CN102703398A - Composition and production method of methionine - Google Patents

Abstract

The invention discloses a microorganism for producing methionine and relevant products in a sulfur transferring path of endogenous genes and in a directional sulfhydrylation path of exogenous genes. The genes can be used for producing the methionine and SAMe.

Description

The working method of compsn and methionine(Met)

The application is dividing an application of the one Chinese patent application No.200780052545.5 that submitted on April 11st, 2007.

Technical field

The invention discloses compsn, and with the method for producing methionine(Met) and associated products like mikrobe, enzyme and chemical substance.

Background technology

Methionine(Met) is the indispensable amino acid in the animal diet.For a long time, the preparation of methionine(Met) is to adopt propenal, thiomethyl alcohol and prussiate as starting substance, through various multistep chemical reaction synthetic.Two kinds of product form: D are arranged, L methionine(Met) and hydroxy analogs thereof.Different with other amino acid, the D-methionine(Met) is converted into essential L-isomer in vivo.According to reports, owing to the increase of poultry demand with recently as pig feed addictive, the market of feed grade methionine(Met) is in continuous expansion.The ability that the main manufacturer of methionine(Met) (Degussa AG, Adisseo and Novus) meets the need of market depends on raw material supply.Intermediate product propenal and thiomethyl alcohol must be converted into 3-methyl sulphur propionic aldehyde, and (3-methylthiopropionaldehyde MMP) and through prussic acid further changes into methionine(Met).All this three tame production commercial cities plan increases the production unit of methionine(Met)s and combine with raw material production (Chem.Marketing Reporter April 7,2003).

Research to the methionine biosynthesis pathway (aspartate family member) of large number of biological body demonstrates phase Sihe difference.The initial reactions step of confirming is that acylation reaction takes place under the katalysis of homoserine acyltransferase (homoserine acyltransferase) homoserine, and different except the acyl group that takes place to shift, it is prevalent in all organisms.The product of metA katalysis is acetylhomoserine or succinyl homoserine.Acetylhomoserine is converted into homocysteine through changeing sulphur approach or directed sulfhydrylation approach subsequently.Two kinds of approach are all existed by report and act in the bacterium of yeast, fungi, green plants and corynebacterium (Corynebacterium glutamicum).Intestinal bacteria (E.coli) are only adopted changes the sulphur approach.Change the sulphur approach with cystathionine as intermediate product and by halfcystine as the sulphur donor.Directed sulfhydrylation approach comprises sulfide is integrated directly into acylhomoserine.Final step in this approach is that homocysteine is converted into methionine(Met) under the katalysis of homocysteine methylferase (homocysteine methyltransferase is by metE or metH genes encoding).

The important amino acid that other is used for animal-feed passes through fermentative prepn like Methionin, Threonine and tryptophane.Therefore, these amino acid can be generated as starting substance by glucose and other renewable resource.Regrettably produce methionine(Met) and unsuccessful, still adopt the chemosynthesis of methionine(Met) so far through the method for fermentation.This wherein partly cause be because the suitable production host who lacks the production methionine biosynthesis pathway of effective structure and produce methionine(Met).

Disclose the methionine(Met) biosynthetic pathway of improvement below and produced the host.

Summary of the invention

General introduction

(S-adenosylmethionine, process SAMe) is described at this to produce methionine(Met) and associated products such as S-adenosylmethionine through the method for fermentation.The genetically engineered mikrobe that contains recombinant DNA molecules and produce methionine(Met) also is described in this.

The invention describes and contain peptide (EC 2.5.1.49, EC 4.2.99.-), and contain mikrobe with the peptide (EC 2.5.1.48 and 4.4.1.8) that changes the active endogenous nucleic acid sequence encoding of sulphur with the active exogenous nucleic acid sequences coding of directed sulfhydrylation.This mikrobe can produce methionine(Met) and associated products.In some instances, this mikrobe can produce at least 0.1,1,2,5,10,50,75,90 or the methionine(Met) or the SAMe of 100g/L born of the same parents' extracellular concentration.

