CN102719437A - Application of mediated PLK1 RNAi (polo-like kinase-1 ribonucleic acid interference) of lentivirus vector in treatment of esophageal squamous carcinoma metastasis - Google Patents
Application of mediated PLK1 RNAi (polo-like kinase-1 ribonucleic acid interference) of lentivirus vector in treatment of esophageal squamous carcinoma metastasis Download PDFInfo
- Publication number
- CN102719437A CN102719437A CN2012102404871A CN201210240487A CN102719437A CN 102719437 A CN102719437 A CN 102719437A CN 2012102404871 A CN2012102404871 A CN 2012102404871A CN 201210240487 A CN201210240487 A CN 201210240487A CN 102719437 A CN102719437 A CN 102719437A
- Authority
- CN
- China
- Prior art keywords
- plk1
- esophageal squamous
- gene
- people
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to building of a recombinant lentiviral vector as to PLK1 (polo-like kinase-1) gene RNA (ribonucleic acid) interference and application of the recombinant lentiviral vector in treatment of esophageal squamous carcinoma metastasis. The recombinant lentiviral vector comprises a segment of nucleotide sequence and lentivirus vector pGLV/H1/GFP+Puro, a positive-sense strand and an antisense strand capable of expressing a human PLK1 gene siRNA (small interface ribonucleic acid) molecule, and human PLK1mRNA is subjected to specific degradation to lead to expression silence. Therefore, the recombinant lentiviral vector of mediated PLK1RNAi disclosed by the invention possibly becomes a powerful tool for esophageal squamous carcinoma gene treatment.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of structure of the recombined lentivirus vector to people PLK1 gene RNAi and the production of recombinant slow virus, and this recombinant slow virus is applied to suppress the transfer of esophageal squamous cell carcinoma.
Background technology
In the prior art, the known PLK1 of those skilled in the art (Polo-like kinase 1) is a kind of serine/threonine kinase of mammalian cell of high conservative.PLK1 plays crucial effect at the different times of cell mitogen, and normally the carrying out of cell cycle, centrosome maturation, division of cytoplasm etc. all have material impact.Discovering in recent years, PLK1 all shows as high expression level in most of human tumors, and too high lung cancer in non-cellule type, tumor of head and neck, the melanoma patients of being expressed in of PLK1 all pointed out prognosis mala.The high expression level of PLK1 is also integrated the Invasion and Metastasis that plain protein level has been induced breast cancer cell through regulating cell surface beta1.All these results of study show: PLK1 might become the novel targets of treating malignant tumor.
At present, the researchist also to have carried out one after another with PLK1 be the research of the antitumor drug of target spot.Set up antisense oligonucleotide to PLK1 mRNA; It can be specifically shows as the restraining effect of dose-dependently to PLK1mRNA and protein product thereof; The activity of serine/threonine kinases that has also suppressed PLK1 thus; The propagation of tumour cell in culturing cell system or the nude mice tumor model be can effectively suppress, and the growth and the viability of normal mesangial cell of human body and amnion fibroblast do not influenced.With the micromolecular compound inhibitor of PLK1 structurally associated the tumour of high expression level PLK1 is also played certain restraining effect.The RNA interfering of target PLK1 then has higher specificity and validity as the therapy of tumor medicine.Behind the siRNAs of transfection target PLK1; Each tumor cell line comprises breast cancer cell MCF-7, cervical cancer cell HeLa S3, colon cancer cell SW-480 and lung cell A549; Cell proliferation receives obvious inhibition; Apoptosis appears, and in the colon cancer cell of transfection, the ability of centrosome forfeiture polymerization microtubule and then formation spindle body.On the mouse model of bladder cancer, target applied can suppress the growth of bladder cancer to the siRNA/ of PLK1 cationic-liposome in position.
Except chemosynthesis PLK1siRNA approach, also have carrier mediated PLK1siRNA to express.But owing to the restriction that receives transfection efficiency to a great extent that acts on of RNAi inhibition of gene expression, improving transfection efficiency is a key link.Slow virus is a kind of retroviral vector, not only can infect the cell of division stage and is incorporated in its genome, but also can infect the cell of non-division stage.Slow virus makes the RNA perturbation technique be widely used in field of gene as the siRNA carrier at present.
