CN102707054B - Indirect ELISA (enzyme linked immunosorbent assay) detection method for escherichia coli OmpT (Outer-membrane protease T) antibody - Google Patents

Abstract

The invention provides an indirect ELISA (enzyme linked immunosorbent assay) detection method for an escherichia coli OmpT (Outer-membrane protease T) antibody, and a detection antigen on an ELISA plate in the ELISA is OmpT recombinant protein. The detection method comprises the following steps that after being diluted according to the ratio of 1:640, the serum to be detected is incubated with the OmpT recombinant protein on the ELISA plate at the temperature of 37 DEG C for 1.5 h, and the plate is washed three times; rabbit anti-bovine IgG marked by horse radish peroxidase is added to be incubated with the serum to be detected at the temperature of 37 DEG C for 1.5 h; a TMB (tetramethylbenzidine) substrate is added for developing for 10 min; and OD450 is detected after the reaction is ended, the antibody is positive if the OD450 is larger than or equal to 0.335, and the antibody is negative if the OD450 is smaller than 0.335. The recombinant protein prepared from the symbolic gene OmpT of the escherichia coli is used as the detection antigen for ELISA, the recombinant antigen can be produced on a large scale in a standardizing mode, has strong specificity, and is suitable for the antibody detection after the infection of all serotype bacteria of the escherichia coli.

Description

Colon bacillus OmpT antibody indirect ELISA detection method

Technical field

The invention belongs to biotechnology detection field, relate to a kind of colon bacillus OmpT antibody indirect ELISA detection method.

Background technology

It is most important member in 12 Pseudomonas of enterobacteriaceae that colon bacillus (E.coli) belongs to, and is extensively present in nature and can causes the common important infecting both domestic animals and human disease pathogen infecting of humans and animals.According to its mechanism of causing a disease, can be divided three classes: the outer pathological form of pathological form and intestines in symbiotic type, intestines.Past people are more to pathological form E.coli research in intestines, and the outer pathological form E.coli of intestines receives much concern in recent years.But E.coli thalline surface structure is complicated, serotype is of a great variety, the popular E.coli serotype in different regions is also different, and belongs to bacteriums with other 11 of enterobacteriaceaes and have cross reaction, and serodiagnosis and the detection for E.coli, infected bring many difficulties.At present, E.coli Serology test mainly contains enzyme linked immunosorbent assay (ELISA), IFAT (IFAT) and serum agglutination test (SAT) etc.But these Serology tests all exist the weak points such as specificity, and to detect be substantially all for some serotype, uses limited because sensing range is narrow.So, still lack by single antigen all serotype E .coli infected and carry out the sensitivity of serodiagnosis and detection, special, quick, short-cut method.

OmpT is the specific proteins of E.coli, by 297 Amino acid profiles, is present in all E.coli, has high conservative and belongs to specificity.Crystal structure shows, OmpT by 10 β-pleated sheets form, center tangent plane is the ellipse flower basket structure of 13 * 16A °, protein active site is positioned at extracellular.OmpT albumen is bacteremic major protein antigen, and it can produce by inducing specific antibody, also can induce the cellullar immunologic response of body.In view of OmpT albumen has these important functions and good antigenicity, the present invention chooses ompT gene, adopts recombinant technique to carry out Gene cloning and prokaryotic expression to it, and expression product carries out the OmpT recombinant protein that affinity chromatography obtains purifying.Through recombinant expressed OmpT albumen, both retain its good antigenicity, improved again the output of OmpT albumen.This antigen not only has the genus specificity of height, and has high-purity and high stability, extracts suitablely after purifying as antigen coated ELISA Plate, to set up indirect ELISA detection method.At present, there is no the ELISA detection method that a kind of OmpT of use recombinant protein detects colon bacillus.

Summary of the invention

The object of this invention is to provide a kind of colon bacillus OmpT antibody indirect ELISA detection method, solution is at present narrow to the sensing range of colon bacillus, still lacks by single antigen all serotype E .coli are infected and carry out the sensitivity of serodiagnosis and detection, special, quick, short-cut method.

The present invention is achieved through the following technical solutions:

One, a colon bacillus OmpT antibody indirect ELISA detection method, described detectable antigens is OmpT recombinant protein.