In some instances, there is more than a kind of methionine biosynthesis pathway,, allows organism to produce more methionine(Met) than under the condition that lacks exogenous nucleic acid sequences (it is active that the peptide of its coding has directed sulfhydrylation).

In other example, in organism, enlivening two or more methionine(Met) biosynthetic pathways.In these examples, it is active that the peptide of one or more exogenous nucleic acid sequences codings has directed sulfhydrylation.A kind of peptide wherein can be with the O-succinyl homoserine as substrate, and another kind of peptide can be with O-acetylhomoserine as substrate.

In some instances, the product methionine(Met) and the associated products of structure, like the mikrobe of SAMe, at least 10% the methionine(Met) that is produced comes from changes the sulphur biosynthetic pathway.In other examples, at least 20,30,40 or 50% the product that their produce comes from changes the sulphur biosynthetic pathway.

In some instances, the product methionine(Met) and the associated products of structure, active like the mikrobe of SAMe by directed sulfhydrylation biosynthetic pathway, produce at least 10% methionine(Met).In other examples, they produce at least 20,30,40 or 50% product by directed sulfhydrylation biosynthetic pathway.

In some instances, make up to produce the mikrobe of methionine(Met) and associated products, with attenuation by gene such as metD, metK, metJ, thrB, the peptide of serA coding or the activity of its goods.In other examples, mikrobe also was built into expresses one or more genes, like metA, and metB, metC, metE, metY, metZ, metX, metH, cysPWUA, cysD, cysN, cysC, cysH, cysI, cysJ, cysG, csyK and cysM.

The present invention also provides the method for producing methionine(Met) and SAMe.These methods comprise the production methionine(Met) of cultivation structure and the mikrobe and the separated product of associated products.In some instances, mikrobe can be intestinal bacteria (E.coli), Rhodopseudomonas (Pseudomonas sp.) or corynebacterium (Corynebacterium glutamicum.).

At this new nucleotide sequence and amino acid sequence corresponding (SEQ ID NOS:1 and 2) have been described also.Being used in of these nucleotide sequences and fragment and these nucleotide sequences produces peptide in the recombinant microorganism.These peptides are used to produce methionine(Met) and SAMe.These peptides and version thereof also are used to produce special wedding agent with its fragment, like antibody.

(phosphoadenylylsulfate, the method for PAPS) improving the assimilation process of sulphur also is described in this to omit intermediate product adenosine phosphate acyl sulfate.This method can be used for the mikrobe of any product methionine(Met).This method is that it allows the overexpression of one or more APS reductases (adenylyl sulfate reductases) (EC1.8.99.2 or 1.8.4.9) through the nucleotide sequence of introducing reorganization in mikrobe.Overexpression can be through introducing the recombinant nucleic acid sequence that changes; Or through introducing new controlling elements; Like promotor or enhanser, it has strengthened the expression of endogenous APS reductase or has strengthened the expression of the recombinant nucleic acid sequence of coding APS reductase.

Through following detailed and specific embodiment, the present invention and other aspect are conspicuous.

Description of drawings

Fig. 1 shows three kinds of approach of various production by biological methionine(Met)s.All approach all partly depend on and adopt aspartic acid as the starting substance of producing methionine(Met).Aspartic acid is converted into homoserine through polystep reaction, and homoserine is converted into O-acetylhomoserine or O-succinyl homoserine through MetA or MetX.Some mikrobes; Utilize the MetA polypeptide to produce the O-succinyl homoserine like intestinal bacteria and Rhodopseudomonas (Pseudomonas sp.); And other mikrobe utilizes MetX to produce O-acetylhomoserine like corynebacterium and leptospira (Corynebacterium and Leptospira sp.).O-succinyl homoserine and O-acetylhomoserine are converted into homocysteine through the sulfhydrylation approach subsequently fully, perhaps are converted into homocysteine (detailed description is all done in two reactions herein) through changeing the sulphur approach.Represent with * * that with the relevant enzyme of commentaries on classics sulphur approach the enzyme relevant with the sulfhydrylation approach represented with *.