The application of the siRNA of the target PLK1 of the slow virus that do not appear in the newspapers in prior art mediation in treatment human esophagus squama cancerous invasion shifts.
Summary of the invention
The object of the present invention is to provide a kind of recombined lentivirus vector, can effectively suppress PLK1 genetic expression in the esophageal squamous cell carcinoma cell, and the application of this recombined lentivirus vector in the treatment esophageal squamous cell carcinoma shifts further is provided to people PLK1 gene RNAi.
The siRNA sequence that effectively suppresses PLK1 genetic expression in people's esophageal squamous cell carcinoma cell among the present invention is: positive-sense strand: 5'-GGGCGGCUUUGCCAAGUGCUtt-3', antisense strand: 5'-AGCACUUGGCAAAGCCGCCCtt-3'.
The present invention at first chooses candidate's siRNA sequence from the cDNA zone of people PLK1 according to siRNA sequences Design principle; Guarantee the specificity of candidate siRNA sequence through the comparison of BLAST homology again to the PLK1 gene; Selected at last 2 siRNA sequences to PLK1 mRNA possible in theory, detailed sequence is seen siRNA-PLK1-1 and the siRNA-PLK1-2 in the table 3.SiRNA-NC (the lucky triumphant gene in Shanghai) is the siRNA as negative control.Through the positive-sense strand and the antisense strand of synthetic PLK1 siRNA sequence of external chemical synthesis and negative control, 56 ℃ of annealing of positive-sense strand and antisense strand form double-stranded then.With synthetic PLK1 siRNA and negative control people's esophageal squamous cell carcinoma cell of transfection vitro culture respectively simultaneously, adopt the method for RT-PCR and Western Blot to detect the jamming effectiveness of PLK1 siRNA, definite siRNA sequence efficiently.People's esophageal squamous cell carcinoma cell of this PLK1 siRNA sequence transient transfection vitro culture through the TRANSWELL experiment, confirms that this sequence can obviously suppress the invasive ability of esophageal squamous cell carcinoma cell; Through cut healing experiment, the result shows that this sequence has obvious restraining effect to the transfer ability of esophageal squamous cell carcinoma cell; Form this sequence of experiment confirm through plate clone experiment, soft-agar cloning and can obviously suppress esophageal squamous cell carcinoma cells in vitro malignant proliferation; Detect the apoptosis that this sequence of explanation can be induced the esophageal squamous cell carcinoma cell through external TUNEL experiment, flow cytometer.
According to this effective siRNA sequence, design people PLK1 gene shRNA sequence, detailed sequence is seen shRNA-PLK1 and the negative control shRNA-NC in the table 3.
According to above-mentioned people PLK1 gene shRNA sequence, combine the carrier characteristics to synthesize its corresponding double chain DNA fragment again, detailed sequence is seen DNA-shRNA-PLK1 and negative control DNA-shRNA-NC in the table 3.
Because double chain DNA fragment has restriction enzyme site
The BamH IWith
The EcoR ISo, use
The BamH IWith
The EcoR IEnzyme is cut lentiviral vectors pGLV/H1/GFP+Puro (Shanghai JiMa pharmacy Technology Co., Ltd), is connected to lentiviral vectors to the synthetic dna fragmentation, obtains recombined lentivirus vector.Recombined lentivirus vector Supersilencing-DNA-shRNA-PLK1 packaged in combination plasmid Helper Vector cotransfection 293T cell obtains the packing recombinant slow virus.Make up nude mice subcutaneous transplantation knurl model and nude mice lung metastasis model respectively, utilize recombinant slow virus infectosome inner cell, find that this recombinant slow virus can obviously suppress the interior malignant proliferation of body and the lung transfer of esophageal squamous cell carcinoma cell.
Beneficial effect of the present invention is: the present invention provides the reticent people PLK1 of 1 pair of ability specificity the siRNA sequence of gene, through the in-vitro transfection experiment, confirms that this sequence can effectively suppress invasion and attack, migration, malignant proliferation and the apoptosis of esophageal squamous cell carcinoma cell.Made up can stably express above-mentioned siRNA sequence lentiviral vectors Supersilencing-DNA-shRNA-PLK1, and in the 293T cell, produce this recombinant slow virus with high infection rate.Through infection experiment in the body, interior malignant proliferation of body and lung that the recombinant slow virus of this high efficiency stable expression PLK1 gene shRNA sequence can obviously suppress the esophageal squamous cell carcinoma cell shift.This result of study provides new approaches for the new bio genomic medicine of the anti-esophageal squamous cell carcinoma of exploitation.