OmpT recombinant protein is to be prepared from by the following method:

(1) extract the DNA of colon bacillus;

(2) according to ncbi database, announced sequence A E014075 design primer, pcr amplification goes out ompT gene, and primer sequence is as follows:

ompT-T1：5’-CG ATGCGGGCGAAACTTCT-3’（SEQ?ID?No.1）

ompT-T2：5’-GGC TTAAAAGGTGTACTTAAGACCAGC-3’（SEQ?ID?No.2）

(3) the PCR product of amplification reclaims and purifying;

(4) PCR product is connected with T carrier, connects product and proceeds to competent cell, through enzyme, cuts evaluation, screening positive clone, sequencing;

(5) plasmid and the pET-32a of BamH I, Sal I double digestion positive colony, build pET-32a-ompT expression vector, proceeds to competent cell, picking positive colony after cultivating, and double digestion is identified;

(6) by IPTG abduction delivering OmpT recombinant protein for the nutrient solution of positive colony.

Described pcr amplification condition is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 45s, 60.5 ℃ of annealing 45s, 72 ℃ are extended 90s, carry out 30 circulations, and last 72 ℃ are extended 10min.

Two, a colon bacillus OmpT antibody indirect ELISA detection method, the method comprises the following steps:

(1) serum to be checked is according to after 1:640 dilution, hatches 1.5h with 37 ℃ of OmpT recombinant proteins in ELISA Plate, washes plate three times;

(2) add 37 ℃ of the anti-ox lgG of horseradish peroxidase target rabbit and serum to be checked to hatch 1.5h;

(3) add the tmb substrate 10min that develops the color;

(4) after cessation reaction, detect OD ₄₅₀, OD ₄₅₀value>=0.335 is positive, OD ₄₅₀< 0.335 is negative for value.

The application of the method in detecting colon bacillus.

Concrete grammar is as follows:

The colon bacillus DNA extracting of usining amplifies ompT gene as PCR reaction template, cloned in expression pET-32a plasmid, proceed to again in expressive host bacterium E.coli rosetta (DE3), by the recombinant bacterium that contains positive expression plasmid obtaining, abduction delivering according to a conventional method, expressing protein is purified, quantitatively rear coated elisa plate, sets up the indirect ELISA method that detects colon bacillus OmpT antibody.

1, the structure of colon bacillus OmpT protein expressing plasmid

Extract according to a conventional method colon bacillus DNA and amplify ompT genetic fragment as the masterplate of PCR reaction, through clone, sequence verification, cloned in pET-32a expression plasmid, proceed to again in expressive host E.coli rosetta (DE3), double digestion, PCR identify and order-checking, result all proves the positive pET-32a-ompT plasmid of gained, recombinant bacterium called after colon bacillus pET-ompT bacterial strain.

2, OmpT protein expression, evaluation and purifying, quantitative

By the centrifugal 10min of thalline 12000r/min through abduction delivering, precipitation is resuspended in PBS with 10 times of concentrated ratios, ultrasonication cracking thalline, centrifuging and taking supernatant is in conjunction with NI-NTA post, with imidazoles elution method purification of recombinant proteins, sampling is through four subgroup colon bacillus immune serums and contrast bacterial immunity serum Western blot evaluation and immunogenicity, ubiquity and specificity checking.And determine protein concentration according to Bradford method.

3, the preparation of enzyme reaction plate

Coated: using OmpT recombinant protein as antigen, with coated 96 orifice plates after the dilution of 0.05M pH7.6 Tris hydrochloride buffer, coated concentration 1 μ g/ hole, puts 4 ℃ of 12-14 hour in wet box, and PBST washes plate 3 times, and each 3min, then pats dry; Obtain the coated enzyme reaction plate of antigen OmpT.

Sealing: with filling it up with hole (approximately 200 μ l/ hole) containing 1%BSA, hatch for 37 ℃, sealing 1h, washes plate three times, pats dry sealing; Obtain OmpT coated elisa plate.

Adopt the good effect of technique scheme: the recombinant protein that the present invention is prepared with the significant gene OmpT of colon bacillus is as the detectable antigens of ELISA; compare with colon bacillus antigen in the past; this recombinant antigen can scale, standardized production; and high specificity, is suitable for colon bacillus and belongs to the rear antibody test of all serotype bacteriums infection.

Accompanying drawing explanation

Fig. 1 is the qualification result of recombinant expression plasmid.

1:DNA Marker, 2:PCR evaluation, 3: double digestion is identified.

Fig. 2 is OmpT expression of recombinant proteins figure.

