoter sequence (TATA) and ribosome bind site (GGAGG) etc.Transcription termination sequence mainly contains: ATTATTTTAT, TTTTTATA, TAG (being rich in T) TA (G) GT, (being rich in AT) TTT etc.

The final whole sequence of confirming by 1524 based compositions; Shown in sequence in the sequence table 2; Amino acid sequence coded such as accompanying drawing 2; The aminoacid sequence like accompanying drawing 1 with virus code sequence in the sequence table 1 coding is compared unanimity, utilizes the dna sequence dna shown in the sequence 2 in total man worker's compound method composition sequence table, the nucleotide sequence codon of this debaryomyces hansenii preference with virus code and debaryomyces hansenii preference codon mode profile comparable situation shown in accompanying drawing 3.

Embodiment 2:HPV18L1 gene and HPV18L1 mutator gene expression vector establishment

Utilize the dna sequence dna shown in the sequence 2 in total man worker's compound method composition sequence table, the sequence two ends add the recognition site of restriction enzyme EcoR I and BamH I.Cut the synthetic dna sequence dna with EcoR I and BamH I enzyme, electrophoresis reclaims the fragment after enzyme is cut, and-20 ℃ of preservations are subsequent use.

With multiple-shaped nuohan inferior yeast CGMCC 2.2497 genomic dnas is template, methanol oxidase gene (MOX) promotor of clone 1.5kb, methanol oxidase gene (MOX) terminator of 350bp, the autonomously replicating sequence HARS of 1.0kb; And from YIp5 (GeneBank Acession NO.L09157) plasmid, clone the yeast saccharomyces cerevisiae uracil gene ScURA3 of 1.1kb; After above-mentioned 4 parts connection, insert the MCS of pBluescrip II plasmid, be built into shuttle vectors pMPT-02.

Cut carrier pMPT-02 with EcoR I and BamH I enzyme; The big fragment after enzyme is cut is reclaimed in the low melting-point agarose gel electrophoresis; Under the effect of T4-DNA ligase enzyme; Be connected with the synthetic dna sequence dna of same double digestion; 16 ℃ of ligations are overnight, and reaction solution transforms the TOP10 of TIANGEN Biotech (Beijing) Co., Ltd. competent cell, with the plate screening transformant of band amicillin resistance; Use primer primer fd:5 '-TCAAAAGCGGTATGTCCTTCCACGT-' 3 and primer:5 '-GCACGGTGGTGACATCAATCTAAAG-' 3 to contain the transformant of carrier pMPT-HPV16L1 through the pcr amplification screening to the intestinal bacteria transformant that grows on the plate; Screen the transformant enlarged culturing that obtains, purifying with the plasmid recovery test kit (TaKaRa MiniBEST Plasmid Purification Kit Ver.2.0) of precious biotechnology Dalian ltd obtains expression vector pMPT-HPV18L1, and the vector construction synoptic diagram is seen accompanying drawing 5.

Use primer primer fd:5 '-TCAAAAGCGGTATGTCCTTCCACGT-' 3 and primer p18J2:5 '-CGGGATCCAGATCTTCATTACAGTCCTGCCTGCACCAG-' 3; With pMPT-HPV 18L1 template pcr amplification; Obtain the dna sequence dna shown in the sequence 3; Be HPV18 brachymemma L1 composite coding gene order, its corresponding amino acid sequence is shown in accompanying drawing 4.

The above-mentioned same double digestion of sequence 3 usefulness, recovery, connection, conversion, screening and purification obtain corresponding expression vector.

Embodiment 3: the expression vector electricity transforms debaryomyces hansenii competence host cell

Cut carrier pMPT-HPV18L1 with Sac I enzyme, make the carrier linearizing.Linearizing carrier is through electrotransformation (the LN-101 type gene transfection instrument that Institutes Of Technology Of Tianjin produces, 1.5kV, 50 μ F, 200 Ω, 3-5mSec) conversion multiple-shaped nuohan inferior yeast (Hansenula polymorpha) CGMCC NO.1218.Containing 1.34g/100ml YNB (yeast nitrogen basic medium), screen transformant on the culture medium flat plate of 2g/100ml glucose.

Embodiment 4: the screening of goal gene multiple copied transformant, gene sequencing and copy number detect

1. cytoclasis

Get about 1mL100D yeast thalline to the 1.5mL centrifuge tube, remove supernatant behind the centrifugal 5min of 6000rpm, add and the identical pickling glass pearl of deposition thalline volume, 100 μ L cytoclasis liquid place the 5min～10min that vibrates on the vibrator.

2.DNA extracting

After cytoclasis is accomplished, in centrifuge tube, add 100 μ L sterilized waters, add 100 μ L phenol/chloroform extracts again, placed ten minutes for 4 ℃ behind the mixing, the centrifugal 5min of 10000rpm gets supernatant 1 μ L and is used for amplified reaction.

3.PCR amplification and agarose gel electrophoresis detect

Can increase the simultaneously MOX gene of debaryomyces hansenii list copy and the goal gene that is incorporated in the debaryomyces hansenii through the carrier conversion of the dna profiling pcr amplification that uses primer primer fd:5 '-TCAAAAGCGGTATGTCCTTCCACGT-' 3 and primer rs:5 '-GCACGGTGGTGACATCAATCTAAAG-' prepares more than 3 pairs, above primer is the HPV16L1 gene.The HPV16L1 fragment length that increases is 1500bp; The MOX fragment length of amplification is 2061bp; Appearance 5 μ L in 1.0% sepharose well, electrophoresis finish and take out the gel shooting, and the electrophoresis photo is seen accompanying drawing 6; Wherein 1500bp left and right sides band is a HPV16L1 gene band, and 2000bp left and right sides band is a MOX gene band.Wherein, 2,3,5,6,7 roads are high copy transformants; 4,9 roads are higher copy transformants; 8 roads copy transformant with being; 1 road is host bacterium (negative control); 10 roads are DL2000Marker, are followed successively by 2000bp, 1000bp, 750bp from top to bottom.

