CN102703580A - Method for detecting DNA (deoxyribonucleic acid) methyltransferase gene - Google Patents

Abstract

The invention belongs to the field of biotechnology and relates to a combined method for detecting DNA (deoxyribonucleic acid) methyltransferase gene. Members of a DNA methyltransferase family have different activities and specificities for different tissues in different developmental phases and co-act to directly affect methylation status of DNA. The DNA methyltransferase refers to DMT (DNA methyltransferase) 701, DMT702, DMT703, DMT704, DMT705, DMT706, DMT707, DMT708, DMT709 and DMT710. By the aid of a series of PCR (polymerase chain reaction) primers and using mRNA (messenger ribonucleic acid) reverse transcription products cDNA (complentary DNA) as a template, total expression level of the DNA methyltransferase family in different tissues and different developmental phases of plant can be detected simultaneously through conserved regions or variable regions specifically combined to the template, and expression levels of single family members can be distinguished.

Description

A kind of method that detects the dnmt rna gene

Technical field

The invention belongs to biological technical field, relate to a kind of detection technique and application thereof, be used for detecting plant and have which dnmt rna family gene member, and they are at the expression of different tissues, etap.

Background technology

The various vital movements of organism all receive the regulation and control of heredity and epigenetic.Heredity is meant the transmission via gene, makes the offspring obtain the characteristic of parental generation; Epigenetic refers to that dna sequence dna does not change, but heritable change (Russo, V.E.A. have taken place in genetic expression; Martienssen, R.A., Riggs; A.D.; 1996Epigenetic mechanisms of gene regulation.Cold Spring Harbor Laboratory Press, Plainview, NY.).These are regulated and control in various levels, do mutually through different approach and network; Make organism keep normal physiological status: like genome stability, chromosomal integrity, the acetylize of chromatin histone, methylate, ubiquitinization etc.; Methylating of genomic dna; Expression of gene and silence, (Henikoff S, Matzke MA.Trends Genet.1997Aug such as the activation of transposon and inactivation; 13 (8): 293-5.Exploring and explaining epigenetic effects).

Gene expression regulation is a kind of important epigenetic regulation and control, and it affects important physiological processes such as organism growing development, tissue differentiation.It in many levels, regulated and control by multiple factor: like the state of gene designation of chromosome section, when gene is in the euchromatin zone, then it has transcriptional activity; Be in the heterochromatic zone like fruit gene, hindered combining of transcription factor and gene promoter area, cause the gene to be in silence state because the chromatin height around its is condensing.The modification position and the kind of gene region nucleosome histone also play significant effects to expression of gene, and acetylation of histone is the sign of genetic transcription; The amino-acid residue of different positions and degree methylates; Then having different effects, is the sign of genetic expression like the trimethylammoniumization of H3K4, and for H3K9 and H3K27; Monomethylation is the active sign of gene, and dimethyl-ization all is the sign of gene silencing with trimethylammoniumization.For some gene promoter area, if cytosine(Cyt) majority is wherein methylated, then gene is in silence state, has only after these regional cytosine methylations are removed, and these genes can be transcribed.

Cytosine(Cyt) 5 '-methylate extensively is present among the most biological gene group DNA, from the low unicellular organism of waiting such as fission yeast, multicellular animals nematode such as low, to high each kind of plant, animal, all extensively exists; Although in a few biology, do not find tangible cytosine methylation, like yeast saccharomyces cerevisiae, fruit bat etc.; By inference; These several kinds biological cytosine methylation systems are accidental losing or inactivation in evolution, still, still exists methylating of histone in them.

The cytosine methylation state directly receives a series of methyltransgerases, glycosylase and fissional acting in conjunction.Wherein class of enzymes is a methyltransgerase, and they can be added to unmethylated cytosine(Cyt) 5 ' position with methyl, produces 5 '-methylcystein; Can be divided into from the beginning methylase and maintenance methylase in this fermentoid again; The former can be 5 '-methylcystein with unmethylated cytosine methylation; The latter need be template with the mCpG on the dna single chain, and unmethylated CpG methyl on another chain of correspondence is turned to mCpG.Another kind of is glycosylase, and they can the methylated cytosine(Cyt) of specific recognition, and with it from the DNA excision, produce double-stranded breach, and under the acting in conjunction of other enzyme, unmethylated cytosine(Cyt) is connected goes up breaks, thereby accomplish initiatively demethylation process.Demethylation also can be owing at mitotic division or postmeiotic, and hemimethylated double-stranded DNA is produced exhaustive methylation by the effect of maintenance methylase, thereby passive generation methylation level reduces.