M: albumen Marker, 1: before empty carrier induction, 2: engineering bacteria induction 2 hours, 3: engineering bacteria induction 3 hours, 4: engineering bacteria induction 4 hours, 5: engineering bacteria induction 5 hours, 6: before engineering bacteria induction, 7: empty carrier induction 5 hours, before 8 Host Strains inductions.

Fig. 3 is that four germlines growth groups represent bacterial immunity serum and OmpT recombinant protein Western blotting collection of illustrative plates.

A:OmpT recombinant protein and E.coli C83919 sero-immunity trace, B1:OmpT recombinant protein E.coli 2002-1 sero-immunity trace, B2:OmpT recombinant protein and E.coli J96 sero-immunity trace, D:OmpT recombinant protein and E.coli O157H:7EDL933 serum.

Embodiment

The source of biomaterial explanation in the present invention:

1, bacterial classification

Colon bacillus C83919: purchased from national veterinary microorganism DSMZ;

Colon bacillus 2002-1: the Analysis of Immunogenicity of mastitis for milk cows enterobacteria OmpA and the immune protective effect assessment to mouse infection model, exhale sharp, Fan Ziyao, Tong Chunyu, Chi Jiaqi, Lee is intercalation graceful, Ding Zhaofeng, Chen Longxin, Chen Liang, in write, horse principal column, Song Baifen, Zhu Zhanbo, Cui Yudong, China animal and veterinary animal and veterinary biotechnics branch of association and Ba Ci scientific seminar of Chinese immunology meeting animal doctor immunity branch collection of thesis, 2010, 363-366, and guaranteed in 20 years, to the public, to provide this biomaterial from the application's day by applicant,

Colon bacillus J96: urinary tract enteropathogenic E．Coli clinical strain I type pili FimH genetic test and analysis, Yin Xiaolin, Wang Xiurong, Hu Jie, Feng Huidong, Wei Lin, Hebei Medical University's journal, the 24th the 03rd phase of volume in 2003,136-138 page, this bacterial classification is given to the applicant by teacher Wei Lin of preclinical medicine institute of Hebei Medical University, and is guaranteed in 20 years, to the public, to provide this biomaterial from the application's day by applicant, in addition, this biomaterial is also disclosed in Analysis of Immunogenicity and the immune protective effect assessment to mouse infection model of mastitis for milk cows enterobacteria OmpA, exhale sharp, Fan Ziyao, Tong Chunyu, Chi Jiaqi, Lee is intercalation graceful, Ding Zhaofeng, Chen Longxin, Chen Liang, in write, horse principal column, Song Baifen, Zhu Zhanbo, Cui Yudong, in China animal and veterinary animal and veterinary biotechnics branch of association and Ba Ci scientific seminar of Chinese immunology meeting animal doctor immunity branch collection of thesis, 2010, 363-366, and guaranteed in 20 years, to the public, to provide this biomaterial from the application's day by applicant,

Colon bacillus O157H:7EDL933: separation evaluation and the Preliminary Applications thereof of Escherichia coli O 157 bacteriophage, Du Chongtao, Master's thesis, conferring unit: Jilin University, tutor: Feng Shuzhang, delivers the time: 2008; This bacterial classification is given to the applicant by teacher Du Chongtao of institute of animal husbandry and veterinary medicine of Jilin University, and is guaranteed in 20 years, to the public, to provide this biomaterial from the application's day by applicant;

Shigella flexneri ATCC 12022, Klebsiella Pneumoniae ATCC 35281, proteus vulgaris ATCC 49027, Pseudomonas aeruginosa ATCC27853, staphylococcus aureus ATCC 25923 all identifies institute purchased from Chinese pharmaceutical biological product;

Ox Pasteurella CVCC 44702, Salmonella gallinarum CVCC 520, proteus mirabilis CVCC 1969, Streptococcusagalactiae CAU0306, all purchased from national veterinary microorganism culture presevation administrative center.

2, primer

OmpT gene-specific primer is according to gene order designed, designed, and Bing You Shanghai Sangon Biological Engineering Technology And Service Co., Ltd is synthetic.

3, the anti-ox lgG of horseradish peroxidase target rabbit is purchased from sigma company.

4, as the DH5a of competent cell and E.coli rosetta (DE3) purchased from Bo Meike Bioisystech Co., Ltd.