4. multiple copied strain target gene order-checking

Dna fragmentation with DNA purification kit extracting 1500bp behind the above amplification PCR products agarose gel electrophoresis carries out gene sequencing, and is consistent with design gene comparison result.

5. multiple copied transformant real-time quantitative PCR detects copy number

Known MOX gene is the single copy gene of debaryomyces hansenii; With the MOX gene is interior mark; The design primer is to same sample increase simultaneously MOX gene fragment and HPV18L1 gene fragment and with the quantitative real time PCR Instrument detection, through the HPV18L1 gene copy number of confirming that relatively individual cells comprises.Gene just can efficiently express after being transformed into recipient bacterium and stable integration through plasmid vector, and its copy number reflects the characteristic of the engineering strain expression target protein that efficiently expresses to a certain extent.

Because the MOX gene is single copy in the debaryomyces hansenii genome, so the segmental amount of the segmental amount/MOX of HPV18L1 is the copy number of the HPV18L1 gene of each cell.If: the dna molecular number when the HPV18L1 fragment amplification arrives threshold value is X _Nh, raw sample is that the dna molecular number of PCR reaction template is X _0hDna molecular number when the MOX fragment amplification arrives threshold value is X _Nm, raw sample is that the dna molecular number of PCR reaction template is X _0mCritical cycle number when HPV18L1 and MOX fragment amplification arrive threshold value is respectively C _ThAnd C _TmFluorescence threshold is R _tHPV18L1 and MOX amplified fragments bonded optical dye fluorescence intensity coefficient are respectively K _hAnd K _mE _mBe the segmental amplification efficiency of MOX; E _hBe the segmental amplification efficiency of HPV18L1.

Then have: X _Nh=X _0h(1+E _h) ^Cth.. (1)

M _nm＝M _0m(1+E _m) ^Cth………..(2)

When reaching threshold value: R _t=K _hX _Nh=K _mX _Nm(3)

Because two kinds of fragments all adopt SYBR Green I as fluorescent indicator, so K during amplification _h=K _m

Then have: X _0h(1+E _h) ^C _Th=M _0m(1+E _m) ^Cth(4)

The calculation formula of the HPV18L1 gene copy number that each cell contains is:

N＝X _0h/M _0m＝(1+E _m) ^Ctm/(1+E _h) ^Cth

When not considering MOX gene and the inconsistent E of being of HBsAg gene amplification efficient _m=E _hDuring=E, the calculation formula of HPV18L1 gene copy number is:

N=X _0h/ M _0m=(1+E) ^{Δ Ct}Δ C wherein _t=C _Tm-C _Th

Two pairs of primers all use online software Primer3 (http://cbr-cnrc.gc.ca/cgi-bin/Primer3) design, and the agency of ltd is synthetic by the precious biotechnology in Dalian.

Primer sequence:

HPV18L1?primer?forward(Sp1)：5‘-CCTCCATCTTCTACCACGCT-’3

HPV18L1?primer?reverse(As1)：5‘-GGAATGTCCTGCTTGTTGC-’3

MOX?primer?forward(Sp2)：5‘-GCCACCTTCTACTCGTCCAG-’3

MOX?primer?reverse(As2)：5‘-ACTCCCAGTCGTCGTAGTCG-’3

Wherein, the HPV18L1 fragment length that increases is 97bp, and the MOX fragment length of amplification is 145bp

Template DNA preparation is with above-mentioned DNA method for extracting, and it dilute as follows: the standard substance dilution, get 20 times of the dna solution dilutions earlier that a certain sample extracting obtains, and carry out serial dilution then, dilute 10 times at every turn, dilute 4 times, it is accurate that this dilutes requirement.Diluted sample is got other samples and is diluted 20 times earlier with the dna solution that extracting obtains, and carries out serial dilution then, dilutes 10 times at every turn, dilutes 2 times, and this dilution does not require accurately.

Real-time quantitative PCR reaction system: TV 20 μ L, each 0.5 μ L of wherein forward and reverse primer (10mM), EX Premix Taq (containing 4mM Mg2+, 0.4mM dNTP, 0.5MExTaq) 10 μ L, SYBR 0.5 μ L template 5 μ L.Real-time quantitative PCR detects the quantitative real time PCR Instrument (model: Rotor-Gene3000) of the Australian Corbett Research of use company.Real-time quantitative PCR reaction heat loop parameter: preparatory 94 ℃ of 5min of sex change, 94 ℃ of 15secs of sex change anneal and extend 60 ℃ of 50secs, 35 circulations.Fusion check atopic: slowly be warmed up to 94 ℃ from 60 ℃, heated up once in per 5 seconds, heat up 0.5 ℃ at every turn, signals collecting is once carried out in every rising.Utilize Rotor-Gene 5.0.28 (Corbett Research) software analysis sample copy number.

Embodiment 5: the operation of cell cultures abduction delivering

Frozen bacterial classification is taken out dissolving rapidly from-70 ℃ of refrigerators, after bacteria suspension being blown and beaten/stirred with the 0.2mL suction pipe, connect 40 μ L bacteria suspensions in the triangular flask that 10mL MD substratum is housed, each sample connects the triangular flask more than 2.Inoculation back shaking table was cultivated 31 ± 2 ℃ of culture temperature, shaking speed 160rpm about 24 hours.

Connect with suction pipe and to cultivate the bacteria suspension 0.1mL obtain and in the triangular flask that 10mL MD substratum is housed, cultivated 31 ± 2 ℃ of culture temperature, shaking speed 160rpm about 24 hours.