Fig. 2 representes the semi-invariant of methionine(Met) in TF4076BJF, only expresses (TF4076BJF) through changeing the sulphur approach, only expresses (TF4076BJF-A) through the sulfhydrylation approach, or expresses (TF4076BJF metYX (Lm) simultaneously by two kinds of approach.

Fig. 3 schematically shows the screening method (product expression of each example marks with the shade ellipse) that is used for discerning feedback inhibition opposing agent metA gene mutation body.

Fig. 4 representes that the expression of methionine(Met) receives the time dependent curve of inhibition of feedback inhibition opposing agent metA gene.

Fig. 5 representes the transhipment model of methionine(Met) in the intestinal bacteria.

Fig. 6 shows natural sulfur assimilation approach and new alternative sulfur assimilation approach.

Sequence table

Nucleic acid shown in the sequence table and aminoacid sequence adopt the standard letter abbreviation, and 3 character codings are used for amino acid.Only demonstrate a chain of each nucleotide sequence, its complementary strand can draw with reference to known chain.

SEQ ID NOS:1-10 is nucleotide sequence and the amino acid sequence corresponding that comes from the various mutator gene metA of E.coli.

SEQ ID NOS:11-34 is various primer sequences used among the embodiment.

Detailed Description Of The Invention

Abbreviation and term

The explanation of following term and method has been described the present invention preferably and has been and guided those skilled in the art to implement.In literary composition, clearly specifying in addition; " comprise " that in this used " comprise, comprise " expression " one " of singulative comprises plural form; For example; Show referring to " comprising a cell " to comprise one or more such cells, mention in the literary composition that " comprising the homocysteine synthase " shows and comprise one or more homocysteine synthase, and be equal to known technology of those skilled in the art or the like.In literary composition, clearly specifying in addition, term " or " expression can be selected the single key element in the said alternative key element, or the combination of two or more key elements.For example, " homocysteine synthase activity or cystathionine gamma-synthase are active " expression homocysteine synthase activity, cystathionine gamma-synthase is active, or the homocysteine synthase activity combines with cystathionine gamma-synthase is active.

Have other explanation except, all technology of using in the present invention are identical with routine techniques known in the art with scientific terminology.Although can be used for implementing or checking the present invention with method and material similar or that be equal to that the present invention describes, suitable method and material are described below.Described material, method and embodiment only are used to explain, and can not limit scope of the present invention.Through following detailed description and the description in the claim, other features and advantages of the present invention are conspicuous.

Accession number (Accession Numbers): the accession number among the present invention comes from ncbi database (National Center for Biotechnology Information); (the National Institute of Health U.S.A.) safeguards by NIH for it.It is on February 20th, 2007 that DB provides the date of accession number.

EC number (Enzyme Classification numbers; Enzyme classification number): come from KEGG ligand DB the EC among the present invention number; Safeguard that by gene and genome capital of a country encyclopedia (Kyoto Encyclopedia of Genes and Genomics) part is sponsored by the Tokyo University.It is on February 20th, 2007 that DB provides EC number date.

Attenuation (Attenuate): the influence, activity or the intensity that alleviate something.For example; The susceptibility of the inhibition that the attenuation certain enzyme causes to feedback inhibition or by compound (this compound is not product or reactant) (nonspecific approach feedback; Non-pathway specific feedback), make this enzymic activity not receive the influence of compound existence.For example, metA gene and amino acid sequence corresponding thereof (as being depicted as example with sequence SEQ ID NOS:2) demonstrate several sudden changes, attenuation the susceptibility of its feedback inhibition.In embodiment 3.B, describe the attenuation of MetA susceptibility in detail.Another example, the activity of enzyme reduces can think attenuation.

CDNA (complementary DNA): separated continuously sequence, non-coding region (intron) and a regulating and controlling sequence, the DNA that decision is transcribed.The messenger RNA(mRNA) that cDNA can extract from cell generates through reverse transcription.

Disappearance is removed (Deletion): from nucleic acid molecule, remove one or more Nucleotide, or from protein molecular, remove one or more amino acid, the two ends after removing are connected.