Through research, a series of methyltransgerases have been found, like from the beginning methylase DNMT3, maintenance methylase DNMT1 to human cytosine methylation.In some model animalss such as Arabidopis thaliana, identified and had the initiatively active two kinds of glycosylases of demethylation---DMMETER and ROS1.Systematic study is kept in other biological methylating, also found some involved enzyme that methylate, like maintenance methyltransgerase met1, methyltransgerase DRM etc. from the beginning.

Pass through multiple means; Can detect epigenetic Expression of Related Genes level, like common RT-PCR, qRT-PCR; High-throughout biochip technology and new-generation sequencing technology; The associative list type analysis, thus a collection of epigenetic two mutants that phenotype is arranged, the regulatory mechanism of further illustrating another level of vital movement found.

Summary of the invention

The purpose of this invention is to provide a kind of built-up type and detect the method that the Methyl transporters enzyme family is expressed in the plant; Can detect all family members' existence and expression level thereof quickly and easily; Be convenient to detect the tissue/spatial and temporal expression specificity of these genes, screening epigenetic two mutants.

The present invention relates to paddy DNA Methyl transporters enzyme family, the known member of this family has 10, and ChromDb database login title is respectively DMT701---DMT710, they respectively to the foundation of cytosine methylation, keep, sequence specific identification has effect.

The present invention uses 12 pairs of primers; Wherein ten pairs of primer specific ground combine the some special members in the Methyl transporters enzyme family; And not can with rice genome/transcribe in the group other any sequence make a mistake and combine, they are used to detect the expression level of every kind of methyltransgerase; Two pairs of degenerated primers; DMT_A identification DMT701, DMT702, DMT703, DMT704, DMT707; DMT_B identification DMT706, DMT708, DMT709, DMT710, they use with the DMT705 primer, can detect all members' of dnmt rna family overall expression level.

12 pairs of primers that the present invention uses; Be that genome sequence and cDNA sequence with ten members of paddy DNA Methyl transporters enzyme family is template; Design overall detection of expression primer from the conserved sequence that a plurality of members have respectively; Whether the single member of design detection exists the primer that reaches the expression degree from the distinctive sequence of single member; And place it in the both sides of certain intron in the genomic dna during primer in design, and whether there is genomic dna to pollute so that detect simultaneously in the reverse transcription product of total RNA, the expression level of avoiding possibly causing thus detects error.

Primer design method of the present invention mainly adopts general primer-design software Primer premier 5 to accomplish, and is auxiliary with artificial interpretation simultaneously.Length 17～the 25bp of all primers, GC content 40～60%, 57～62 ℃ of annealing temperatures.Amplification is PCR product size 200～400bp during cDNA, amplifying genom DNA the or when cDNA that genomic dna pollutes is arranged, PCR product size 300～500bp.

The primer that is used to detect the overall expression level of dnmt rna is right, is the DMT_A that detects DMT701, DMT702, DMT703, DMT704, DMT707 expression level, and the DMT_B that detects DMT706, DMT708, DMT709, DMT710 expression level:

DMT_A：

OsDMT_AF：WRTGGTGGSCCTCCRTGTCARGGY

OsDMT_AR：YCCWARYGKDRCYTGRTAHYBCAT

Big or small 249bp (template is DMT702 and DMT707) of being of product when increasing cDNA or 243bp (template is DMT701, DMT703, DMT704).

DMT_B：

OsDMT_BF：MTSTWYWSTGGWATTGGAGGTGCA

OsDMT_BR：RATMRYYAKGTCAAARCCRCCAAA

Product size during amplification cDNA is 231bp (template is DMT706, DMT708 and DMT709) or 234bp (template is DMT710).

The primer of DMT701 is placed on the first and the 3rd exon, first and second intron of interval 131bp and 97bp, and second exon of 26bp;

OsDMT701-F：GGAGGACTCAGATGACCACTT

OsDMT701-R：GGTAGTGACATCGAGCCTTC

PCR product 152bp during intronless, product 406bp during amplifying genom DNA.

The primer of DMT702 is placed on the 4th and the 5th exon, the 4th intron of interval 111bp;

OsDMT702-F：CCTGTGGTGATGATAGAGGGAA

OsDMT702-R：CAAGTCTAACATTGGGCGGTA

PCR product 157bp during intronless, product 268bp during amplifying genom DNA.