Change the bacteria suspension that obtains the 10mL centrifuge tube of the bacterium of going out over to, 3000rpm is centrifugal 10 minutes on desk centrifuge, abandons supernatant.Add about sterilized water 10mL, fully behind the mixing, 3000rpm is centrifugal 10 minutes on desk centrifuge, abandons supernatant.Do not have the thalline concussion mixing after the carbon source substratum will wash with 10mL, change in the triangular flask.

The methyl alcohol that in the cell suspension that above cultivation obtains, adds 0.5% (50 μ L) is put triangular flask and is cultivated on the shaking table, opens shaking table and adjusts temperature to 31 ± 2 ℃, and the adjustment rotating speed is to 160rpm, and concussion is cultivated.Rise next day and every morning, afternoon respectively add methyl alcohol once, between twice methyl alcohol stream adds as far as possible pitch time longer.

Behind the inducing culture 24 hours, add 1mL and do not have the carbon source substratum, add the methyl alcohol of 0.5% (55 μ L), triangular flask is put cultivated on the shaking table, open shaking table and adjust temperature to 31 ± 2 ℃, the adjustment rotating speed is to 160rpm, and concussion is cultivated.Inducing culture sampling detection after totally 72 hours, 30 times of bacteria suspension dilutions are with spectrophotometric instrumentation OD ₆₀₀Value, the OD of bacteria suspension behind the calculating inducing culture ₆₀₀Value is got suitable 1mL200D cell and is carried out the detection of expression level.

Embodiment 6: debaryomyces hansenii recombiant vaccine engineering bacteria 3 phase pilot scale fermentation technology

The height that screens in strain construction copy high expression level bacterial strain is prepared as former generation seed, main for seed, three grades of seed banks of work seed, is placed in-70 ℃ of refrigerator-freezers frozenly, the work seed is used for zymotechnique exploitation and vaccine fermentative prodn.

Culture medium preparation: seed culture medium: 2g/100ml glucose, 1.34g/100ml YNB; First order seed substratum 200mL, secondary seed medium 1600mL, autoclaving.From-70 ℃ of refrigerator-freezers, get (1mL, an OD ₆₀₀≈ 100) insert 200mL first order seed substratum, cultivate 24 hours switching 1600mL secondary seed medium enlarged culturing, cultivate 22 hour cell OD600 for 31 ℃ and reach more than 10, for 31 ℃ as ferment-seeded.

2. fermenting process:

Supplemented medium: NH ₄H ₂PO ₄87g is dissolved in the 540mL water, autoclaving; Other gets 260g glycerine, autoclaving.

Substratum derepresses: amount to 3L, NH ₄H ₂PO ₄27g, MgSO ₄7H ₂O 6g, KCl 6.8g, NaCl 0.7g, above raw material are dissolved in the 660mL water, autoclaving; Other gets 1.8L glycerine, autoclaving.

Inducing culture: glycerine 400mL, autoclaving adds 0.6L methyl alcohol after the sterilization.

Fermention medium: the cultivation initial body amasss 12L; NH ₄H ₂PO ₄175g, MgSO ₄7H ₂O 40g, KCl 44g, NaCl 4.4g, glycerine 520g, other adds the 4mL skimmer, jar interior 110-115 ℃ of autoclaving 30 minutes.

Zymotechnique: the 30L fermentor tank (model: MSJ-J2) carry out zymotechnique of producing with Japanese ball water chestnut physics and chemistry device institute; The fermentation cylinder for fermentation substratum is carried out online sterilization, and the FC-280 type dissolved oxygen monitor of biotechnology institute of East China University of Science carries out the monitoring and the control of dissolved oxygen.

The 1800mL secondary seed inserted begin fermentation in the fermentor tank that the sterilization of 12L fermention medium is housed, phase when zymotechnique mainly comprises three, phase when promptly growing, when derepressing during mutually with abduction delivering mutually.

Phase during growth: the control of fermentor tank pH value is set in 5.4-5.5; 30 ℃ of leavening temperature controls; Tank pressure 0.5Kg/cm ²Dissolved oxygen can slowly descend in the fermentor tank, when dropping to 60% left and right sides, (ferments about 16 hours), connects the feed supplement pipeline, at the uniform velocity squeezes into about 800mL supplemented medium with peristaltic pump.Reduce to 40% when following when the fermentor tank dissolved oxygen level, air flow quantity is transferred to 15L/min, mixing speed transfers to 700rpm.In phase later stage during growth (fermenting about about 22 hours), if cell growth state is good, the fermentor tank dissolved oxygen level can drop to below 20%; Cell OD ₆₀₀Reach more than 80.

Phase when derepressing: dissolved oxygen is connected the peristaltic pump attaching plug before ging up with dissolved oxygen monitor signal out-put supply; Monitor dissolved oxygen control 40, the dead band is 2, high-end opening; The peristaltic pump power switch is closed.Go back up to 60% when above when observing the fermentor tank dissolved oxygen by valley, get into phase when derepressing; Open the peristaltic pump power switch this moment, set pump speed 22rpm, begin stream and add the substratum that derepresses.Derepress the later stage, if the cell well-grown, OD ₆₀₀Can reach more than 300.

Phase when inducing: continue about 24 hours mutually when derepressing, get into phase when inducing, begin to add inducing culture, through methyl alcohol electrode control methanol concentration 0.3% (V/V), about 96 hours of whole fermentation time.

This zymotechnique makes the engineering strain that obtains through embodiment 1-5 obtain to efficiently express.

Fermentation cell suspension 10L adds the Tween80 of 3mL, stirs 2 hours; With the centrifugal 25min of Sigma 6K-15 whizzer 8000rpm, abandon supernatant, cell adds washing lotion [200mMPH6.2 phosphate buffered saline buffer; 0.5M NaCl; 4mMEDTA, 0.03%Tween80] stir resuspendedly ,-72 ℃ are frozen subsequent use.