Below in conjunction with embodiment, the present invention will be further described, but should not be construed as limitation of the present invention:

Embodiment 1

The present embodiment is for illustrating the acquisition of ompT gene and the structure of expression vector, and concrete steps are as follows:

1, according to colon bacillus ompT gene order (GenBank Accession No.AE014075); utilize Oligo6.0 software analysis; designed, designed pair of primers, primer two ends add respectively in restriction enzyme site BamH I and Sal I(square frame) and protectiveness base.Machine BLAST software analysis, has good specificity as calculated.The nucleotides sequence of primer is classified as:

ompT-T1：5’-CG ATGCGGGCGAAACTTCT-3’（SEQ?ID?No.1）

ompT-T2：5’-GGC TTAAAAGGTGTACTTAAGACCAGC-3’（SEQ?ID?No.2）

2, usining the E.coli 2002-1 strain thallus DNA extracting carries out pcr amplification as masterplate, and amplification condition is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 45s, 60.5 ℃ of annealing 45s, 72 ℃ are extended 90s, carry out 30 circulations, and last 72 ℃ are extended 10min.The ompT genetic fragment amplifying adopts PCR product purification kit to reclaim object fragment.

3, the PCR product of amplification after electrophoresis, cuts object band on 1% Ago-Gel under uviol lamp, reclaims kit (Wizard SV Gel and PCR Clean-Up System) reclaim and purify DNA with DNA gel, and concrete steps are carried out with reference to instructions.

4, gained fragment is connected with T carrier, connection product 10 μ L are joined in freshly prepd competent cell, gently revolve and mix.Ice bath 30min; 42 ℃ of heat shock 90s, immediately ice bath 2min.Then join in the liquid LB nutrient culture media of 37 ℃ of preheatings of 1mL 37 ℃ of 100r/min jolting 45min; The centrifugal 2min of 5,000r/min, discards 800 μ L supernatants, and 200 remaining μ L nutrient solutions are coated solid LB dull and stereotyped (containing 100 μ g/mLAmp+), cultivate 12h for 37 ℃.

5, the single bacterium colony in picking reformer plate, the aseptic 3mL of being connected to LB/Amp+(Amp+ final concentration is 100 μ g/mL) in fluid nutrient medium, concussion is cultivated after 12h, adopts kit to extract plasmid in a small amount.

6, get that clone's recombinant plasmid carries out PCR and BamH I, Sal I double digestion is identified.PCR reaction system and condition are the same.Mix rear 37 ℃ of water-bath 2-3h, whole loadings after taking out, 1% agarose gel electrophoresis is identified.

7, pET-32a carrier is extracted to plasmid, with BamH I and Sal I, carry out after double digestion, with DNA, purify/reclaim kit recovery.Plasmid pMD18-T-OmpT is carried out to double digestion by BamH I and Sal I simultaneously, use DNA purifying/recovery kit to reclaim ompT genetic fragment.Object fragment is connected with carrier pET-32a.After 16 ℃ of connections are spent the night, thermal transition, to E.coli rosetta competent cell, is undertaken after screening and identification by Amp resistance, PCR and restriction enzymes double zyme cutting, and (as Fig. 1), object band is 1000bp, and positive colony is checked order.

Embodiment 2

Abduction delivering and the purifying of the present embodiment explanation recombinant protein, concrete steps are as follows:

1, for the correct bacterium colony of sequence, the single colony inoculation of picking is in containing in the liquid LB nutrient culture media of Amp+, 37 ℃ of shaken overnight.Getting overnight culture is inoculated in the liquid LB nutrient culture media containing Amp+ by 2% amount, 37 ℃ of shaken cultivation are to A600 value 0.5 ~ 1.0, add IPTG to final concentration be 1mM, continuation is 37 ℃ of shaken cultivation, and cultivate not in the same time (2, 3, 4, 5, 6h) respectively from culture, taking out 1mL bacterium liquid transfers in centrifuge tube, 10, the centrifugal 5min of 000r/min, collect bacterial sediment, adding 90 μ L 2 * sample-loading buffers and 10 μ L 1mol/L DTT to suspend mixes, boil 5min, 10, after the centrifugal 5min of 000r/min, use immediately, or-20 ℃ of storages, with front 100 ℃ of heating 5min.