The DMT703 primer is placed on the 4th and the 5th exon, the 4th intron of interval 183bp;

OsDMT703-F：GGCAGGTTGCTAGAGTTCTTC

OsDMT703-R：TCCTCGGGTCATGTGATTG

PCR product 118bp during intronless, product 301bp during amplifying genom DNA.

The DMT704 primer is placed on third and fourth exon, the 3rd intron of interval 111bp;

OsDMT704-F：GGGACTGACCACTGCCACT

OsDMT704-R：CACGCTTGAGATCATGCTTTT

PCR product 115bp during intronless, product 226bp during amplifying genom DNA.

The DMT705 primer is placed on first and second exons, first intron of interval 104bp;

OsDMT705-F：GAAAGTCCTCGAGTTCTATAGCG

OsDMT705-R：GTTGGCAACGTCGTTGATG

PCR product 109bp during intronless, product 213bp during amplifying genom DNA

The DMT706 primer is placed on first and second exons, first intron of interval 117bp;

OsDMT706-F：ACAATGATAAGTTCGAGTGGGA

OsDMT706-R：CAGCAACCAAAGCACCTGA

PCR product 147bp during intronless, product 264bp during amplifying genom DNA.

The DMT707 primer is placed on first and second exons, first intron of interval 122bp;

OsDMT707-F：CATCAAGTAGTTCTAACCACCAGG

OsDMT707-R：TGTTTTCAAGACAGGCTCACA

PCR product 182bp during intronless, product 304bp during amplifying genom DNA.

The DMT708 primer is placed on the 7th and the 8th exon, the 7th intron of interval 36bp;

OsDMT708-F：AGGAAGTGGAACCTTGTCTGG

OsDMT708-R：CCTGCTAACTCCCCTGGTATG

PCR product 111bp during intronless, product 147bp during amplifying genom DNA

The DMT709 primer is placed on the 7th and the 8th exon, the 7th intron of interval 407bp;

OsDMT709-F：CTTGGAAGAATGTAGGAAGTGGA

OsDMT709-R：GCCATTAGGGAATATGTCCCTC

PCR product 199bp during intronless, product 606bp during amplifying genom DNA.

The DMT710 primer is placed on the second and the 3rd exon, second intron of interval 136bp;

OsDMT710-F：CTCCAGTCATGTAAGATCACAATTT

OsDMT710-R：CAAAAGAGCCTCCAGTATAGTATCT

PCR product 115bp during intronless, product 251bp during amplifying genom DNA.

Above-mentioned ten pairs of special primers among the present invention are during design and stride the intron design, can be used for detecting whether the genomic dna residual contamination is arranged among the mRNA, in order to avoid because of pollution effect detected result accuracy.

When with above-mentioned ten pairs of primer amplification genomic dnas, can be used for detecting in the different gene type, whether there is a certain methyltransgerase to exist; And can learn the methyltransgerase sequence variations information in the different genotype through with the order-checking of PCR product.

When with above-mentioned ten couples of primer amplification cDNA, can be used for detecting the overall expression level of Methyl transporters enzyme family and each family member's expression level.

Implementation step of the present invention is mainly: get plant tissue; Cryogrinding becomes fine powder; Extract genomic dna (like modified CTAB method) and total RNA (like the Trizol method) respectively with diverse ways, carry out purifying respectively, obtain the genomic dna and total RNA sample that can be used for detecting extracting product.For genome DNA sample, be template with them, carry out pcr amplification with ten pairs of primers that detect the methyltransgerase family member respectively, detect in employed rice varieties/genotype, whether this methyltransgerase family member's existence is arranged.For total RNA sample; Carrying out reverse transcription reaction, obtain cDNA, is pcr template then with cDNA; Be used in the methyltransgerase primer amplification that exists in this rice varieties/genotype; If PCR product electrophoresis result is shown as the band about a 100bp, and it is big or small than the little about 100bp of product with the genomic dna amplification, and then explaining does not have genomic dna to pollute among total RNA; If two bands are arranged; And than the molecular weight of big band with use genomic dna in full accord as the stripe size that template amplification obtains; Then explaining in total RNA sample has genomic dna to pollute; Need can make template of so total RNA and carry out reverse transcription-PCR of DNaseI except that after depolluting, detect gene expression dose.Confirm not receive total RNA that genomic dna pollutes through above detection; Can be used as template and carry out reverse transcription; Its product cDNA is used for pcr template; Use real time fluorescent quantitative TRAP (real-time qRT-PCR), carry out pcr amplification, each member's of detection by quantitative expression level with the primer that detects different methyltransgerase members.