Embodiment 7:L1 protein purification

Sample pretreatment:

-72 ℃ of freeze-stored cells melt for 4 ℃, add 200mM PMSF to final concentration 4mM, behind the suspension mixing, with high pressure homogenizer under the 1300BAR condition with twice of cytoclasis.With the centrifugal 25min of Sigma 6K-15 whizzer 8000rpm, get supernatant, with the Sai Duolisi Sartocon 2Plus tangential flow 10KDa of system membrane ultrafiltration; Concentrate 3 times; With 8 times of buffer A [25mMpH7.2 phosphate buffered saline buffer, 0.1M NaCl, 4mM EDTA; 0.03%Tween80] fully displacement, remove small molecular weight impurity.

The strong cation exchange chromatography:

Ion-the displacement chromatography resin is filled chromatography column, and (26mmID * 100mm), this post is used 0.5M NaOH cleaning-sterilizing to application QXL reinforcing yin essence before use.At room temperature use buffer A balance chromatography column.Room temperature ultrafiltration sample with the speed pump upper prop of 15 ml/min, is washed with 15 ml/min stream with 8 column volume HPV room temperature bufferA; 100%bufferA is to 100%bufferB [25mMpH7.2 phosphate buffered saline buffer; 2M NaCl, 4mM EDTA, 0.03%Tween80] the linear gradient elution chromatography column; Total linear gradient is 10 column volumes, collects the flow point with absorption peak.Behind the gradient elution, with 15 ml/min flushing post, the NaOH flushing post of 10 column volume 1N washes post, balance with bufferA with 15 ml/min with 5 column volume room temperature bufferB.

The Win 40350 column chromatography:

Fully replace the effective flow point of QXL reinforcing yin essence ion exchange chromatography wash-out with balance liquid [50mM MOPS, pH7.2,0.7M sodium-chlor] with the 10KDa membrane ultrafiltration, be used for all article on the Win 40350 column chromatography.

The 40g Win 40350 is used 200mM, the filling (chromatography column of 16mmID * 360mm) behind the abundant swelling of pH7.0 phosphate buffered saline buffer.Flow velocity 3mL/min (about 90cm/h LV), the balance liquid of 6 column volumes.Sample is balance liquid ultrafiltration and concentration, permanent filter, gets 50mL with 3 times of dilutions of balance liquid, and flow velocity 3mL/min goes up appearance.The balance liquid of 4 column volumes, the elutriant I of 2 column volumes [50mM MOPS, pH7.2,0.7M sodium-chlor, 5mM sodium phosphate], flow velocity 3mL/min stream is washed.To 100% elutriant II [50mM MOPS, pH7.2,0.7M sodium-chlor, 200mM sodium phosphate] gradient elution, collect elution peak with 8 column volumes, 100% elutriant I.With 1.5 column volumes, 100% elutriant III [50mM MOPS, pH7.2,0.7M sodium-chlor, 500mM sodium phosphate] wash-out, collect elution peak.Analyze each elution peak content purity with Bradford method (lowry method), SDS-PAGE electrophoresis, west-blot.

Embodiment 8: target protein west-blot detects

1. the cell of embodiment 5 acquisitions uses the yeast special protein extraction agent (YeastBuster) of Novagen to extract engineering bacteria and shakes bottle abduction delivering or embodiment 6 fermentation expression total protein of cell; The centrifugal cell debris that removes, supernatant is with 2Xloading Buffer [100mM Tris-Cl, pH6.8; 20% (w/v) glycerine; 2% (w/v) SDS, 0.2M DTT, a little tetrabromophenol sulfonphthalein] mix back boiling water bath 10 minute at 1: 1.

2. through the SDS-PAGE electrophoresis, use " molecular cloning " second edition protein polyacrylamide gel electrophoresis method, electrophoretic band is forwarded on the pvdf membrane, change the film effect through dying albumen Marker indication in advance.

3. use BSA to encapsulate HPV16L1 (CAMVIR-1): the sc-47699 monoclonal antibody is anti-as one, and Goat anti Mouse IgG-AP is anti-as two, detects the target protein specificity, develops the color with BCIP/NBT colouring reagents box.Transformant west-blot method The selection result is seen accompanying drawing 7.Wherein, 1,4 is albumen Marker, is followed successively by 170,130,100,70,55,40,35 from top to bottom, 25KDa.2 roads are that HPV18 total length L1 expresses transformant, and 3 roads are that HPV18 brachymemma L1 expresses transformant.

Embodiment 9: electron microscopic examination

Each sample (sample of slightly begin clear liquor, purifying or through the VLPs sample of re-assemble) is got one and is placed on the copper mesh that 200 order carbon cover.The phospho-wolframic acid of one 2% PH7.0 (PTA) places 20-60 second on the copper wire.Copper mesh gas carries out transmissioning electric mirror checking after doing, and all microscopes are accomplished with JEOL 100CE perspective electron microscope (JEOLUSA LAC) with the incremental voltage of 100kv.The displaing micro picture that produces finally is enlarged into 100,000 *.

Wherein HPV18L1 ultrafiltration sample electron microscopic examination result such as accompanying drawing 8 among the embodiment 7.

Embodiment 10: the animal immune test

The immunity of mouse: the ED50 that measures HPV18L1 VLP vaccine: use the SPF level NIH or the Balb/c mouse in 60 6～8 ages in week, be divided into 6 groups, every group of 10 mouse.Every each immune 1mL HPV18 VLP vaccine diluent of mouse, concentration is respectively: former times, 1: 5 times diluent, 1: 20 times of diluent, 1: 80 times of diluent, 1: 160 times of diluent, 1: 320 times of diluent.Adopt abdominal injection, six weeks of immunity back are put to death blood sampling, and serum separates and is no less than 0.5mL, deposit in-20 ℃ subsequent use.The vaccine ED50 value that HPV18 antigen immune mouse ELISA method detects ED50 (Reed-Muench method) calculating is 0.088 μ g.