Can detect, it is thus clear that (Detectable): existence that can be detected or definite.For example, if the signal that is produced by product or reactant is enough to detect,,, be can be detected like the generation of O-succinyl homoserine or homocysteine by the product that reactant generates.

Directed sulfhydrylation active (Direct sulfhydrylation activity): OSHS or OAHS and S2-direct reaction generate the ability of homocysteine.Have this active peptide and comprise such as homocysteine synthase (EC 4.2.99.-, EC 2.5.1.49), it is by gene metZ and metY coding.

DNA: thymus nucleic acid.DNA is a long chain polymer, and it comprises that (some viral genes contain Yeast Nucleic Acid, RNA) for the genetic material of most of Living Organism.The repeating unit of DNA polymkeric substance is four different Nucleotide, and wherein each Nucleotide is that one of four bases adenine, guanine, cytosine(Cyt) and thymus pyrimidines combine and have a phosphate group with ribodesose.In dna molecular, form codon, be the amino acid coding by three Nucleotide.The term codon also is used for being transcribed by dna sequence dna corresponding (and complementary) sequence of three Nucleotide of the mRNA that obtains.

Endogenous (Endogenous): be used herein to expressed nucleic acid molecule and specific cells or mikrobe, explain that nucleotide sequence or the peptide sequence in the cell do not utilize the recombination to construct technology, also do not utilize the recombination to construct technology to implant cell.Like cell wherein gene when occurring in nature is separated at first.If through recombinant technology, to transcribe or translate like promotor or enhanser initiation, regulating and controlling sequence changes, and thinks that still gene is endogenous.

External source (Exogenous): be used herein to expressed nucleic acid molecule and specific cells, be meant that arbitrary nucleic acid molecule is not to come from the specific cells of nature discovery.Therefore, in case in the nucleic acid molecule transfered cell that non-natural produces, be external source with being considered to pair cell.The nucleic acid molecule of natural generation also can become external source for specific cells.For example, isolated complete encoding sequence from cell X, in case with among this encoding sequence transfered cell Y, then for cell Y, this encoding sequence is an external source, even X and Y are the cells of same type.

Express (Expression): the information of genes encoding is converted into the process of the 26S Proteasome Structure and Function of cell, like protein, transfer RNA or ribosome-RNA(rRNA).The gene of expressing comprises and is transcribed into mRNA, translates into protein then, and those are transcribed into RNA, but the do not translate into protein gene of (for example, transfer RNA and ribosome-RNA(rRNA) s).

Afunction (Functional Deletion): the sudden change of gene order, partly or entirely disappearance, insert or other changes the generation of its minimizing or suppressor gene product or make the gene product loss of function.For example, the afunction of gene metJ among the E.coli has reduced the inhibition to the methionine(Met) biosynthetic pathway.In another example, the afunction of gene thrB among the E.coli has reduced in the Threonine biosynthetic pathway utilization to homoserine.In some instances, afunction representes to knock out sudden change.

Separate (Isolated): " isolating " biotic component (like nucleic acid molecule, protein or cell) expression is come out with the complete isolated or purified of other biotic component from naturally occurring composition, like other karyomit(e) and the external DNA of karyomit(e), RNA and protein.Nucleic acid molecule that " separation " goes out and protein comprise nucleic acid molecule and the protein that purifying comes out through the standard purification method.This term also comprises through recombinant expressed in host cell and through nucleic acid molecule and protein that chemical synthesis process produced.

In an example, the nucleic acid molecule of the natural generation of discrete representation directly with the two ends adjacency of sequence, its nucleic acid molecule of genome that comes from the natural generation of organism is direct adjacency (end and 5 ' is held and linked to each other, and the other end and 3 ' is held and linked to each other).

Nucleic acid molecule (Nucleic acid molecule): comprise RNA and dna molecular, be not limited to cDNA, genomic dna and mRNA.Comprise the synthetic nucleic acid molecule, like those through nucleic acid molecule chemosynthesis or that reorganization produces.This nucleic acid molecule can be two strands or strand.The nucleic acid molecule of strand can be sense strand or antisense strand.In addition, nucleic acid molecule can be cyclic or linearity.