The invention provides a kind of method, can be used for identifying quickly and accurately in the paddy rice different genotype, whether some methyltransgerase family member's disappearance takes place, and whether sequence variations has taken place; Can also be used for detecting the expression level of different tissues, different developmental phases methyltransgerase, compare, advantages such as having of this method is quick, simple, cost with methods such as gene chip, new-generation sequencing.

Description of drawings

Fig. 1 is the embodiment overview flow chart;

Fig. 2 is the signal of PCR detected result, and pcr template is respectively: the first swimming lane genomic dna, second swimming lane do not have the RNA reverse transcription product that genome pollutes, the RNA reverse transcription product that the 3rd swimming lane has genomic dna to pollute.

Embodiment

Pulverize sample: get the required kind of 50-200mg/genotypic rice tissue, after weighing roughly, put into the 2ml centrifuge tube; Put into the stainless shot of 2 5mm diameters then, the tight pipe of lid covers, and centrifuge tube is put into the hole of the special-purpose centrifuge tube shelf of TissueLyser sample grinding machine; Centrifuge tube shelf is put into empty ice chest, in ice chest, pour into a small amount of liquid nitrogen then, centrifuge tube was preserved in ice chest 5 minutes; In ice chest, add a small amount of liquid nitrogen therebetween and replenish the evaporable part, thoroughly freeze until sample.Centrifuge tube shelf is taken out from ice chest, in the sample grinding machine of packing into rapidly, pulverize plant tissue 15 seconds * 2 times with the medium tenacity vibration.Centrifuge tube shelf is taken out from sample grinding machine, and whether the sample in the inspection centrifuge tube is thoroughly pulverized, if do not pulverize fully, then repeats above-mentioned grind away operation, pulverizes fully until sample.

Extract genomic dna: adopt modified CTAB method, from rice tissue, extract genomic dna.Be put in the centrifuge tube shelf on ice just pulverizing or pulverize the frozen sample centrifuge tube in back in-20 ℃; The improvement CTAB DNA extraction liquid that adds the above 65 ℃ of preheatings of 5X volume; And the tight pipe of lid covers, puts upside down centrifuge tube for several times rapidly, so that tissue sample melts in extracting solution.(improvement CTAB DNA extraction buffer formulation A liquid: 0.35mol/L Sorbitol; 0.1mol/L Tris-HCl pH 7.5,0.5mmol/L EDTA, B liquid: 0.2mol/L Tris-HCl pH7.5; 0.05mol/L EDTA pH 8.0; 2mol/L NaCl, 2%CTAB, C liquid: 5%N-lauroylsarcosine.A, B, C liquid mixed by 1: 1: 0.4, and the PVP that adds DNA extraction damping fluid TV 1% before the mixing is in B liquid.) sample placed on 65 ℃ the water bath with thermostatic control shaking table, in 40-50rpm jolting 30min.Take out then, be cooled to room temperature and add isopyknic chloroform then: primary isoamyl alcohol (24: 1), turned upside down 5 minutes, afterwards in the centrifugal 10-15 of 4000rpm minute gently.Draw the upper strata water; The Virahol that adds 2/3 volume precooling turned upside down 10 minutes and puts 10min in 4 ℃ of refrigerators, and-20 ℃ in the centrifugal 10min of 3000rpm; Outwell liquid; DNA is resuspended in 30 minutes and often concussion in 70% ethanol, discards ethanol then, the DNA after air-dry is added 100 μ l TE it is dissolved fully.Add 1 μ l and do not contain the RNA enzyme of DNA enzyme, 37 ℃ of temperature are bathed 30min to remove the RNA among the DNA, add 95% cold ethanol of 3 * volume then; Mixing be placed on-20 ℃ 30 minutes; Centrifugal 5 minutes of 12000rpm, supernatant discarded adds rinsing in 1ml 70% ethanol; Air-dry then DNA 30 minutes is dissolved among the 100 μ l TE.Treat can carry out 1% agarose gel electrophoresis after DNA dissolves fully, the quality of inspection DNA and the known DNA Marker of certificate estimate its concentration.It is ℃ subsequent use that DNA is put what-20.

