CN102703456B

CN102703456B - Action target site of death-associated protein kinase (DAPK3) gene hsa-miR-20a

Info

Publication number: CN102703456B
Application number: CN201210150061.7A
Authority: CN
Inventors: 张翼; 付向东; 蔡志强; 薛愿超
Original assignee: ABLIFE (WUHAN) Inc
Current assignee: ABLIFE (WUHAN) Inc
Priority date: 2012-05-15
Filing date: 2012-05-15
Publication date: 2014-04-02
Anticipated expiration: 2032-05-15
Also published as: CN102703456A

Abstract

The invention discloses an action target site of gene hsa-miR-20a on cancer suppressor gene death-associated protein kinase (DAPK3) of a carcinogenicity hsa-miR-20a. The action target site is located on a second exon in a DAPK3 coding area, a nucleotide sequence is shown as SEQIDNo1. The invention further discloses an oligonucleotides inhibitor of the hsa-miR-20a, the inhibitor can effectively prevent inhibitory action of the hsa-miR-20a on the DAPK3 and kill human cancer cells, and the sequence of the oligonucleotides inhibitor is shown as SEQIDNo2. Mutation of the hsa-miR-20a target site on the cancer suppressor gene DAPK3 can improve protein expression index of the DAPK3 and reduce livability of the human cancer cells. The invention further provides a mutation sequence and the DAPK3 containing the mutation sequence. Relevant gene therapy medicines can be developed according to the target site, the mutation sequence of the target site and the hsa-miR-20a oligonucleotides inhibitor, and the action target site has important medical application prospects.

Description

The target site point of DAPK3 gene hsa-miR-20a

Technical field

The present invention relates to molecular biology and field of medicaments, be specifically related to Microrna (miRNAs) hsa-miR-20a to the target site of the expression inhibiting of cancer suppressor gene DAPK3 (target molecule), the invention still further relates to and utilize this path to remove the suffered expression inhibiting of DAPK3, thereby activate method and related drugs that it suppresses human cancer Growth of Cells.

Background technology

Microrna (miRNAs) is the little RNA of a most important class finding so far.The non-coding rna regulation that it is comprised of 20-25 Nucleotide; mainly on rna level, genetic expression is regulated and controled; in cell proliferation and death, metabolism of fat, Neurons location, the differentiation of hematopoietic cell system and various growth course, all play vital regulating and controlling effect (Kim, V.N.MicroRNA Biogenesis:Coordinated Cropping and Dicing.Molecular Cell Biology:Nature Reviews.6:376-385; 2005, Bartel, D.P.MicroRNAs:genomics, biogenesis, mechanism, and function.Cell 116,281-297; 2004.).Existing 1921 of the miRNA finding in human body at present, the express spectra of these miRNAs has great difference in healthy tissues and cancerous tissue, this prompting miRNA in the generation of cancer, infect, play an important role in the process such as transfer.

Over 2005, miRNA works and becomes a focus of life science in cancer occurs, American scientist is then first by the mir-17-92cluster(bunch being positioned on No. 13 karyomit(e)s of the mankind) called after " oncomiR1 " (Lin He, J.Michael Thomson, Michael T.Hemann, Eva Hernando-Monge, David Mu, Summer Goodson, Scott Powers, Carlos Cordon-Cardo, Scott W.Lowe, Gregory J.Hannon and Scott M.Hammond.A microRNA polycistron as a potential human oncogene.Nature 435, 828-833).Find that nearly all studied cancer has specific label miRNA the same period, most label miRNA level is raised, also there is the miRNA level of considerable part to be lowered (Stefano Volinia, George A. Calin, Chang-Gong Liu, Stefan Ambs, Amelia Cimmino, Fabio Petrocca, Rosa Visone, Marilena Iorio, Claudia Roldo, Manuela Ferracin, Robyn L.Prueitt, Nozumu Yanaihara, Giovanni Lanza, Aldo Scarpa, Andrea Vecchione, Massimo Negrini, Curtis C.Harris, and Carlo M.Croce.A microRNA expression signature of human solid tumors defines cancer gene targets.Proc Natl Acad Sci.103, 2257-2261).Later stage in the same year finds that about 50% miRNAs being explained is positioned on genome the fragile site with Tumor-assaciated.Mir-17-92 bunch comprises miR-17, miR-18, miR-19, miR-20a, and miR-92.Mankind miR-20a is a proto-oncogene, in the rectum cancer, carcinoma of the pancreas and prostate cancer, all presents high expression level.Research shows that high expression level miR-20a can significantly reduce the apoptosis of c-Myc transgenic mice cancerous tumor cell, thus the high-speed and high lethality rate that causes cancer to occur, and prompting miR-20a may play anti-apoptosis in vivo.Up to the present the action target of the miR-20a being verified only has E2F1, miR-20a may be by reducing the protein expression of E2F1 inhibited apoptosis (Yannick Sylvestre, Vincent De Guire, Emmanuelle Querido, Utpal K.Mukhopadhyay, V é ronique Bourdeau