(Operably linked) is operably connected: when first nucleotide sequence and second nucleotide sequence have the relation on the function, can first nucleotide sequence be operably connected to second nucleotide sequence.For example, if promotor has influence on transcribing or expressing of encoding sequence, this promotor is operably connected with this encoding sequence.Generally speaking, the dna sequence dna that is operably connected is an adjacency, and it is necessary in same reading frame, connecting two protein-coding regions.The series connection of the conformation of gene is transcribed into single messenger RNA(mRNA) separately, is called operon.Like this that the position of gene is contiguous, for example in plasmid vector,, formed a synthetic operon through the transcriptional control of single promotor.

ORFs ORF (open reading frame): a series of three Nucleotide (codon) encoded peptide, polypeptide or amino acid, do not have any terminator codon.These sequences can be translated into peptide usually.

Purifying (Purified): the term purifying is not to refer to absolute purifying; The relative notion of its expression.Therefore, the for example preparation of purified peptide, like the preparation of succinyl-coenzyme A homoserine acyltransferase or homocysteine synthase, resulting peptide concentration is bigger than peptide concentration in the cell.For example, the peptide of purifying possibly separated (nucleic acid, lipid, glucide and other peptide) the bonded cellular constituent fully from it.In another example, the preparation of the peptide of purifying is from pollutent, possibly be present in the pollutent of chemosynthesis of said peptide like those and dissociate out fully.

In an example,, for example account for about 60%, 70%, 80%, 85%, 90%, 92%, 95%, 98%, 99% or more for a long time, peptide is a purifying at least when the weight percent of peptide in the sample accounts for approximately 50% the time at least.The example that can be used for the method for purified peptide, include but not limited to disclosed methods such as Sambrook (Molecular Cloning:A Laboratory Manual, Cold Spring Harbor, New York, 1989, Ch.17).Purity of protein can pass through, and for example protein sample is carried out polyacrylamide gel electrophoresis, and the bar that then on painted polyacrylamide gel, demonstrates single peptide brings mensuration; Pass through high-pressure liquid chromatography; Measure through order-checking or other ordinary method.

Reorganization (Recombinant): the nucleic acid molecule of reorganization or albumen refer to natural non-existent sequence, and its sequence is through two independent sequence fragment artificiallies are combined.This manual work combines and can realize, for example through chemosynthesis or through manual operation isolated nucleic acid molecule or protein fragments is combined, like gene engineering.Reorganization also is used for describing through manually-operated nucleic acid molecule, but contain with organism in identical regulating and controlling sequence and the coding region found.

Sequence identity/similarity (Sequence identity/similarity): the identity/similarity of two or more nucleotide sequences, or the identity/similarity of two or more aminoacid sequences can be expressed as sequence identity or similarity.Sequence identity can be measured through the percentage ratio of identical sequence; High percentage ratio is represented high order row identity.Sequence similarity can be measured (considering the replacement of conserved amino acid) through the percentage ratio of similar sequences; High percentage ratio is represented high order row similarity.The employing standard method is compared, and the nucleic acid or the aminoacid sequence of homology (Homologs) or lineal homology (orthologs) have high relatively sequence identity/similarity.

The comparison method of comparative sequences differences is well known in the art.Various programs and comparison calculation rule are described in this: Smith & Waterman, Adv.Appl.Math.2:482,1981; Needleman & Wunsch, J.Mol.Biol.48:443,1970; Pearson & Lipman, Proc.Natl.Acad.Sci.USA 85:2444,1988; Higgins & Sharp, Gene, 73:237-44,1988; Higgins & Sharp, CABIOS 5:151-3,1989; Corpet etc., Nuc.Acids Res.16:10881-90,1988; Computer Appls.in the Biosciences 8 such as Huang, 155-65,1992; And Pearson etc., Meth.Mol.Bio.24:307-31,1994.Altschul etc., J.Mol.Biol.215:403-10,1990, detailed sequence alignment method and homology prediction is provided.