Extract total RNA: adopt the Trizol method, from rice tissue, extract total RNA.All consumptive materials that below use all pass through the DEPC water treatment.Be put in the centrifuge tube shelf just pulverizing or pulverize the frozen sample centrifuge tube in back in-70 ℃; Add the Trizol reagent of 20 times of volumes, put upside down centrifuge tube rapidly, sample is melted in Trizol; Then sample was placed 10 minutes in room temperature; Every at a distance from 1-2 minute, put upside down the mixing sample for several times, sample is fully extracted.Centrifuge tube is placed compact centrifuge, and centrifugal 5 minutes of 13000rpm draws supernatant and transfers in the new 2ml centrifuge tube; Add isopyknic chloroform: primary isoamyl alcohol (24: 1); Behind the vortex mixing 15 seconds, room temperature left standstill 1 minute, and 13000rpm is centrifugal 5 minutes then; The careful supernatant of drawing changes in the new centrifuge tube, and middle level and lower floor's liquid are abandoned.In supernatant, adding 1 μ l does not have the active DNaseI of RNase, and room temperature is placed the genomic dna that degraded in 15 minutes possibly polluted, and adds 95% ethanol of 3 times of volume-20 ℃ precoolings then;-20 ℃ the deposition 30 minutes, then 13000rpm 4 ℃ centrifugal 15 minutes, supernatant discarded; The deposition with 0.5ml 70% ethanol rinsing 2 minutes, 13000rpm 4 ℃ centrifugal 5 minutes, supernatant discarded; To be deposited in air drying 10 minutes, add 50 μ l DEPC water, 65 ℃ of water-bath hydrotropies 10 minutes.It is ℃ subsequent use that RNA is put what-70.

DNA, RNA quality inspection.Use ultraviolet spectrophotometer, agarose gel electrophoresis method for detecting, detect concentration, purity and the integrity of genomic dna and total RNA.Get each 1 μ l of every kind of genomic dna and total RNA sample, use the nanodrop ultraviolet spectrophotometer, measure their absorbance at 230nm, 260nm and 280nm place respectively, each sample should be between 1.6～2.1 at the absorbance ratio at 260nm and 280nm place; The absorbance of each genome DNA sample at the 260nm place multiply by 50ng/ μ l, promptly gets the concentration of sample DNA; The 260nm place absorbance of each RNA sample multiply by 40ng/ μ l, promptly gets the concentration of total RNA.Every kind of genomic dna got 5 μ l with total RNA sample, and electrophoresis is 30 minutes on 1% sepharose, is marker with λ DNA and 100bp DNA ladder, and complete oryza sativa genomic dna size should be close with λ dna molecular amount size; High-quality total RNA should have the 2-5 band about 500bp, respectively corresponding different molecular weight size rRNA, and wherein the maximum band brightness of molecular weight is about two times of that band brightness below it.According to the luminance difference multiple of maker band and sample strip,, can estimate the concentration of genomic dna and total RNA in conjunction with the applied sample amount of marker.

The detection of dnmt rna in the different water rice varieties genome.Known paddy DNA Methyl transporters enzyme family has 10 members, but in different kinds, some member possibly thereby lose owing to the former of evolution, sudden change or artificial selection, is necessary before the expression level that detects them, confirms earlier whether they exist.Get 10 0.2ml PCR pipes, in every pipe, add following sample/reagent respectively: 1 μ l genome DNA sample, dNTP mixture (every kind of 2.5mM) 2.5 μ l, 10X PCR damping fluid (contains 15mM MgCl ₂, down with) 2.5 μ l, Taq archaeal dna polymerase 0.2 μ l adds each 2.5 μ l of special upstream and downstream primer (2.5 μ M) of certain methyltransgerase respectively in each pipe, replenish nuclease free water to final volume 25 μ l.PCR pipe is put into the PCR appearance, moves following program: 94 ℃ 5 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 30 seconds, totally 35 circulations, 72 ℃ the insulation 10 minutes.Respectively getting 5 μ l PCR products, add 1 μ l 6X electrophoresis sample-loading buffer, is marker with 100bp DNA ladder; In 1.5% sepharose; With 5V/cm voltage electrophoresis 30 minutes, on ultraviolet gel imaging appearance, observe electrophoresis result then, the PCR sample of the above amplified band of single 300bp is arranged; Explaining has this dnmt rna member in this rice genome, otherwise explains that this dnmt rna member loses in this genotype.