major, Gerardo Ferbeyre, and Pascal Chartrand.An E2F/miR-20a Autoregulatory Feedback Loop.J.Biol.Chem.282,2135-2143, Kathryn A.O ' Donnell, Erik A.Wentzel, Karen I.Zeller, Chi V.Dang, and Joshua T.Mendell.c-Myc-regulated microRNAs modulate E2F1 expression.Nature 435,839-843).But do not cause apoptotic reduction when knock out E2F1 in c-Myc transgenic mice after.This explanation miR-20a comes (Troy A.Baudino, Kirsteen H.Maclean, Jennifer Brennan, the Evan Parganas of inhibited apoptosis by reducing the expression of E2F1 albumen ¹chunying Yang, Aaron Aslanian, Jacqueline A.Lees, Charles J.Sherr, Martine F.Roussel and John L.Cleveland.Myc-Mediated Proliferation and Lymphomagenesis, but Not Apoptosis, Are Compromised by E2f1 Loss.Molecular Cell, 11,905-914).Up to the present the mechanism of action of miR-20a apoptosis inhibit is still unclear.

Summary of the invention

The object of the present invention is to provide the upper target site sequence that is suppressed expression by hsa-miR-20a of cancer suppressor gene DAPK3;

Another object of the present invention is to provide the inhibitor sequence of a kind of hsa-miR-20a, and this inhibitor can be removed the restraining effect of hsa-miR-20a to cancer suppressor gene DAPK3;

Another object of the present invention is to provide the mutant nucleotide sequence of above-mentioned DAPK3 target site sequence, and this sequence has kept aminoacid sequence and the protein active of DAPK3, but has escaped the restraining effect of hsa-miR-20a;

A further object of the present invention is to provide two kinds of cancer therapy drugs.

For achieving the above object, technical scheme of the present invention is as follows:

The present invention has proved that proto-oncogene hsa-miR-20a is by promoting human cancer cell's survival rate to the expression inhibiting of cancer suppressor gene DAPK3.The present invention has found the upper target site sequence that is suppressed expression by hsa-miR-20a of DAPK3, and this sequence is positioned at cancer suppressor gene DAPK3 on its second exon, and its nucleotide sequence is as shown in SEQIDNo.1.

The present invention studies discovery, can remove hsa-miR-20a by the restraining effect of this target spot to DAPK3 by an oligonucleotide sequence, causes DAPK3 expression amount to improve, and its sequence is as shown in SEQIDNo.2.This sequence can be used for developing cancer therapy drug.

The present invention studies and finds, by the sudden change to above-mentioned target site sequence, can remove the restraining effect of hsa-miR-20a, can cause the expressing quantity of DAPK3 to improve and therefore cause that the survival rate of human cancer cell reduces.And then the invention provides the agreement mutant nucleotide sequence of described target site, it disturbs the inhibition of has-miR-20a to DAPK3, but does not change the aminoacid sequence of DAPK3.Preferably, the nucleotides sequence of described mutant nucleotide sequence is classified as: TCCTGGACGGCGTTCATTATCTCCATTCAAAACGGATCGCACACTTTGAC.