Description of drawings
Fig. 1 screens the esophageal squamous cell carcinoma cell of high expression level PLK1
A desires to make money or profit and detects the expression amount of PLK1 gene mRNA in the different esophageal squamous cell carcinoma clones with RT-PCR.
B desires to make money or profit and detects the expression amount of PLK1 protein level in the different esophageal squamous cell carcinoma clones with Western Blot.With Actin is confidential reference items, and TE-8 is the clone of high expression level PLK1 as a result.
Effective siRNA transfection esophageal squamous cell carcinoma cell TE-8 of Fig. 2 target PLK1 detects jamming effectiveness with Western Blot, sets up three contrasts, respectively transfection PBS, Lipo and siRNA-NC.
The RNA YM 14090 of Fig. 3 target PLK1 obviously suppresses the invasive ability of esophageal squamous cell carcinoma cell
A figure TRANSWELL experimental result is set up three contrasts, respectively transfection PBS, Lipo and siRNA-NC.
The statistics of B figure TRANSWELL experiment.
Fig. 4 cut healing experimental result is set up three contrasts, respectively transfection PBS, Lipo and siRNA-NC.The RNA that target PLK1 is described disturbs the transfer ability to the esophageal squamous cell carcinoma cell that obvious restraining effect is arranged.
Fig. 5 plate clone experimental result explains that the RNA YM 14090 of target PLK1 obviously suppresses the inside and outside malignant proliferation of esophageal squamous cell carcinoma cell.
Fig. 6 soft-agar cloning forms experimental result, explains that the RNA YM 14090 of target PLK1 obviously suppresses the inside and outside malignant proliferation of esophageal squamous cell carcinoma cell.
The external TUNEL of Fig. 7 experiment (A) and flow cytometer detection (B) result, the RNA YM 14090 that target PLK1 is described is induced the apoptosis of esophageal squamous cell carcinoma cell.
Fig. 8 Supersilencing-DNA-shRNA-PLK1 sequencing result figure, underscore are partly for inserting the DNA-shRNA-PLK1 sequence of lentiviral vectors.
Fig. 9 recombinant slow virus infects nude mice subcutaneous transplantation knurl model result, explains that the RNA YM 14090 of target PLK1 obviously suppresses the interior malignant proliferation of body of esophageal squamous cell carcinoma cell.
Figure 10 recombinant slow virus infects the experiment of nude mice lung metastasis model, explains that the RNA YM 14090 of target PLK1 obviously suppresses the lung transfer of esophageal squamous cell carcinoma cell.
Embodiment
Below will combine detailed description the present invention of the further indefiniteness of accompanying drawing.
People's esophageal squamous cell carcinoma cell of embodiment 1 usefulness RT-PCR and Western Blot method screening high expression level PLK1
1、RT-PCR
The Trizol cracking process extracts people's esophageal squamous cell carcinoma cell total rna, and is quantitative to total RNA with spectrophotometer, and is cDNA with Takara company reverse transcription reaction test kit (TaKaRa Code:DRR037A) reverse transcription.Use
TaKaRa Taq((TaKaRa Code:DR001A) carries out pcr amplification, concrete steps reference reagent box specification sheets.The primer of people PLK1 and confidential reference items Actin is seen table 1, and reaction system is seen table 2.
The primer sequence of table 1 PLK1 and confidential reference items Actin
Table 2 PCR reaction system
| Reagent | The amount that adds reagent |
| 10X PCR buffer（Mg 2+ free） | 5 μl |
| MgCl 2（25mM） | 3 μl |
| 2.5mM dNTP mix | 4 μl |
| The 10 μ M Primer upper reaches |
1 |
| 10 μ M Primer downstream | 1 μl |
| Template cDNA | 1 μl |
| The Taq enzyme | 0.25 μl |
| Sterilized water | Up to 50μl |
Reaction conditions: 95 ℃ of 3 min, 72 ℃ of 1 min of 55 ℃ of 30 sec of 95 ℃ of 30 sec carries out 22 circulations, 72 ℃ of 10 min.