2, SDS-PAGE gel electrophoresis: assemble electrophoresis equipment, extract sample comb, every hole adds the sample of 10 μ L, sample adopts the voltage of 8v/cm to carry out electrophoresis in concentrated glue, adopts the voltage of 15V/cm to carry out electrophoresis in separation gel.Until bromophenol blue, during to the about 1cm in separation gel bottom, stop electrophoresis.Take out gel and on shaking table, dye about 30min with coomassie brilliant blue R_250 dyeing liquor, then decolour clear to background, with clear water, rinse, take a picture.SDS-PAGE shows, under the induction of IPTG, transforms and has efficiently expressed fusion protein of the Escherichia coli rosetta (DE3) of recombinant plasmid; Time gradient result shows, the induction amount the highest (as Fig. 2) of 4h-5h.

3, by best induction time, cultivate recombinant bacterium, 10, the centrifugal 5min of 000g, precipitate resuspended rear ultrasonic disruption, 4000r/min is centrifugal 10min again, gets respectively cleer and peaceful precipitation on 10 μ L and carries out SDS-PAGE electrophoresis (8% separation gel, 5% concentrated glue), take and determine whether recombinant protein is solubility expression, and purify with NI-NTA post.

Embodiment 3

Antigenicity and the specificity checking of the present embodiment explanation OmpT albumen.

1, undertaken by " semidry method ": by the protein transduction in the gel after SDS-PAGE to NC film, with whole cell immune serum and protein immunization serum, respectively as primary antibodie, the sheep anti-mouse igg of HRP mark detects the protein of expressing as the two anti-western-blotting that carry out.Result: four E.coli germlines are grown group of mean people mouse immune serum and all occurred an apparent band (Fig. 3) as the western-blotting of primary antibodie, show that the OmpT albumen of expressing has good antigenicity and conservative property, and purity is high.

2, use micro sample adding appliance to 96 hole polystyrene micro reaction plates (ELISA Plate), with every hole 25 μ L, add dilution (except the first hole).The first hole adds 50 μ LOmpT purifying protein immune serums, from the first hole serum, taking out 25 μ L joins in the second hole, with sample injector, in piping and druming mode, mix 5 times, mix and with micro sample adding appliance, draw 25 μ L and add in the 3rd hole afterwards, the same piping and druming mode that adopts mixes, to the 12nd hole, finally in the 12nd hole, take out 25 μ L and discard successively.Every hole adds respectively the somatic antigen 25 μ L:A groups that prepared: E.coli C83919; B1 group: E.coli 2002-1; B2 group: E.coli J96; D group: E.coli O157H:7EDL933, verify that each germline grows the conservative property of group E.coli antigen, tetra-germlines of result E.coli grow group all with OmpT protein immunization serum generation agglutinating reaction; Meanwhile, do aggegation with the non-E.coli control strain of 9 strain and test to verify its specificity, as a result the non-E.coli control strain of 9 strain all not with OmpT protein immunization serum generation agglutinating reaction.

Embodiment 4

The present embodiment is for illustrating the foundation (take ox serum detection as example) of colon bacillus OmpT antibody indirect ELISA detection method:

1, the reagent that ELISA detects

(1) coating buffer: 0.05mol/L Tris-HCl damping fluid, 4 ℃ of preservations.

(2) sample dilution: containing 1% bovine serum albumin(BSA) (BSA) phosphate-tween damping fluid.

(3) confining liquid: containing 1% bovine serum albumin(BSA) (BSA) phosphate-tween damping fluid.

(4) ELIAS secondary antibody: the anti-ox IgG/HRP of rabbit.

(5) substrate buffer solution (phosphate-citrate salts damping fluid (pH5.0)): 0.2mol Na ₂hPO ₄12H ₂o 25.7mL, 0.1mol citric acid 24.3mL, deionized water 50mL.

(6) tmb substrate nitrite ion: 0.01g TMB dry powder is dissolved in 1mL DMSO, gets substrate buffer solution 9.9mL and adds 30 μ L H ₂o ₂, then the TMB100 μ L that adds DMSO to dissolve.

(7) stop buffer (2M H ₂sO ₄): distilled water 178.3mL, pointwise adds the H of dense 2M ₂sO ₄21.7mL.

(8) 0.05%PBST: the Tween-20 that adds 0.5mL in above-mentioned PBS.