The immunity of White Rabbit: with containing the fully not HPV18 VLP particulate antigen of formula adjuvant, 2 large ear rabbits of immunity.Immunizing dose is 160 μ g, and 4 weeks of immunity back and 10 weeks, each was strengthened once.The per two weeks blood sampling in immunity back is once put 2h in 37 ℃ with the blood of gathering, and moves into 4 ℃ again and spends the night, and the centrifugal 10min of 4000g draws supernatant, the polyvalent antibody of acquisition deposit in-20 ℃ subsequent use.The 10th week was put to death blood sampling, and serum separates and is no less than 50mL, deposit in-20 ℃ subsequent use.

Antiserum(antisera) ELISA detects: the HPV18VLP particulate antigen that obtains with purifying encapsulates 96 hole enzyme plates and spends the night; The site that does not combine the HPV18VLP particulate antigen with each hole of 1%BSA sealing; The antiserum(antisera) that adds mouse or large ear rabbit combines with HPV18VLP particulate antigen in the hole; Add the mouse or the large ear rabbit ELIAS secondary antibody that are combined with horseradish peroxidase; The

chromogenic substrate

3,3 ', 5 that adds horseradish peroxidase, 5 '-TMB; 2N H ₂SO ₄Detect the absorbance of each reacting hole after the color development stopping at the 405nm place with ELIASA.HPV18 antigen immune rabbit ELISA method detects the antibody titers result, and when finally getting antiserum(antisera), the sero-fast titre of White Rabbit was greater than 1: 10240.

Sequence table

< 110>Tianjin Chaoran Biological Technology Co., Ltd.

< 120>a kind of HPV18L1 polynucleotide sequence and expression vector, host cell and application