2、Western?Blot
(1) prepares protein: esophageal squamous cell carcinoma clone TE-8, TE-10, TE-15, the Eca-109 that will be in logarithmic phase; Discard old nutrient solution; PBS with precooling in advance washes 2 times, scrapes with cell and gets cell, 4 ° of C of 3000 rpm, 5 min centrifugal collecting cells deposition.RIPA lysate lysing cell, the proteinase inhibitor of adding 1%, every pipe adds 200 microlitre RIPA, sustained oscillation 5 min.Place 30 min on ice, whenever make lysis abundant at a distance from the concussion of 10 min vortexs.Centrifugal 10 min of 12000 rpm go to a new EP pipe with supernatant, abandon deposition.Use green skies BCA determination of protein concentration test kit to carry out protein quantification.Get the albumen of an amount of volume, add 5 * sample-loading buffer, mix, boiling water boils 5 min.
(2) SDS-PAGE electrophoresis: record sds page; Last appearance, every hole 20 μ l; Run glue, spacer gel 80 V, separation gel 100 V.
(3) semidrying is changeed film: clip and gel phase immerse transfering buffering liquid with the nitrocellulose filter and the 6 metafiltration paper of size with film and filter paper.(if usefulness be pvdf membrane, then will with pvdf membrane in methyl alcohol after of short duration the soaking, move into transfering buffering liquid again and soak).By changeing membrane electrode plate negative electrode to anode direction, by the method for putting of similar " sandwich ", neatly stack three metafiltration paper, gel, nitrocellulose filter and three metafiltration paper respectively, and perform mark at film one jiao with soft pencil, carefully removal remains in the bubble of each interlayer." sandwich " that make put into transfer groove, and the transfering buffering liquid that adds capacity is soaked in the liquid it fully, connects with the mains, and changes film.100 V change film 60 min.
(4) sealing:, then film is inserted in the PBST confining liquid that contains 5% (w/v) skim-milk room temperature jolting 1 h with PBS rinsing nitrocellulose filter 10～15 min; PBST rinsing film 3 times, each 5～10 min.
(5) one anti-hatching: 37 ℃ are shaken 1 h slowly, and turn-over makes and hatches evenly frequently, and 4 ℃ are spent the night; PBST rinsing film 3 times, each 5～10 min.
(6) two anti-hatching: room temperature, 2 h; PBST rinsing film 3 times, each 5～10 min.
(7) darkroom exposure.
Embodiment 2 is to the chemosynthesis of the RNA interfering of PLK1 gene
MRNA sequence (NM-005030.0) based on people PLK1 gene; Adopt the synthetic two couples of PLK1 siRNA of the known chemical synthesis of prior art; Be siRNA-PLK1-1 and siRNA-PLK1-2 (Shanghai JiKai Gene Chemical Technology Co., Ltd is synthetic); SiRNA-NC is the negative control of siRNA-PLK1, and concrete sequence is seen table 3.Through screening, siRNA-PLK1-1 has interference performance efficiently to the PLK1 gene.
SiRNA in this research of table 3, shRNA and dna sequence dna
Embodiment 3 TRANSWELL methods detect the invasive ability of esophageal squamous cell carcinoma cell
With the PLK1 siRNA of chemosynthesis and contrast siRNA fragment transient transfection TE-8 esophageal squamous cell carcinoma cell 48h, trysinization is inoculated among the TRANSWELL (Matrigel encapsulates) with the density of 50,000 cells of every WELL, leaves standstill 1 h.The substratum that in lower floor, adds antibiotic-free, no foetal calf serum is cultivated 16 h.Take out WELL, 4% Paraformaldehyde 96 is fixed 10 min.PBS washes twice, violet staining, 30 min.Careful wiping WELL is inner with cotton swab, wipes the cell of internal surface.PBS washes 3 times, and microscopically is observed and taken a picture.Get 10 visual field countings at random, variate is drawn column diagram.
Embodiment 4 cuts healing experiment detects the transfer ability of esophageal squamous cell carcinoma cell
With TE-8 esophageal squamous cell carcinoma cell inoculation in six orifice plates, when cell density reaches 90%, the PLK1 siRNA of transient transfection chemosynthesis and contrast siRNA fragment 48 h.Rifle head point with 200 μ l is rule on six orifice plates with uniform dynamics.Wash cell 3 times with the substratum of antibiotic-free, no foetal calf serum.Use 2% culture medium culturing 24 h instead.Take pictures.