2, reaction plate homogeneity is measured

From the ELISA Plate of buying, randomly draw 8, ELISA Plate is coated with 100 μ L/ holes by the ELIAS secondary antibody after 3000 times of dilutions, 4 ℃ of coated spending the night.PBST washes 3 times, and every minor tick 5min, pats dry after washing, with 200 μ L/ holes, adds 5% skimmed milk confining liquid, 37 ℃ of 1h, as stated above washing again.With 100 μ L/ holes, add tmb substrate nitrite ion, 37 ℃ of lucifuge reaction 10min survey its OD450 numerical value in microplate reader, calculate standard deviation and the coefficient of variation between each hole, analyze the uniformity coefficient between different ELISA Plate.Statistical analysis, each hole mean value when OD450 is 1.347, the coefficient of variation is 4.6%, is less than 5%, shows that this kind of enzyme target homogeneity is good, can meet the requirement that ELISA detects test.

3, the selection of best coated damping fluid

OmpT proteantigen is used respectively carbonate buffer solution (pH9.6), PBS(pH 7.2), Tris-HCl(pH 7.6), citrate buffer (1.0M pH6.0), water (pH7.0) be coated with, every kind of coated liquid is done 4 repetitions, 4 ℃ are spent the night, serum dilutes according to optium concentration, by ELISA operation steps, undertaken below, survey its OD450 value and calculate P/N value, with Tris-HCl(pH 7.6) P/N value during as coated damping fluid maximum always all.So, select Tris-HCl(pH 7.6) and as best coated damping fluid.

4, the best coated concentration of OmpT proteantigen and serum optimum diluting multiple determines

Yin and yang attribute serum is respectively 40-1280 and is doubly diluted, and does cross reaction test with the envelope antigen of gradient dilution, and each dilutability is done 4 repetitions.Result is when the reduction of envelope antigen concentration, yin and yang attribute serum-concentration reduce, and OD450 value constantly diminishes.When the dilute concentration of antigen is 1 μ g/ hole, the extension rate of yin and yang attribute serum is 1:640, and now P/N value is the highest.So, determine that best antigen coated concentration is 1 μ g/ hole, the extension rate of serum is 1:640.

5, ELIAS secondary antibody working concentration determines

OmpT albumen harmonizing yinyang serum is done respectively to carry out ELISA operation after best dilution, ELIAS secondary antibody according to instructions make respectively 1:3000,1:6000,1:12000,1:24000 gradient dilution carries out ELISA test, the value while surveying its OD450 is also calculated P/N value.Result is after antigen and serum best effort concentration are determined, P/N value maximum when ELIAS secondary antibody dilute with 1:6000, determines that ELIAS secondary antibody the best dilute concentration is 1:6000.

6, the selection of confining liquid

OmpT proteantigen, an antiserum and ELIAS secondary antibody are diluted according to fixed optium concentration respectively.With 5% skimmed milk power, 1% gelatin, 1% bovine serum albumin(BSA) and 10% hyclone, do confining liquid respectively, carry out indirect ELISA test.Numerical value calculate P/N value while surveying OD450.1%BSA-PBST confining liquid best results for result OmpT-ELISA.

7, off-period determines

Adopt fixed best confining liquid at 37 ℃ of sealings 30min, 1h, 1.5h, 2h, other reaction conditions, by above definite carrying out, is measured its numerical value and is P/N and calculates when OD450, determines best off-period.ELISA37 ℃ of sealing 1h effect of result OmpT – is best.

8, the selection of serum dilution

P/N value when relatively 5% skimmed milk power, 1%BSA, PBS, Tris hydrochloride damping fluid are as serum dilution, determines best serum dilution.Result 1%BSA is better than Tris-HCl and PBS as the successful of serum dilution.

9, antigen and seroreaction time determines

Antigen-antibody reaction meeting is along with the increase of time, reacting dose also increases, but reach after the regular hour, reaction reaches balance, OmpT proteantigen is by above-mentioned definite optimum reaction condition, negative and positive serum is respectively done 8 repetitions, and 37 ℃ act on respectively 0.5h, 1h, 1.5h, the checking in tetra-reaction time of 2h.Numerical value while surveying its OD450, determines the reaction time that P/N value is maximum.Result OmpT proteantigen at 37 ℃ during with seroreaction 1.5h P/N value maximum, negative mean value is also less.

10, the action time of ELIAS secondary antibody determines

OmpT proteantigen is by best coated concentration coated elisa plate, 4 ℃ are spent the night, standard positive, negative serum are diluted with optimum diluting multiple, ELIAS secondary antibody is done 1:6000 dilution, establish 0.5h, 1h, 1.5h, tetra-reaction groups of 2h the action time of ELIAS secondary antibody, every group of negative and positive control is done 8 repetitions, according to ELISA running program, carries out, survey it at OD450 numerical value, relatively P/N value is determined the reaction time.During result OmpT ELIAS secondary antibody effect 1.5h, P/N value is maximum, and positive value is all greater than 1.0, and feminine gender value is all less than 0.2, so is defined as 1.5h the action time of OmpT-ELISA ELIAS secondary antibody.