The present invention also further provides the cancer therapy drug based on above-mentioned target site exploitation, this medicine is by making the series jump of above-mentioned target site remove the expression inhibiting of hsa-miR-20a to cancer suppressor gene DAPK3, improve the expression level of DAPK3 in cancer cell, to reduce the survival rate of cancer cell, suppress the growth of cancerous tissue.

The present invention further also provides the cancer suppressor gene DAPK3 that contains said mutation sequence, and because sudden change has occurred for the hsa-miR-20a target site of this gene, thereby its expression can not be subject to the impact of hsa-miR-20a.The present invention also provides the expression vector that contains described gene, by described expression vector is imported in cancer cells, can make cancer suppressor gene DAPK3 effective expression in cancer cells, thereby effectively reduce cancer cells survival rate.

The present invention has following beneficial effect:

Provided by the invention hsa-miR-20a target molecule on cancer suppressor gene DAPK3 is suddenlyd change to it, or hsa-miR-20a is suppressed, all can cause the expressing quantity of DAPK3 to improve and therefore cause that the survival rate of human cancer cell reduces.Based on this, can develop the gene therapy medicament for this target molecule, have important medical applications prospect.

Accompanying drawing explanation

What Fig. 1 showed is the restraining effect that hsa-miR-20a expresses DAPK3, and wherein NC is the oligonucleotide sequence of negative control, in figure " /+/ +++ " be illustrated in experiment " do not add/add lower concentration/add high density/or add shown in oligonucleotide sequence;

What Fig. 2 showed is the promoter action that hsa-miR-20a inhibitor (anti-miR-20a) is expressed DAPK3.Wherein scramble is random oligonucleotide sequence, and anti-miR-20a is hsa-miR-20a inhibitor oligonucleotide, and its sequence is shown in SEQ ID No.2.In figure " /+" be illustrated in experiment, do not add or add shown in oligonucleotide sequence;

What Fig. 3 showed is saltant type DAPK3 and the expression of wild-type DAPK3 under different situations, and wherein D3 represents wild-type, and D3M represents saltant type, and SC is the result of having added hsa-miR-20a inhibitor, and anti-a20 is the result of having added Flag tag antibody;

Fig. 4 is the Photomicrograph of hsa-miR-20a and DAPK3 wild-type/mutant expression vector cotransfection human hela Cell line Hela, and wherein Mock is blank (replacing hsa-miR-20a and DAPK3 wild-type/mutant expression vector solution with isopyknic water).

Embodiment

Below in conjunction with specific embodiment, further set forth the present invention.Be to be understood that, these embodiment are only not used in restriction the scope of protection of present invention for the present invention is described, unreceipted specific experiment condition and method in the following example, conventionally according to normal condition as chief editors such as J. Pehanorm Brookers, Science Press, 1992, molecular cloning experiment guide (second edition); D.L. Spector etc., Science Press, 2001, cell experiment guide; Lv Hongsheng, Science Press, the condition that 1982, Huo Jiezhao manufacturer advises.

In following examples, hsa-mir-20a represents mankind miR-20a, and hsa-mir-20a mimics represents hsa-mir-20a oligomerization ribonucleotide (RNA) sequence of synthetic.MiR-20a in figure refers to hsa-mir-20a mimics.

The expression inhibiting of embodiment 1 hsa-miR-20a to DAPK3

(1) adopt the method for trans transfection that the hsa-mir-20a mimics transfection of synthetic is entered to human hela Cell line Hela, concrete steps are: by Hela cell, with trysinization and spread in 24 orifice plates, cell density is 30%.Configuration transfection composite, system is as follows:

The configuration of table 1 transfection mixture (being dissolved in 50 μ l Opti-mem substratum)

	NC	+	+++
				NC	4,5μl	3μl	0μl
hsa-mir-20a	0μl	1.5μl	4.5μl

[NC is negative contrast, is random oligomerization ribonucleotide]

4.5 μ l Lipo2000 are dissolved in 50 μ l Opti-mem substratum to standing 5 minutes of room temperature; Be added dropwise in each nucleic acid mixture, mix rear room temperature standing 20 minutes.Again the transfection mixture configuring is added drop-wise to ready 24 orifice plates.