Embodiment 5 clones form and soft-agar cloning forms experiment detection esophageal squamous cell carcinoma cells in vitro malignant proliferation ability
1, the clone forms experiment: pair cell is handled in six orifice plates, comprises transfection siRNA etc.; Behind 48 h, digest treated cell, and the concentration of cell by 100 in every hole is inoculated in six orifice plates; Let cell self-sow 14 days, remove substratum, PBS washes fixing 10 min of twice, 4% Paraformaldehyde 96; PBS washes twice, violet staining, the Viola crystallina that the PBS flush away is unnecessary.Take pictures counting.
2, soft-agar cloning forms experiment: prepare the LMP agar liquid glucose of 1.2% and 0.7% two concentration, autoclaving respectively with zero(ppm) water; After in the 1:1 ratio 1.2% agarose and 2 * DMEM substratum (calf serum that contains 2 * microbiotic and 20%) being mixed, add in six orifice plates cooled and solidified; Digest the good cell of packet transaction; Let 0.7% agarose with after 2 * DMEM substratum mixes in sterile test tube mutually in the 1:1 ratio, in pipe, add cell suspension (final concentration is 3000 cells/well) again, fully mixing; In six orifice plates, by forming two agar layer.After treating that top-layer agar solidifies, insert 37 ℃ of 5% CO
2Cultivated 14 days in the incubator; Be placed on plate under the inverted microscope observation of cell clone number.Calculate cloning efficiency.
1, external TUNNEL: experiment is carried out in six orifice plates, places the sterility cover slide, inoculates the esophageal squamous cell carcinoma cell to logarithmic phase, the PLK1 siRNA of transient transfection chemosynthesis and contrast siRNA fragment 48 h.PBS washed cell creep plate is twice under the room temperature.With 4 ℃ of fixing 25 min of neutral formalin.The PBS washed twice, each 5 min.Cell climbing sheet is placed PBS solution 5 min of 0.2% TritonX-100.PBS washed cell creep plate twice under the room temperature, each 5 min.Add balance liquid (Equlibration buffer) 100 μ l, 5 ~ 10 min under the room temperature, the unnecessary balance liquid of flush away adds 50 μ l TdT incubation buffer, makes it evenly lucifuge, 37 ℃ of wet 60 min that educate with plastic coverslip; Cell climbing sheet is placed 2 * SCC termination reaction, 15 min under the room temperature, inverted fluorescence microscope is observed down.
2, flow cytometer detects: the cell after the collection and treatment, and PBS damping fluid washing 2 times is abandoned supernatant behind centrifugal 3 min of 1000g, slowly adds 1 ml, 70% ice ethanol, and soft mixing is processed cell suspension ,-20 ℃ of fixed overnight.Take out cell before streaming detects, abandon supernatant behind centrifugal 3 min of 1000g, add PI staining fluid 1 ml, incubated at room 30 min.The upflowing cell instrument detects the DNA-PI fluorescence intensity.Flow cytometer exciting light and wavelength of transmitted light are respectively 488 nm and 530 nm, each sample 1 * 10
4Individual cell.Use Coulter Elite 4.5 Multicycle softwares to carry out parameter acquiring and interpretation of result.
The structure of embodiment 7 Supersilencing-DNA-shRNA-PLK1 recombined lentivirus vectors
Select the dna sequence dna DNA-shRNA-PLK1 of siRNA-PLK1-1 sequences Design shRNA and coding shRNA for use, and add restriction enzyme site according to carrier characteristics two ends, concrete sequence is seen table 3.It is double-stranded to entrust Takara company synthetic DNA sequence and annealing to form.ShRNA-NC and DNA-shRNA-NC are respectively the negative control of shRNA-PLK1 and DNA-shRNA-PLK1.
Use
The BamH IWith
The EcoR IDouble digestion slow virus interference carrier pGLV/H1/GFP+Puro makes its linearizing, and the rubber tapping purifying and recovering is connected with linearizing carrier above-mentioned DNA-shRNA-PLK1 (DNA-shRNA-NC for contrast) fragment with the T4 dna ligase and spends the night in 16 ℃.Obtain correct mono-clonal through transformed clone, and it is correct to send the order-checking of Takara company to identify, sequencing result is seen Fig. 8, called after Supersilencing-DNA-shRNA-PLK1.