<130>

<160>3

<170>PatentIn?version?3.3

<210>1

<211>1524

<212>DNA

< 213>HPV18L1 encoding viral gene

<400>1

atggctttgt?ggcggcctag?tgacaatacc?gtatatcttc?cacctccttc?tgtggcaaga 60

gttgtaaata?ccgatgatta?tgtgactcgc?acaagcatat?tttatcatgc?tggcagctct 120

agattattaa?ctgttggtaa?tccatatttt?agggttcctg?caggtggtgg?caataagcag 180

gatattccta?aggtttctgc?ataccaatat?agagtattta?gggtgcagtt?acctgaccca 240

aataaatttg?gtttacctga?tactagtatt?tataatcctg?aaacacaacg?tttagtgtgg 300

gcctgtgctg?gagtggaaat?tggccgtggt?cagcctttag?gtgttggcct?tagtgggcat 360

ccattttata?ataaattaga?tgacactgaa?agttcccatg?ccgccacgtc?taatgtttct 420

gaggacgtta?gggacaatgt?gtctgtagat?tataagcaga?cacagttatg?tattttgggc 480

tgtgcccctg?ctattgggga?acactgggct?aaaggcactg?cttgtaaatc?gcgtccttta 540

tcacagggcg?attgcccccc?tttagaactt?aaaaacacag?ttttggaaga?tggtgatatg 600

gtagatactg?gatatggtgc?catggacttt?agtacattgc?aagatactaa?atgtgaggta 660

ccattggata?tttgtcagtc?tatttgtaaa?tatcctgatt?atttacaaat?gtctgcagat 720

ccttatgggg?attccatgtt?tttttgctta?cggcgtgagc?agctttttgc?taggcatttt 780

tggaatagag?caggtactat?gggtgacact?gtgcctcaat?ccttatatat?taaaggcaca 840

ggtatgcgtg?cttcacctgg?cagctgtgtg?tattctccct?ctccaagtgg?ctctattgtt 900

acctctgact?cccagttgtt?taataaacca?tattggttac?ataaggcaca?gggtcataac 960

aatggtgttt?gctggcataa?tcaattattt?gttactgtgg?tagataccac?tcgcagtacc 1020

aatttaacaa?tatgtgcttc?tacacagtct?cctgtacctg?ggcaatatga?tgctaccaaa 1080

tttaagcagt?atagcagaca?tgttgaggaa?tatgatttgc?agtttatttt?tcagttgtgt 1140

actattactt?taactgcaga?tgttatgtcc?tatattcata?gtatgaatag?cagtatttta 1200

gaggattgga?actttggtgt?tccccccccg?ccaactacta?gtttggtgga?tacatatcgt 1260

tttgtacaat?ctgttgctat?tacctgtcaa?aaggatgctg?caccggctga?aaataaggat 1320

ccctatgata?agttaaagtt?ttggaatgtg?gatttaaagg?aaaagttttc?tttagactta 1380

gatcaatatc?cccttggacg?taaatttttg?gttcaggctg?gattgcgtcg?caagcccacc 1440

ataggccctc?gcaaacgttc?tgctccatct?gccactacgt?cttctaaacc?tgccaagcgt 1500

gtgcgtgtac?gtgccaggaa?gtaa 1524

<210>2

<211>1524

<212>DNA

< 213>HPV18L1 composite coding gene

<400>2

atggccctgt?ggagaccatc?cgacaacacc?gtctacctgc?caccaccatc?cgtcgccaga 60

gtcgtcaaca?ccgatgacta?cgtcaccaga?acctccatct?tctaccacgc?tggctcctcc 120

agactgctga?ccgtcggcaa?cccatacttc?agagtcccag?cgggcggtgg?caacaagcag 180

gacattccaa?aggtctccgc?ttaccagtac?agagtcttca?gagtccaact?gccagaccca 240

aacaagttcg?gcctcccaga?cacctccatc?tacaacccag?agacccagag?actggtgtgg 300

gcttgcgctg?gcgtcgagat?cggcagagga?cagccactgg?gcgttggcct?gtcgggccac 360

ccattctaca?acaagcttga?cgacaccgag?tcctcccacg?ccgccacctc?caacgtctcc 420

gaggatgtca?gagacaacgt?ctccgtcgac?tacaagcaga?cccagctgtg?catcctgggc 480

tgcgccccag?ccatcggcga?gcactgggcc?aagggcaccg?cttgcaagtc?cagaccactg 540

tcccagggcg?actgcccacc?actggagctg?aaaaacaccg?tcctggaaga?cggcgacatg 600

gtcgacaccg?gctacggcgc?catggatttc?tctaccctgc?aggacaccaa?gtgcgaggtc 660

ccactcgaca?tctgccagtc?catctgcaag?tacccagact?acctccaaat?gtccgccgac 720

ccatacggcg?actccatgtt?cttttgcctg?agaagagagc?agctgttcgc?cagacacttc 780

tggaatagag?ccggcaccat?gggcgacacc?gtcccacagt?ccctgtacat?caagggcacc 840

ggcatgagag?cctcccctgg?ctcctgcgtc?tactccccat?ccccatcggg?ctccatcgtc 900

acctccgact?cccagctgtt?caacaagcca?tactggctgc?acaaggccca?aggccacaac 960

aacggcgtct?gctggcacaa?ccagctgttc?gtcaccgtcg?tcgacaccac?cagatccacc 1020

aacctgacca?tctgcgcctc?cacccagtcc?ccagtcccag?gtcagtacga?cgctaccaag 1080

ttcaagcagt?actccagaca?cgtcgaagaa?tacgacctgc?agttcatctt?ccagctgtgc 1140

accatcaccc?tgaccgccga?cgtcatgtcc?tacatccact?ccatgaactc?ctccattctt 1200

gaggattgga?actttggcgt?cccaccacca?ccaaccacct?ccctggtcga?cacctacaga 1260

ttcgtccagt?ccgtcgccat?cacctgccag?aaggacgctg?ccccagccga?gaacaaggac 1320

ccatacgaca?agctgaaatt?ctggaacgtg?gacctgaagg?agaagttctc?gctggacctt 1380

gaccagtacc?cactgggcag?aaagttcctg?gtgcaggcag?gactgagaag?aaagccaacc 1440

atcggcccaa?gaaagagatc?cgccccatcc?gccaccacct?cctccaagcc?agccaagaga 1500

gtcagagtca?gagctagaaa?gtaa 1524

<210>3

<211>1428

<212>DNA

< 213>HPV18 brachymemma L1 composite coding gene order

<400>3

atggccctgt?ggagaccatc?cgacaacacc?gtctacctgc?caccaccatc?cgtcgccaga 60

gtcgtcaaca?ccgatgacta?cgtcaccaga?acctccatct?tctaccacgc?tggctcctcc 120

agactgctga?ccgtcggcaa?cccatacttc?agagtcccag?cgggcggtgg?caacaagcag 180

gacattccaa?aggtctccgc?ttaccagtac?agagtcttca?gagtccaact?gccagaccca 240

aacaagttcg?gcctcccaga?cacctccatc?tacaacccag?agacccagag?actggtgtgg 300

gcttgcgctg?gcgtcgagat?cggcagagga?cagccactgg?gcgttggcct?gtcgggccac 360

ccattctaca?acaagcttga?cgacaccgag?tcctcccacg?ccgccacctc?caacgtctcc 420

gaggatgtca?gagacaacgt?ctccgtcgac?tacaagcaga?cccagctgtg?catcctgggc 480

tgcgccccag?ccatcggcga?gcactgggcc?aagggcaccg?cttgcaagtc?cagaccactg 540

tcccagggcg?actgcccacc?actggagctg?aaaaacaccg?tcctggaaga?cggcgacatg 600

gtcgacaccg?gctacggcgc?catggatttc?tctaccctgc?aggacaccaa?gtgcgaggtc 660

ccactcgaca?tctgccagtc?catctgcaag?tacccagact?acctccaaat?gtccgccgac 720

ccatacggcg?actccatgtt?cttttgcctg?agaagagagc?agctgttcgc?cagacacttc 780

tggaatagag?ccggcaccat?gggcgacacc?gtcccacagt?ccctgtacat?caagggcacc 840

ggcatgagag?cctcccctgg?ctcctgcgtc?tactccccat?ccccatcggg?ctccatcgtc 900

acctccgact?cccagctgtt?caacaagcca?tactggctgc?acaaggccca?aggccacaac 960

aacggcgtct?gctggcacaa?ccagctgttc?gtcaccgtcg?tcgacaccac?cagatccacc 1020

aacctgacca?tctgcgcctc?cacccagtcc?ccagtcccag?gtcagtacga?cgctaccaag 1080

ttcaagcagt?actccagaca?cgtcgaagaa?tacgacctgc?agttcatctt?ccagctgtgc 1140

accatcaccc?tgaccgccga?cgtcatgtcc?tacatccact?ccatgaactc?ctccattctt 1200

gaggattgga?actttggcgt?cccaccacca?ccaaccacct?ccctggtcga?cacctacaga 1260

ttcgtccagt?ccgtcgccat?cacctgccag?aaggacgctg?ccccagccga?gaacaaggac 1320

ccatacgaca?agctgaaatt?ctggaacgtg?gacctgaagg?agaagttctc?gctggacctt 1380

gaccagtacc?cactgggcag?aaagttcctg?gtgcaggcag?gactgtaa 1428

SEQUENCE?LISTING

< 110>Tianjin Chaoran Biological Technology Co., Ltd.