With total RNA is that template, OligodT are primer, carries out reverse transcription, obtains cDNA.Get the total RNA of 1 μ g (according to different sample concentrations, about 2～10 μ l) and place 0.2ml PCR pipe, add OligodT reverse transcription primer and the mixing of 1 μ l, 0.5 μ g/ μ l; 70 ℃ of water-baths 10 minutes are taken out PCR rapidly and to be placed 2 minutes on ice, and are of short duration then centrifugal; Add following reagent: 10 * reverse transcription damping fluid, 2 μ l, dNTP mixture (every kind of 10mM) 2 μ l, RNA enzyme inhibitors 0.5 μ l; M-MuLV ThermoScript II 1 μ l; DEPC water adds to final volume 20 μ l, 37 ℃ of incubations 1 hour, and the EDTA, 70 ℃ that add 1 μ l 50mM handle 10 minutes termination reactions.In system, add 30 μ l DEPC water.

Whether regular-PCR detects has genomic dna to pollute among total RNA.Get the RT-PCR product of 1 μ l dilution; Add dNTP mixture (every kind of 2.5mM) 2.5 μ l; 10 * PCR damping fluid, 2.5 μ l; Taq archaeal dna polymerase 0.2 μ l, each 2.5 μ l of the special upstream and downstream primer of methyltransgerase (2.5 μ M) that any has been existed in this genome by genomic dna PCR affirmation replenish nuclease free water to final volume 25 μ l.PCR pipe is put into the PCR appearance, moves following program: 94 ℃ 5 minutes; 94 ℃ 30 seconds, 58 ℃ 30 seconds, 72 ℃ 45 seconds, totally 35 circulations, 72 ℃ the insulation 10 minutes.Respectively getting 5 μ l PCR products, add 1 μ l 6X electrophoresis sample-loading buffer, is marker with 100bp DNA ladder; In 1.5% sepharose,, on ultraviolet gel imaging appearance, observe electrophoresis result then with 5V/cm voltage electrophoresis 30 minutes; If a unique amplified band is arranged below 300bp; And its size conforms to expection cDNA amplified production size, and explaining does not have the genomic dna pollution among total RNA, can be used to detect the expression of various dnmt rnas.If there more than the expection band, have second to take out of to be existing; And its size conforms to the amplified production that with the genomic dna is template; Explaining has genomic dna to pollute among total RNA, then need this reverse transcription product is abandoned, and the DNaseI with no RNase handles total RNA again; Repeat above-mentioned reverse transcription-PCR then and detect, in total RNA sample, detect and pollute less than genomic dna.

Each member expresses level detection in the dnmt rna family.In each 0.2ml PCR pipe; The RT-PCR product that adds 1 μ l dilution respectively, each 1 μ l of the special upstream and downstream primer of dnmt rna member (2.5 μ M) (simultaneously with the positive contrast of actin gene), 2 * SYBR green premixed liquid, 10 μ l; The PCR water adds to final volume 20 μ l; Put into the fluorescence real-time quantitative PCR appearance,, detect the exciting light of each sample simultaneously with the preset program run of instrument.After program run finished, the analysis software that the operation instrument carries was used Δ Δ Ct method, obtains relative expression's abundance of each dnmt rna family member.

The dnmt rna family member always expresses level detection.Method is similar with the expression level that detects each family member, and different is, uses primer DMT_A, DMT_B and DMT705 respectively, their threes' expression level addition, promptly gets all members' of dnmt rna family expression level summation.

Sequence table

< 110>Northeast Normal University

< 120>a kind of method that detects the dnmt rna gene

<130>

<140>

<150>

<160>24

<170>

<210>1

<211>24

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<220>

<221>OsDMT_AF

<222>(1)..(24)

<400>1

wrtggtggsc?ctccrtgtca?rggy 24

<210>2

<211>24

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT_AR

<222>(1)..(24)

<400>2

yccwarygkd?rcytgrtahy?bcat 24

<210>3

<211>24

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT_BF

<222>(1)..(24)

<400>3

mtstwywstg?gwattggagg?tgca 24

<210>4

<211>24

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT_BR

<222>(1)..(24)

<400>4

ratmryyakg?tcaaarccrc?caaa 24

<210>5

<211>21

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT701-F

<222>(1)..(21)

<400>5

ggaggactca?gatgaccact?t 21

<210>6

<211>20

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT701-R

<222>(1)..(20)

<400>6

ggtagtgaca?tcgagccttc 20

<210>7

<211>22

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT702-F

<222>(1)..(22)

<400>7

cctgtggtga?tgatagaggg?aa 22

<210>8

<211>21

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT702-R

<222>(1)..(21)