The preparation of embodiment 8 recombinant slow virus
1, the packing of virus: above-mentioned recombinant slow virus plasmid Supersilencing-DNA-shRNA-PLK1 (Supersilencing-DNA-shRNA-NC is contrast) and packaging plasmid Helper Vector; And use 2000 working instructions cotransfection 293T cells according to Invitrogen Lipofectamine, be changed to perfect medium behind transfection 8 h.
2, the collection of virus is with concentrated: 48 h collect 293T cell conditioned medium liquid after the transfection.4 ℃, centrifugal 10 min of 4000g collect supernatant, are sub-packed in the tubule-80 ℃ of prolonged preservation after filtering with 0.45 μ m filter.
3, the slow virus titre detects: prepare 5 aseptic Ep pipes, add the serum free medium of 90 μ l in every pipe; Get virus stock solution used to be determined 10 μ l and join in first pipe, behind the mixing, get 10 μ l from first pipe and add second pipe, continue identical operations up to the 5th pipe; Remove the nutrient solution of the 293T cell of cultivation, good 90 μ l virus solution is diluted in adding, changes the perfect medium of 100 μ l behind continuation cultivation 24 h into, observation luciferase expression situation behind 48 h.This experiment slow virus titre is 1 * 10
9TU/ml.
The nude mice of choosing 5-8 week is divided into 4 groups.The TE-8 cell of digestion logarithmic phase is washed cell 2 times with the nutrient solution of serum-free antibiotic-free again, and is made into 1 * 10
7The cell suspension of individual cell/100 μ l.With the TE-8 cell suspension inoculation for preparing in nude mice subcutaneous (inoculum size be about 100 μ l/ only).Conventional raise nude mice, when the volume of subcutaneous transplantation knurl reaches 6 mm * 6 mm, begin to carry out GP TH through hypodermic mode.Blank control group is not done any processing; Each every nude mice injection 2 * 10 of experimental therapy group
6The slow virus that is loaded with siRNA-PLK1 of TU; All the other two control groups are injected respectively and the PBS and the slow virus that be loaded with siRNA-NC of experimental therapy group with dosage.Treatment in per 3 days is once treated 10 times altogether.Treatment finishes nude mice is put to death, and takes out the knurl body, observes the volume of measuring the knurl body, and classified statistics are taken pictures.
The experiment of embodiment 10 nude mice lung metastasis models detects the lung transfer ability of esophageal squamous cell carcinoma cell
The nude mice of choosing 5-8 week is divided into 4 groups.The TE-8 cell of digestion logarithmic phase is washed cell 2 times with serum-free antibiotic-free substratum, and cell is made into 4 * 10
5The concentration of individual/100 uL.Mode through tail vein injection is inoculated in nude mice, and inoculum size is about 4 * 10
5Individual cell/only.2 h after inoculation begin to treat through the mode of tail vein injection slow virus.Each every nude mice injection 2 * 10
6The slow virus of TU, treatment in per 3 days is once treated 6 times altogether.Treat that obviously being short of breath appears in the blank control group nude mice, after the costive phenomenon, unified execution nude mice is taken out its lung, and the counting lung tumors shifts nodular number and takes pictures.
Claims (5)
1. the siRNA sequence signature that effectively suppresses people's esophageal squamous cell carcinoma cell PLK1 expression is: according to people PLK1 gene mRNA sequences Design, above-mentioned people PLK1 gene mRNA sequence Gene Bank accession number is NM-005030.3; The length of positive-sense strand and antisense strand is 22 Nucleotide, wherein 3 ' the tt suspension arranged.And complementary pairing, GC content are 59.1%.