<130>

<160> 3

<170> PatentIn?version?3.3

<210> 1

<211> 1524

<212> DNA

< 213>HPV18L1 encoding viral gene

<400> 1

atggctttgt?ggcggcctag?tgacaatacc?gtatatcttc?cacctccttc?tgtggcaaga 60

gttgtaaata?ccgatgatta?tgtgactcgc?acaagcatat?tttatcatgc?tggcagctct 120

agattattaa?ctgttggtaa?tccatatttt?agggttcctg?caggtggtgg?caataagcag 180

gatattccta?aggtttctgc?ataccaatat?agagtattta?gggtgcagtt?acctgaccca 240

aataaatttg?gtttacctga?tactagtatt?tataatcctg?aaacacaacg?tttagtgtgg 300

gcctgtgctg?gagtggaaat?tggccgtggt?cagcctttag?gtgttggcct?tagtgggcat 360

ccattttata?ataaattaga?tgacactgaa?agttcccatg?ccgccacgtc?taatgtttct 420

gaggacgtta?gggacaatgt?gtctgtagat?tataagcaga?cacagttatg?tattttgggc 480

tgtgcccctg?ctattgggga?acactgggct?aaaggcactg?cttgtaaatc?gcgtccttta 540

tcacagggcg?attgcccccc?tttagaactt?aaaaacacag?ttttggaaga?tggtgatatg 600

gtagatactg?gatatggtgc?catggacttt?agtacattgc?aagatactaa?atgtgaggta 660

ccattggata?tttgtcagtc?tatttgtaaa?tatcctgatt?atttacaaat?gtctgcagat 720

ccttatgggg?attccatgtt?tttttgctta?cggcgtgagc?agctttttgc?taggcatttt 780

tggaatagag?caggtactat?gggtgacact?gtgcctcaat?ccttatatat?taaaggcaca 840

ggtatgcgtg?cttcacctgg?cagctgtgtg?tattctccct?ctccaagtgg?ctctattgtt 900

acctctgact?cccagttgtt?taataaacca?tattggttac?ataaggcaca?gggtcataac 960

aatggtgttt?gctggcataa?tcaattattt?gttactgtgg?tagataccac?tcgcagtacc 1020

aatttaacaa?tatgtgcttc?tacacagtct?cctgtacctg?ggcaatatga?tgctaccaaa 1080

tttaagcagt?atagcagaca?tgttgaggaa?tatgatttgc?agtttatttt?tcagttgtgt 1140

actattactt?taactgcaga?tgttatgtcc?tatattcata?gtatgaatag?cagtatttta 1200

gaggattgga?actttggtgt?tccccccccg?ccaactacta?gtttggtgga?tacatatcgt 1260

tttgtacaat?ctgttgctat?tacctgtcaa?aaggatgctg?caccggctga?aaataaggat 1320

ccctatgata?agttaaagtt?ttggaatgtg?gatttaaagg?aaaagttttc?tttagactta 1380

gatcaatatc?cccttggacg?taaatttttg?gttcaggctg?gattgcgtcg?caagcccacc 1440

ataggccctc?gcaaacgttc?tgctccatct?gccactacgt?cttctaaacc?tgccaagcgt 1500

gtgcgtgtac?gtgccaggaa?gtaa 1524

<210> 2

<211> 1524

<212> DNA

< 213>HPV18L1 composite coding gene

<400> 2

atggccctgt?ggagaccatc?cgacaacacc?gtctacctgc?caccaccatc?cgtcgccaga 60

gtcgtcaaca?ccgatgacta?cgtcaccaga?acctccatct?tctaccacgc?tggctcctcc 120

agactgctga?ccgtcggcaa?cccatacttc?agagtcccag?cgggcggtgg?caacaagcag 180

gacattccaa?aggtctccgc?ttaccagtac?agagtcttca?gagtccaact?gccagaccca 240

aacaagttcg?gcctcccaga?cacctccatc?tacaacccag?agacccagag?actggtgtgg 300

gcttgcgctg?gcgtcgagat?cggcagagga?cagccactgg?gcgttggcct?gtcgggccac 360

ccattctaca?acaagcttga?cgacaccgag?tcctcccacg?ccgccacctc?caacgtctcc 420

gaggatgtca?gagacaacgt?ctccgtcgac?tacaagcaga?cccagctgtg?catcctgggc 480

tgcgccccag?ccatcggcga?gcactgggcc?aagggcaccg?cttgcaagtc?cagaccactg 540

tcccagggcg?actgcccacc?actggagctg?aaaaacaccg?tcctggaaga?cggcgacatg 600

gtcgacaccg?gctacggcgc?catggatttc?tctaccctgc?aggacaccaa?gtgcgaggtc 660

ccactcgaca?tctgccagtc?catctgcaag?tacccagact?acctccaaat?gtccgccgac 720

ccatacggcg?actccatgtt?cttttgcctg?agaagagagc?agctgttcgc?cagacacttc 780

tggaatagag?ccggcaccat?gggcgacacc?gtcccacagt?ccctgtacat?caagggcacc 840

ggcatgagag?cctcccctgg?ctcctgcgtc?tactccccat?ccccatcggg?ctccatcgtc 900

acctccgact?cccagctgtt?caacaagcca?tactggctgc?acaaggccca?aggccacaac 960

aacggcgtct?gctggcacaa?ccagctgttc?gtcaccgtcg?tcgacaccac?cagatccacc 1020

aacctgacca?tctgcgcctc?cacccagtcc?ccagtcccag?gtcagtacga?cgctaccaag 1080

ttcaagcagt?actccagaca?cgtcgaagaa?tacgacctgc?agttcatctt?ccagctgtgc 1140

accatcaccc?tgaccgccga?cgtcatgtcc?tacatccact?ccatgaactc?ctccattctt 1200

gaggattgga?actttggcgt?cccaccacca?ccaaccacct?ccctggtcga?cacctacaga 1260

ttcgtccagt?ccgtcgccat?cacctgccag?aaggacgctg?ccccagccga?gaacaaggac 1320

ccatacgaca?agctgaaatt?ctggaacgtg?gacctgaagg?agaagttctc?gctggacctt 1380

gaccagtacc?cactgggcag?aaagttcctg?gtgcaggcag?gactgagaag?aaagccaacc 1440

atcggcccaa?gaaagagatc?cgccccatcc?gccaccacct?cctccaagcc?agccaagaga 1500

gtcagagtca?gagctagaaa?gtaa 1524

<210> 3

<211> 1428

<212> DNA

< 213>HPV18L1 composite coding gene truncated sequence

<400> 3

atggccctgt?ggagaccatc?cgacaacacc?gtctacctgc?caccaccatc?cgtcgccaga 60