After (2) 48 hours, every porocyte is washed twice with PBS; Every porocyte adds 200 μ l 1 * SDS sample-loading buffers, and standing 10 minutes lysing cell of room temperature move to 1.5ml centrifuge tube after piping and druming evenly.

(3) sample boils in 1000C, is placed on 5 minutes on ice.

(4) 10%SDS PAGE protein isolate sample, 10%SDS PAGE separation gel and spacer gel press respectively table 2 and table 3 formula is as follows:

The configuration of table 2 separation gel

Distilled water	1.3ml
		30%acrylamide	1.7ml
1.5M Tris（pH8.8）	1.9ml
		10%SDS	0.05ml
10%APS	0.05ml
		TEMED	0.002ml

The configuration of table 3 spacer gel

Distilled water	2.1ml
		30%acrylamide	0.5ml

1.5M Tris（pH8.8）	0.38ml
		10%SDS	0.03ml
10%APS	0.03ml
		TEMED	0.002ml

(5) albumen is transferred on the nitrocellulose filter of suitable size under the 100V voltage condition of 1 hour.

(6) TBST that nitrocellulose filter is placed in to 5% skim-milk blocks liquid incubated at room 1 hour; DAPK3 antibody and internal reference β-actin antibody incubated at room 1 hour, TBST solution is washed three times; Two anti-damping fluid room temperatures of horseradish peroxidase mark are hatched 1 hour, and TBST solution is washed three times

(7) use the substrate colouring reagents box of horseradish peroxidase to nitrocellulose filter color development treatment, and carry out the compressing tablet processing of developing a film with dark indoor X-ray.

Hsa-miR-20a mimics buys the auspicious rich biological company limited in Guangzhou, and Lipo2000 buys the company in invitrogene, and DAPK3 antibody is bought the biological company limited of three hawks in Wuhan, and β-actin antibody is bought the company in sigma.

As shown in Figure 1, hsa-miR-20a is at 50nM(+ for result) lower concentration under not obvious to the restraining effect of DAPK3, at 150nM(+++) high density under the expression of DAPK3 is had to strong restraining effect.

The promotion that embodiment 2 hsa-miR-20a inhibitor are expressed DAPK3

In the present embodiment, design has been synthesized hsa-miR-20a inhibitor (anti-miR-20a) (SEQ ID No.2) as the inhibitor (synthetic by Guangzhou Rui Bo company) that suppresses DAPK3 expression.By this inhibitor transfection mankind cervical cancer tumer line Hela, after 48 hours, transfectional cell is carried out to cracking collection, with the protein expression level of DAPK3 in specific antibody test cell and internal reference β-actin.Identical in method content and embodiment 1, do not repeat them here.

The configuration of table 4 transfection mixture (being dissolved in 50 μ l Opti-mem substratum)

As shown in Figure 2, hsa-miR-20a inhibitor has obvious promoter action to the protein expression of DAPK3 to result under 50nM concentration.

The establishment of embodiment 3 hsa-miR-20a target site on second exon of DAPK3

(1) with Trizol method, extracting mankind's cervical cell is total RNA of Hela, and key step is:

Cell is laid on to 24 orifice plates, Growth of Cells to 80% density after 24 hours

A) porocyte adds 600 μ l Trizol, and standing 5 minutes of room temperature, makes lysis

B) cell of cracking is transferred in 1.5ml centrifuge tube with liquid-transfering gun, added 120 μ l chloroforms, turn upside down and mix.