11, substrate displaying time determines

According to fixed ELISA response procedures, be coated with successively, seal, add yin and yang attribute serum, respectively do 8 repetitions, add tmb substrate colour developing again with after ELIAS secondary antibody reaction 1.5h, 37 ℃ of incubation reaction are established 5min, 10min, 15min, tetra-developing times of 20min, numerical value while being determined at OD450.Choose positive mean value and approach 1.0, negative OD mean value is smaller, and maximum one group of P/N value is as best substrate developing time.Result, 37 ℃ of conditions, can reach more than 1.0 with the positive OD450 value of substrate-function 10min, and negative OD450 value is below 0.2, and P/N value is maximum, and substrate developing time is defined as 10min.

12, the positive critical value of indirect ELISA method determines

With OmpT proteantigen coated elisa plate, according to the indirect ELISA detection method of having set up above, detect 170 parts of serum agglutination tests and be judged to be negative cow's serum.Every part of serum is done three repetitions, records OD450 value calculating mean value (x) and the standard deviation (S) of sample.When sample OD450 value >=x+3S, judge the positive serum of this serum; On the contrary, be judged to be negative serum.The decision content of result indirect ELISA method negative and positive serum is 0.335.Be that blood serum sample OD450 value >=0.335 just can be judged as the positive, < 0.335 is negative.

13, specificity and sensitivity tests

With built vertical indirect ELISA method, to 170 parts of E.coli aggegations experiment, negative and 170 parts of whole-bacterial-vaccine immune agglutinations are tested after positive cow's serum dilutes 640 times and are detected.The recall rate of negative serum embodies the specificity of the indirect ELISA method of setting up, and the recall rate of positive serum embodies the susceptibility of the indirect ELISA method of setting up.It is indirect ELISA method specificity=(ELISA negative serum quantity)/(full bacterium aggegation experiment negative serum quantity) * 100%; ELISA method susceptibility=(ELISA positive serum quantity)/(whole-bacterial-vaccine immunity positive serum quantity) * 100%.The specificity of result indirect ELISA method is 96.5%, and susceptibility is 100%.

14, detection sensitivity test

By positive doubling dilution parallel with negative serum, by the indirect ELISA method of setting up, detect the content of Serum Antibody, the sensitivity using the maximum serum dilution of P/N >=2.1 as ELISA detection method.Result is by detection after the doubling dilution of serum is found, when serum dilution reaches 1:6400, P/N value is still greater than 2.1, illustrates that set up indirect ELISA method has very high sensitivity.

15, replica test

(1) criticize interior replica test

With the OmpT recombinant protein coated elisa plate with a purifying, get 8 parts of different serum, by the indirect ELISA trace routine of having established, to measure together, every duplicate samples is done 6 parallel holes, and result is carried out statistical analysis.Result detects the coefficient of variation (CV) of sample between 2%-9%, is all less than 10%.The method has good repeatability.

(2) criticize between replica test

By coated 4 ELISA Plate of the OmpT recombinant protein antigen with a purifying, get 8 parts of different samples to be tested, 4 times, according to the indirect ELISA trace routine of having established, measure sample, every part of serum sample is established 6 parallel holes, and result is carried out statistical analysis; The OmpT recombinant protein antigen coated elisa plate of purifying with 4 different batches, gets 8 parts of different serum samples and detects under similarity condition, and every part of serum sample is established 6 parallel holes, and result is carried out statistical analysis.Result detects the coefficient of variation (CV) of sample between 2%-9%, is all less than 10%.The method has good repeatability.

Embodiment 5

The present embodiment is for illustrating preparation and the testing process of colon bacillus OmpT antibody indirect ELISA check-out console, and concrete steps are as follows:

(1) by 0.05M Tris-HCl(pH 7.6 for purification of Recombinant OmpT albumen) damping fluid dilutes after 10 μ g/mL, draws the sample having diluted and add in hand-hole, 100 μ L/ holes with micro sample adding appliance, 4 ℃ of refrigerator 12 ~ 14h, PBST washes plate 3 times, and each 3min, then pats dry; Washing: take out elisa plate after refrigerator overnight, dry content, add washing lotion PBST, 200 μ L/ holes, shake 5min, dry, and wash 3 times, last drying patted totally;

(2) add 1%BSA-PBST, 100 μ L/ holes, 37 ℃ of 1h, wash 3 sealings afterwards of plate.