Positive-sense strand: 5'-GGGCGGCUUUGCCAAGUGCUtt-3'
Antisense strand: 5'-AGCACUUGGCAAAGCCGCCCtt-3'
2. the described siRNA sequence to people PLK1 gene of claim 1 can effectively suppress PLK1 expression of gene and the invasion and attack of esophageal squamous cell carcinoma cells in vitro, migration, propagation and apoptosis.According to this effective siRNA sequence, it is following to design people PLK1 gene shRNA sequence:
5’-GGGCGGCUUUGCCAAGUGCUUUCAAGAGAAGCACUUGGCAAAGCCGCCC-3’
3. people PLK1 gene shRNA sequence according to claim 2, synthetic its corresponding double chain DNA fragment; And make up a kind of recombined lentivirus vector to people PLK1 gene RNAi, it is characterized in that: the MCS district of the lentiviral vectors pGLV/H1/GFP+Puro of self inactivation has connected the double chain DNA fragment that is directed against people PLK1 gene shRNA.The sequence of above-mentioned double chain DNA fragment is following:
Positive-sense strand: 5 '-GATCCGGGCGGCTTTGCCAAGTGCTTTCAAGAGAAGCACTTGGCAAAGCCGCCCTT TTTT-3 '
Antisense strand: 5 '-AATTCAAAAAGGGCGGCTTTGCCAAGTGCTTCTCTTGAAAGCACTTGGCAAAGCCG CCC-3 '
4. the described recombined lentivirus vector to people PLK1 gene RNAi of claim 3 obtains the packing recombinant slow virus with packaging plasmid carrier Helper Vector cotransfection 293T cell.
5. the application of the recombinant slow virus described in the claim 4 in the treatment esophageal squamous cell carcinoma shifts.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102404871A CN102719437A (en) | 2012-07-11 | 2012-07-11 | Application of mediated PLK1 RNAi (polo-like kinase-1 ribonucleic acid interference) of lentivirus vector in treatment of esophageal squamous carcinoma metastasis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012102404871A CN102719437A (en) | 2012-07-11 | 2012-07-11 | Application of mediated PLK1 RNAi (polo-like kinase-1 ribonucleic acid interference) of lentivirus vector in treatment of esophageal squamous carcinoma metastasis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102719437A true CN102719437A (en) | 2012-10-10 |
Family
ID=46945306
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012102404871A Pending CN102719437A (en) | 2012-07-11 | 2012-07-11 | Application of mediated PLK1 RNAi (polo-like kinase-1 ribonucleic acid interference) of lentivirus vector in treatment of esophageal squamous carcinoma metastasis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102719437A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1552878A (en) * | 2003-06-05 | 2004-12-08 | 深圳市奥尼克斯基因技术有限公司 | Use and obtain of selective inactivating tumour PLK1 anticancer recombined gland virus constituent |
| CN1651450A (en) * | 2003-11-21 | 2005-08-10 | 杭州新瑞佳生物医药技术开发有限公司 | Small interference RNA molecule (SiRNA) capable of effectively killing and wounding tumour cell pointed at PLK1 mRNA, its mixture and use |
| CN101489383A (en) * | 2006-06-01 | 2009-07-22 | 杜克大学 | Delivery method |
| CN101942481A (en) * | 2009-04-30 | 2011-01-12 | 中南大学 | Construction and application of recombined lentivirus vector aiming at RNA interference of PKC gamma genes |
| CN102102101A (en) * | 2010-03-05 | 2011-06-22 | 重庆医科大学 | SiRNA for inhibiting expression of Plk1 and use thereof |
| US8058069B2 (en) * | 2008-04-15 | 2011-11-15 | Protiva Biotherapeutics, Inc. | Lipid formulations for nucleic acid delivery |
-
2012
- 2012-07-11 CN CN2012102404871A patent/CN102719437A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1552878A (en) * | 2003-06-05 | 2004-12-08 | 深圳市奥尼克斯基因技术有限公司 | Use and obtain of selective inactivating tumour PLK1 anticancer recombined gland virus constituent |
| CN1651450A (en) * | 2003-11-21 | 2005-08-10 | 杭州新瑞佳生物医药技术开发有限公司 | Small interference RNA molecule (SiRNA) capable of effectively killing and wounding tumour cell pointed at PLK1 mRNA, its mixture and use |
| CN101489383A (en) * | 2006-06-01 | 2009-07-22 | 杜克大学 | Delivery method |
| US8058069B2 (en) * | 2008-04-15 | 2011-11-15 | Protiva Biotherapeutics, Inc. | Lipid formulations for nucleic acid delivery |