C) on supercentrifuge, the rotating speed with 12,000, under the condition of 4 ℃ centrifugal 20 minutes.

D) draw supernatant to fresh centrifuge tube, add 300 μ l Virahols, place on ice 20 minutes.

E) on supercentrifuge, the rotating speed with 12,000, under the condition of 4 ℃ centrifugal 10 minutes.

F) with liquid-transfering gun, siphon away supernatant, with 75% ethanol washing of precipitate, room temperature is dried for standing 5 minutes, thoroughly removes residual liquid

G) with 20 μ l DEPC, process water dissolution RNA

H) with Nanovue, measure together concentration and the purity thereof of RNA, sample retention is in-80 ℃.

Trizol reagent is bought the company in invitrogen, and chloroform, Virahol, ethanol are all bought in traditional Chinese medicines group.

(2) the synthetic cDNA of reverse transcription

Get the total RNA sample of 2 μ g for reverse transcription reaction, first remove trace genome DNA and pollute, in the following system of the secondary configuration of 0.2ml centrifuge tube:

RNA 10μl

RQ1 DNA enzyme 2 μ l

10X enzyme reaction buffer solution 2 μ l

DEPC processes water 6 μ l

Be placed in 37 ℃ of reactions 30 minutes, then add 2 μ l stop solution, 65 ℃ of activity of hatching 10 minutes inactivation DNase.RQ1DNase enzyme is purchased from Promega company.

In previous step reaction system, add following ingredients:

42 ℃ are reacted 1 hour, 5 minutes inactivation MMLV reversed transcriptive enzymes of 90 ℃ of heating.

(3) clone DAPK3 coding region sequence configures following pcr amplification system to eucaryon high-expression vector pCDNA3:

95 ℃ of sex change 1 minute, 60 ℃ of annealing 1 minute, 72 ℃ are extended 2 minutes.35 cyclic amplifications.

The primer of amplification DAPK3 coding region:

Forward primer GAAGATCTACCATGGACTACAAGGACGACGATGACAAGTCCACGTTCAGGCAGGAG GA, reverse primer CGGAATTCCCGCTCGAGCTAGCGCAGCCCGCACTCCA.

More than the PCR primer of design is synthesized by invitrogen company, and KOD plus archaeal dna polymerase is bought the company in TOYOBO.

In upper step reaction system, add 3 μ l EcoRI and XbaI restriction enzyme, 37 ℃ of water-baths 1 hour.

1% agarose purifying reclaims the amplified fragments of DAPK3, is connected to same enzyme and cuts in the carrier segments of processing, obtains plasmid pC DAPK3, standby after empirical tests is correct.

(4) structure of sudden change DAPK3 expression vector

PCR reaction system configures as follows:

95 ° of C sex change 2 minutes, 60 ° of C annealing 1 minute, 72 ° of C extend 8 minutes, 35 circulations of increasing.

As above in reaction system, adding 1 μ lDpnI, be placed in 37 ° of C water-baths and react 2 hours.

Get the rear system of 1 μ l reaction, be coated with the dull and stereotyped DAPK3 expression vector pCDAPK3M that obtains saltant type after conversion, empirical tests is correctly rear standby.

The sequence of mutant primer is:

TCCTGGACGGCGTTCATTATCTCCATTCAAAACGGATCGCACACTTTGAC

Positive-sense strand TCCTGGACGGCGTTCATTATCTCCATTCAAAACGGATCGCACACTTTGAC

Antisense strand GTCAAAGTGTGCGATCCGTTTTGAATGGAGATAATGAACGCCGTCCAGGA

More than the PCR primer of design is synthesized by invitrogen company, and DpnI restriction enzyme is purchased from TAKARA company.