<400>8

caagtctaac?attgggcggt?a 21

<210>9

<211>21

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT703-F

<222>(1)..(21)

<400>9

ggcaggttgc?tagagttctt?c 21

<210>10

<211>19

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT703-R

<222>(1)..(19)

<400>9

tcctcgggtc?atgtgattg 19

<210>11

<211>19

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT704-F

<222>(1)..(19)

<400>11

gggactgacc?actgccact 21

<210>12

<211>21

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT704-R

<222>(1)..(21)

<400>12

cacgcttgag?atcatgcttt?t 21

<210>13

<211>23

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT705-F

<222>(1)..(23)

<400>13

gaaagtcctc?gagttctata?gcg 23

<210>14

<211>19

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT705-R

<222>(1)..(19)

<400>14

gttggcaacg?tcgttgatg 19

<210>15

<211>22

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT706-F

<222>(1)..(22)

<400>15

acaatgataa?gttcgagtgg?ga 22

<210>16

<211>19

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT706-R

<222>(1)..(19)

<400>16

cagcaaccaa?agcacctga 19

<210>17

<211>24

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT707-F

<222>(1)..(24)

<400>17

catcaagtag?ttctaaccac?cagg 24

<210>18

<211>21

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT707-R

<222>(1)..(21)

<400>18

tgttttcaag?acaggctcac?a 21

<210>19

<211>21

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT708-F

<222>(1)..(21)

<400>19

aggaagtgga?accttgtctg?g 21

<210>20

<211>21

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT708-R

<222>(1)..(21)

<400>20

cctgctaact?cccctggtat?g 21

<210>21

<211>23

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT709-F

<222>(1)..(23)

<400>21

cttggaagaa?tgtaggaagt?gga 23

<210>22

<211>22

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT709-R

<222>(1)..(22)

<400>22

gccattaggg?aatatgtccc?tc 22

<210>23

<211>25

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT710-F

<222>(1)..(25)

<400>23

ctccagtcat?gtaagatcac?aattt 25

<210>24

<211>25

<212>DNA

< 213>paddy rice (Oryza sativa japonica)

<221>OsDMT710-R

<222>(1)..(25)

<400>24

caaaagagcc?tccagtatag?tatct 25

Claims (1)

1. method that detects the dnmt rna gene, it is characterized in that key step is: get plant tissue, cryogrinding becomes fine powder; Extract genomic dna and total RNA respectively with different ordinary methods, carry out purifying respectively, obtain the genomic dna and total RNA sample that are used to detect extracting product; For genome DNA sample, be template with them, carry out pcr amplification with ten pairs of primers that detect the methyltransgerase family member respectively; Whether detection has this methyltransgerase family member's existence in employed rice varieties/genotype, for total RNA sample; Carrying out reverse transcription reaction, obtain cDNA, is pcr template then with cDNA; Be used in the methyltransgerase primer amplification that exists in this rice varieties/genotype; PCR product electrophoresis result is shown as a band, and its size does not have genomic dna to pollute than the little about 100bp of product with the genomic dna amplification among then total RNA; Two bands are arranged, and than the molecular weight of big band with uses genomic dna in full accord as the stripe size that template amplification obtains, the genomic dna pollution is then being arranged in total RNA sample; Will be with DNaseI except that after depolluting; Could make template of so total RNA and carry out reverse transcription, its product cDNA is used for pcr template, uses the real time fluorescent quantitative TRAP; Primer with detecting different methyltransgerase members carries out pcr amplification; Each member's of detection by quantitative expression level uses 12 pairs of primers, and wherein ten pairs of primer specific ground combine the some special members in the Methyl transporters enzyme family; And not can with rice genome/transcribe in the group other any sequence make a mistake and combine, they are used to detect the expression level of every kind of methyltransgerase; Two pairs of degenerated primers, DMT_A identification DMT701, DMT702, DMT703, DMT704, DMT707, DMT_B identification DMT706, DMT708, DMT709, DMT710; They use with the DMT705 primer, can detect all members' of dnmt rna family overall expression level, 12 pairs of primers of use; Be that genome sequence and cDNA sequence with ten members of paddy DNA Methyl transporters enzyme family is template; Design overall detection of expression primer from the conserved sequence that a plurality of members have designs the single member of detection and whether has the primer that reaches the expression degree from the distinctive sequence of single member respectively, and when the design primer, places it in the both sides of certain intron in the genomic dna; Primer design method; The main general primer-design software Primer premier 5 that adopts accomplishes, and is auxiliary with artificial interpretation simultaneously, the length 17～25bp of all primers; GC content 40～60%; 57～62 ℃ of annealing temperatures, amplification be PCR product size 200～400bp during cDNA, amplifying genom DNA the or when cDNA that genomic dna pollutes is arranged; PCR product size 300～500bp; The primer that is used to detect the overall expression level of dnmt rna is right, is the DMT_A that detects DMT701, DMT702, DMT703, DMT704, DMT707 expression level, and the DMT_B that detects DMT706, DMT708, DMT709, DMT710 expression level:

DMT_A：

OsDMT_AF：WRTGGTGGSCCTCCRTGTCARGGY

OsDMT_AR：YCCWARYGKDRCYTGRTAHYBCAT

Product size during amplification cDNA is 249bp or 243bp, and template is DMT702 and DMT707 or does

DMT701，DMT703，DMT704；

DMT_B：

OsDMT_BF：MTSTWYWSTGGWATTGGAGGTGCA

OsDMT_BR：RATMRYYAKGTCAAARCCRCCAAA

The product size of amplification during cDNA is 231bp or 234bp, and template is DMT706, DMT708 and DMT709 or be DMT710;

The primer of DMT701 is placed on the first and the 3rd exon, first and second intron of interval 131bp and 97bp, and second exon of 26bp;

OsDMT701-F：GGAGGACTCAGATGACCACTT

OsDMT701-R：GGTAGTGACATCGAGCCTTC

PCR product 152bp during intronless, product 406bp during amplifying genom DNA,

The primer of DMT702 is placed on the 4th and the 5th exon, the 4th intron of interval 111bp;

OsDMT702-F：CCTGTGGTGATGATAGAGGGAA

OsDMT702-R：CAAGTCTAACATTGGGCGGTA

PCR product 157bp during intronless, product 268bp during amplifying genom DNA,

The DMT703 primer is placed on the 4th and the 5th exon, the 4th intron of interval 183bp;

OsDMT703-F：GGCAGGTTGCTAGAGTTCTTC

OsDMT703-R：TCCTCGGGTCATGTGATTG

PCR product 118bp during intronless, product 301bp during amplifying genom DNA,

The DMT704 primer is placed on third and fourth exon, the 3rd intron of interval 111bp;

OsDMT704-F：GGGACTGACCACTGCCACT

OsDMT704-R：CACGCTTGAGATCATGCTTTT

PCR product 115bp during intronless, product 226bp during amplifying genom DNA,

The DMT705 primer is placed on first and second exons, first intron of interval 104bp;

OsDMT705-F：GAAAGTCCTCGAGTTCTATAGCG

OsDMT705-R：GTTGGCAACGTCGTTGATG

PCR product 109bp during intronless, product 213bp during amplifying genom DNA,

The DMT706 primer is placed on first and second exons, second intron of interval 117bp;

OsDMT706-F：ACAATGATAAGTTCGAGTGGGA

OsDMT706-R：CAGCAACCAAAGCACCTGA

PCR product 147bp during intronless, product 264bp during amplifying genom DNA,

The DMT707 primer is placed on first and second exons, first intron of interval 122bp;

OsDMT707-F：CATCAAGTAGTTCTAACCACCAGG

OsDMT707-R：TGTTTTCAAGACAGGCTCACA

PCR product 182bp during intronless, product 304bp during amplifying genom DNA.

The DMT708 primer is placed on the 7th and the 8th exon, the 7th intron of interval 36bp;

OsDMT708-F：AGGAAGTGGAACCTTGTCTGG

OsDMT708-R：CCTGCTAACTCCCCTGGTATG

PCR product 111bp during intronless, product 147bp during amplifying genom DNA

The DMT709 primer is placed on the 7th and the 8th exon, the 7th intron of interval 407bp;

OsDMT709-F：CTTGGAAGAATGTAGGAAGTGGA

OsDMT709-R：GCCATTAGGGAATATGTCCCTC

PCR product 199bp during intronless, product 606bp during amplifying genom DNA.

The DMT710 primer is placed on the second and the 3rd exon, second intron of interval 136bp;

OsDMT710-F：CTCCAGTCATGTAAGATCACAATTT

OsDMT710-R：CAAAAGAGCCTCCAGTATAGTATCT

PCR product 115bp during intronless, product 251bp during amplifying genom DNA.

Images