| CN101942481A (en) * | 2009-04-30 | 2011-01-12 | 中南大学 | Construction and application of recombined lentivirus vector aiming at RNA interference of PKC gamma genes |
| CN102102101A (en) * | 2010-03-05 | 2011-06-22 | 重庆医科大学 | SiRNA for inhibiting expression of Plk1 and use thereof |
Non-Patent Citations (2)
| Title |
|---|
| CHUNLING ZHAO ET AL: "Overexpression of Plk1 promotes malignant progress in human esophageal squamous cell carcinoma", 《J CANCER RES CLIN ONCOL》, vol. 136, 2 July 2009 (2009-07-02), XP019760622 * |
| 杨正梅 等: "siRNA介导的Plk1表达沉默对食管癌细胞生长的影响", 《西南大学学报》, vol. 31, no. 8, 31 August 2009 (2009-08-31), pages 61 - 66 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Xie et al. | LncRNA MALAT1 inhibits apoptosis and promotes invasion by antagonizing miR-125b in bladder cancer cells | |
| Wu et al. | miR‐340 inhibition of breast cancer cell migration and invasion through targeting of oncoprotein c‐Met | |
| Zheng et al. | MicroRNA-148a suppresses tumor cell invasion and metastasis by downregulating ROCK1 in gastric cancer | |
| Hsu et al. | The Epstein-Barr virus-encoded microRNA MiR-BART9 promotes tumor metastasis by targeting E-cadherin in nasopharyngeal carcinoma | |
| Fang et al. | MiR-744 functions as a proto-oncogene in nasopharyngeal carcinoma progression and metastasis via transcriptional control of ARHGAP5 | |
| Yuan et al. | Molecular mechanisms of lncRNA SMARCC2/miR-551b-3p/TMPRSS4 axis in gastric cancer | |
| Feng et al. | Long noncoding RNA LINC00460 promotes carcinogenesis via sponging miR‐613 in papillary thyroid carcinoma | |
| CN108486060A (en) | It is a kind of to be used to treat excretion body of tumour and its preparation method and application | |
| CN107142310B (en) | Screening method of specific shRNA for inhibiting lung cancer cells by targeting Ang-2 gene | |
| Cao et al. | CircRNA circ_POLA2 promotes cervical squamous cell carcinoma progression via regulating miR-326/GNB1 | |
| Xu et al. | MicroRNA‑518b functions as a tumor suppressor in glioblastoma by targeting PDGFRB | |
| Chen et al. | Viral etiology relationship between human papillomavirus and human breast cancer and target of gene therapy | |
| Tang et al. | Suppression of CX3CL1 by miR-497-5p inhibits cell growth and invasion through inactivating the ERK/AKT pathway in NSCLC cells | |
| Zhu et al. | Marek’s disease virus (Gallid alphaherpesvirus 2)-encoded miR-M2-5p simultaneously promotes cell proliferation and suppresses apoptosis through RBM24 and MYOD1-mediated signaling pathways | |
| Xu et al. | Silencing linc00662 inhibits cell proliferation and colony formation of lung cancer cells via regulating the miR-145-5p–PAFAH1B2 axis | |
| CN105586391A (en) | Application of human GTPBP4 gene and related drugs of human GTPBP4 gene | |
| CN102558336B (en) | The albumen and application of PRR11 genes and its coding | |
| CN102533763A (en) | Construction and use of lentivirus-mediated siRNA (small interfering RNA) recombinant 970 against VEGF-C (vascular endothelial growth factor C) gene | |
| CN105200059A (en) | SiRNA for targeted inhibition of mouse UCP2 gene expression and construction of expression vector thereof | |
| CN102719437A (en) | Application of mediated PLK1 RNAi (polo-like kinase-1 ribonucleic acid interference) of lentivirus vector in treatment of esophageal squamous carcinoma metastasis | |
| Wang et al. | Inhibition of KIT RNAi mediated with adenovirus in gastrointestinal stromal tumor xenograft | |
| CN105079822A (en) | Application of FAM3C antisense nucleotide in preparation of drugs for inhibiting epithelial ovarian cancer cell invasion and metastasis | |
| Liu et al. | Inhibiting cell migration and cell invasion by silencing the transcription factor ETS-1 in human bladder cancer | |
| Li et al. | MiR-744 functions as an oncogene through direct binding to c-Fos promoter and facilitates non-small cell lung cancer progression | |
| Farokhimanesh et al. | Metastasis inhibition by cell type specific expression of BRMS1 gene under the regulation of miR200 family response elements |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20121010 |
|
| WD01 | Invention patent application deemed withdrawn after publication |