(5) hsa-miR-20a inhibitor (anti-miR-20a) and DAPK3 expression vector coexpression

Adopt the method for cis transfection that the hsa-mir-20a inhibitor of synthetic and DAPK3 expression vector cotransfection are entered to human hela Cell line Hela, concrete steps are: by eugonic cell trysinization, be laid in 24 orifice plates, after 24 hours, cell grows to 80% density, uses Lipo2000 lipofectamine by hsa-miR-20a and DAPK3 wild-type (saltant type) expression vector transfection mankind cervical cancer tumer line Hela.Transfection conditions is as shown in the table:

Table 5 transfection conditions

Transfection method as described in example 1 above, does not repeat them here.

Transfection 48 as a child, is collected sample and with the expressing quantity of Flag tag antibody (being purchased from U.S. sigma company) and the interior DAPK3 of internal reference β-actin antibody test cell and internal reference.Indicate: because of DAPK3 in plasmid and Flag label, form fusion rotein, therefore can be by the expression amount of the DAPK3 in the antibody antibody test born of the same parents of Flag label.By comparing DAPK3 in the expression ratio of internal reference, determine the expression regulation trend of DAPK3.The method content of Westernblot as described in example 1 above, does not repeat them here.

As shown in Figure 3, saltant type DAPK3 is higher than wild-type expression amount because being no longer subject to the inhibition of miR-20a for result.After cotransfection hsa-miR-20a inhibitor, miR-20a no longer suppresses the expression of wild-type DAPK3, and the expression amount of wild-type DAPK3 and saltant type DAPK3 is replied consistent.

Embodiment 4 removes hsa-miR-20a the expression inhibiting of DAPK3 is done in order to suppress human cancer Growth of Cells

Saltant type and wild-type DAPK3 expression vector or its contrast empty carrier transfection are entered to human hela Cell line Hela.

In the present embodiment, adopt the method for cis transfection that the expression vector of hsa-mir-20a and DAPK3 expression vector cotransfection are entered to human hela Cell line Hela, concrete steps are: by eugonic cell trysinization, be laid in 24 orifice plates, after 24 hours, cell grows to 80% density, uses Lipo2000 lipofectamine by hsa-miR-20a and DAPK3 wild-type (saltant type) expression vector transfection mankind cervical cancer tumer line Hela.Transfection conditions is as following table:

Transfection method as described in example 1 above, does not repeat them here.

After transfection 48 hours, naked eyes turn the then survival condition of cell at micro-Microscopic observation on the contrary, to cell take pictures synthetic image the survival rate of qualitative detection cell.

As shown in Figure 4, DAPK3 wild-type and expression vector can reduce cell survival rate to result, and transfection after DAPK3 saltant type the survival rate of cancer cells lower.Can effectively the escape restraining effect of hsa-miR-20a in cancer cells of hint saltant type DAPK3, thereby the growth of more effective anticancer.When hsa-miR-20a and wild-type DAPK3 coexpression, the expression of DAPK3 is suppressed and cannot causes cancer cells survival rate higher by cell growth inhibiting.And when hsa-miR-20a and saltant type DAPK3 coexpression, the DAPK3 after sudden change has replied the inhibition of cell growth because not being subject to the inhibition of this former cancer microRNA, cause the reduction of cell survival rate.This result proves can the escape restraining effect of hsa-miR-20a of the transfection of saltant type DAPK3 expression vector effectively, thus efficient anticancer growth.

Claims

1. cancer suppressor gene DAPK3 is upper by the target site of proto-oncogene hsa-miR-20a inhibition expression, it is characterized in that, this target site is positioned on second exon of DAPK3 coding region, and its nucleotides sequence is classified TCCTGGACGGCGTTCACTACCTGCACTCTAAGCGCATCGCACACTTTGAC as.

2. a DNA, its nucleotides sequence is classified the mutant nucleotide sequence of the nucleotide sequence of target site described in claim 1 as, and the nucleotides sequence of described mutant nucleotide sequence is classified as: TCCTGGACGGCGTTCATTATCTCCATTCAAAACGGATCGCACACTTTGAC.

3. the cancer suppressor gene DAPK3 that contains DNA described in claim 2.

4. the expression vector that contains cancer suppressor gene DAPK3 described in claim 3.