(3) serum dilution to be checked: add the serum to be checked of 1:640 dilution to the enzyme reaction plate being coated with, 100 μ L/ holes, hatch for 37 ℃, and 1.5h washes plate three times;

(4) enzyme-added mark thing: the SPA of the special IgG antibody of detected species or employing enzyme labeling, 100 μ L/ holes, 37 ℃ of 1.5h, wash plate three times;

(5) colour developing: the tmb substrate solution configuring 100 μ L/ holes are added to 37 ℃ of lucifuge 10min;

(6) cessation reaction: the H that adds stop buffer 2mol/L ₂sO ₄50 μ L/ holes, 5min under room temperature;

(7) determine serum yin and yang attribute critical value, according to the indirect ELISA detection method of having set up, detect negative serum above.Every part of serum is done three repetitions, records OD450 value calculating mean value (x) and the standard deviation (S) of sample.When sample OD450 value >=x+3S, judge the positive serum of this serum; On the contrary, be judged to be negative serum.

(8) result judgement: utilize microplate reader, blank well zeroing, reads 450nm wavelength place absorbance, i.e. OD450 value.Be greater than the positive of critical value, be less than the negative of critical value.

Test example 1

This test example is for verifying the accuracy of colon bacillus OmpT antibody indirect ELISA check-out console of the present invention, and concrete steps are as follows:

Get 10 parts of positive serums that infected colon bacillus, and by the metainfective antibody serum of 9 strain contrast bacterium (shigella flexneri ATCC12022, Klebsiella Pneumoniae ATCC 35281, proteus vulgaris ATCC 49027, Pseudomonas aeruginosa ATCC27853, ox Pasteurella CVCC 44702, Salmonella gallinarum CVCC 520, proteus mirabilis CVCC 1969, Streptococcusagalactiae CAU0306, staphylococcus aureus ATCC 25923), apply ELISA check-out console of the present invention and detect, decision method is with embodiment 5.Found that, ELISA check-out console accuracy rate of the present invention can reach 100%, can be used as a kind of simple effective method that detects colon bacillus.

Claims (4)

1. colon bacillus OmpT antibody indirect ELISA detection method application in antibody test belong to all serotype bacteriums infection with the non-colon bacillus that is diagnosed as object after, the detectable antigens in described ELISA detection method in ELISA Plate is OmpT recombinant protein.

2. application according to claim 1, is characterized in that: described OmpT recombinant protein is to be prepared from by the following method:

(1) extract the DNA of colon bacillus;

(2) according to ncbi database, announced sequence A E014075 design primer, pcr amplification goes out ompTgene, primer sequence is as follows:

ompT-T1：5’-?CGGGATCCATGCGGGCGAAACTTCT?-3’（SEQ?ID?No.1）

ompT-T2：5’-GGCGTCGACTTAAAAGGTGTACTTAAGACCAGC?-3’（SEQ?ID?No.2）

(3) the PCR product of amplification reclaims and purifying;

(4) PCR product is connected with T carrier, connects product and proceeds to competent cell, through enzyme, cuts evaluation, screening positive clone, sequencing;

(5) plasmid and the pET-32a of BamH I, Sal I double digestion positive colony, build pET-32a- ompTexpression vector, proceeds to competent cell, picking positive colony after cultivating, and double digestion is identified;

(6) by IPTG abduction delivering OmpT recombinant protein for the nutrient solution of positive colony.

3. application according to claim 2, is characterized in that: described pcr amplification condition is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 45s, 60.5 ℃ of annealing 45s, 72 ℃ are extended 90s, carry out 30 circulations, and last 72 ℃ are extended l0min.

4. application according to claim 1, is characterized in that: the method comprises the following steps:

(1) serum to be checked is according to after 1:640 dilution, hatches 1.5 h with 37 ℃ of OmpT recombinant proteins in ELISA Plate, washes plate three times;

(2) add 37 ℃ of the anti-ox lgG of horseradish peroxidase target rabbit and serum to be checked to hatch 1.5 h;

(3) add the tmb substrate 10min that develops the color;

(4) after cessation reaction, detect OD ₄₅₀.