gtcgtcaaca?ccgatgacta?cgtcaccaga?acctccatct?tctaccacgc?tggctcctcc 120

agactgctga?ccgtcggcaa?cccatacttc?agagtcccag?cgggcggtgg?caacaagcag 180

gacattccaa?aggtctccgc?ttaccagtac?agagtcttca?gagtccaact?gccagaccca 240

aacaagttcg?gcctcccaga?cacctccatc?tacaacccag?agacccagag?actggtgtgg 300

gcttgcgctg?gcgtcgagat?cggcagagga?cagccactgg?gcgttggcct?gtcgggccac 360

ccattctaca?acaagcttga?cgacaccgag?tcctcccacg?ccgccacctc?caacgtctcc 420

gaggatgtca?gagacaacgt?ctccgtcgac?tacaagcaga?cccagctgtg?catcctgggc 480

tgcgccccag?ccatcggcga?gcactgggcc?aagggcaccg?cttgcaagtc?cagaccactg 540

tcccagggcg?actgcccacc?actggagctg?aaaaacaccg?tcctggaaga?cggcgacatg 600

gtcgacaccg?gctacggcgc?catggatttc?tctaccctgc?aggacaccaa?gtgcgaggtc 660

ccactcgaca?tctgccagtc?catctgcaag?tacccagact?acctccaaat?gtccgccgac 720

ccatacggcg?actccatgtt?cttttgcctg?agaagagagc?agctgttcgc?cagacacttc 780

tggaatagag?ccggcaccat?gggcgacacc?gtcccacagt?ccctgtacat?caagggcacc 840

ggcatgagag?cctcccctgg?ctcctgcgtc?tactccccat?ccccatcggg?ctccatcgtc 900

acctccgact?cccagctgtt?caacaagcca?tactggctgc?acaaggccca?aggccacaac 960

aacggcgtct?gctggcacaa?ccagctgttc?gtcaccgtcg?tcgacaccac?cagatccacc 1020

aacctgacca?tctgcgcctc?cacccagtcc?ccagtcccag?gtcagtacga?cgctaccaag 1080

ttcaagcagt?actccagaca?cgtcgaagaa?tacgacctgc?agttcatctt?ccagctgtgc 1140

accatcaccc?tgaccgccga?cgtcatgtcc?tacatccact?ccatgaactc?ctccattctt 1200

gaggattgga?actttggcgt?cccaccacca?ccaaccacct?ccctggtcga?cacctacaga 1260

ttcgtccagt?ccgtcgccat?cacctgccag?aaggacgctg?ccccagccga?gaacaaggac 1320

ccatacgaca?agctgaaatt?ctggaacgtg?gacctgaagg?agaagttctc?gctggacctt 1380

gaccagtacc?cactgggcag?aaagttcctg?gtgcaggcag?gactgtaa 1428

ttcaagcagt?actccagaca?cgtcgaagaa?tacgacctgc?agttcatctt?ccagctgtgc 1140

accatcaccc?tgaccgccga?cgtcatgtcc?tacatccact?ccatgaactc?ctccattctt 1200

gaggattgga?actttggcgt?cccaccacca?ccaaccacct?ccctggtcga?cacctacaga 1260

ttcgtccagt?ccgtcgccat?cacctgccag?aaggacgctg?ccccagccga?gaacaaggac 1320

ccatacgaca?agctgaaatt?ctggaacgtg?gacctgaagg?agaagttctc?gctggacctt 1380

gaccagtacc?cactgggcag?aaagttcctg?gtgcaggcag?gactgcacca?tcaccaccat 1440

cactaa 1446

Claims

1. HPV18L1 polynucleotide sequence, it is characterized in that: its polynucleotide sequence is shown in SEQID NO.2.

2. a peptide species, it is characterized in that: it comprises the described polynucleotide sequence of claim 1.

3. polypeptide according to claim 2 is characterized in that: said polypeptide comprises all or part of of HPV18 late gene product.

4. each described polynucleotide sequence during aforesaid right requires; Preference codon coefficient of performance with the debaryomyces hansenii gene of high expression level is reference; The maximum codon of debaryomyces hansenii coefficient of performance in first-selected degenerate code; The debaryomyces hansenii preferences is in the first deputy codon in main use degenerate code, and few cases is used tertiary codon.

5. to require each polynucleotide sequence of 1-3 be fragment or the analogue that has kept debaryomyces hansenii codon preference use-pattern to aforesaid right.

6. expression vector, it comprises each polynucleotide sequence of aforesaid right requirement 1-3, and this polynucleotide sequence and carrier regulating and controlling sequence can be operatively connected, and said regulating and controlling sequence can make this polynucleotide sequence of host cell expression.

7. host cell, this cell comprises described polynucleotide sequence of claim 1 or the described expression vector of claim 6.

8. according to the described host cell of claim 7, this host cell has expression vector can compensate the URA3 auxotrophy that is used for transformant screening.

9. the application of the corresponding product of each described polynucleotide sequence of claim 1-4 aspect treatment or prevention HPV infection preparation.

Claim 1-8 each in treatment or prevention skin wart, ASC, dysplasia of cervix, the application of intracutaneous tumorigenesis or cervical cancer medicine aspect on the neck.