NCBI Basic Local Alignment Search Tool (BLAST) (Altschul etc., J.Mol.Biol.215:403-10,1990) can obtain through several kinds of resources, comprises the state-run (NCBI of information center of the U.S.; National Library of Medicine, Building 38A, Room8N805, Bethesda; MD 20894) and the Internet, according to the difference of aligned sequences, adopt sequential analysis program blastp; Blastn, blastx, tblastn and tblastx.Out of Memory can be referring to the NCBI website.

BLASTN is used for the comparison nucleotide sequence, and BLASTP is used for the comparing amino acid sequence.Two kinds of nucleotide sequences relatively, option can be arranged to :-i is arranged to comprise the file (as seq1.txt) of article one nucleotide sequence that will compare;-j is arranged to comprise the file (as seq2.txt) of the second nucleotide sequence that will compare;-p is arranged to blastn;-o is arranged to any filename of wanting (as output.txt);-q is arranged to-1;-r is arranged to 2; Other option is a default setting.For example, following order can be used for generating the output file that contains two sequence alignment results: Bl2seq-i seq1.txt-j seq2.txt-p blastn-o output.txt-q-1-r2.

Two aminoacid sequences relatively, the option of Bl2seq can be arranged to :-i is arranged to comprise the file (as seq1.txt) of article one aminoacid sequence that will compare;-j is arranged to comprise the file (as seq2.txt) of the second aminoacid sequence that will compare;-p is arranged to blastp;-o is arranged to any filename of wanting (as output.txt); Other option is a default setting.For example, following order can be used for generating the output file that contains two aminoacid sequence comparison results: Bl2seq – i seq1.txt-j seq2.txt-pblastp – o output.txt.If the sequence of two comparisons has homology, specified output file will be listed the homology zone of institute's aligned sequences.If the sequence of two comparisons does not have homology, specified output file will not show the sequence of comparison.

In case compare, the quantity of coupling is decided by the identical Nucleotide or the amino acid whose quantity that are present in two sequences.The percentage ratio of sequence identity is by the quantity decision of distinguishing coupling; Perhaps distinguish through the length of setting aligned sequences; Perhaps distinguish, the end value that obtains multiply by 100 through connecting length (as from aligned sequences, setting 100 successive Nucleotide or amino-acid residue).For example, when comparing with the cycle tests with 1554 Nucleotide, nucleotide sequence has the Nucleotide of 1166 couplings, i.e. 75.0% sequence identity (1166 ÷ 1554 * 100=75.0).The value of sequence identity percentage ratio adopts and rounds up.For example, 75.11,75.12,75.13 and 75.14 are rounded to 75.1, and 75.15,75.16,75.17,75.18 and 75.19 are rounded to 75.2.Length value always remains integer.

Relatively, adopt Blast 2 functional nucleotide sequences, through BLOSUM62 arranged in matrix system default parameter (open space value 11, each residue spacing value 1) greater than 30 amino acid whose sequences.Adopt NCBI Basic Blast 2.0, blastp at interval comes nr or swissprot DB freely, in the full length amino acid sequence that homology is normally compared, has 70% sequence identical.Through the result behind the blastn program search through DUST filter (Hancock and Armstrong, 1994, Comput.Appl.Biosci.10:67-70).Other program is used SEG.In addition, can carry out the manual work comparison.Adopt this method to assess, proteic similarity is high more, and sequence identity percent value is big more; As at least 75%, at least 80%, at least 85%; At least 90%; At least 95%, at least 97% or at least 99% with the identical sequence of chief series (sequence of accession number or other sequence are promptly arranged), have the activity of chief series simultaneously.In some instances, chief series has higher activity than native sequences, and in other examples, the chief series activity is lower.

Carry out short peptide sequence comparison (less than about 30 amino acid), adopt Blast 2 functional nucleotide sequences to accomplish comparison, through PAM30 arranged in matrix system default parameter (open space value 9, extending gap penalty is 1).Adopt this method to assess, the homology of albumen and reference sequences is high more, and sequence identity percent value is big more, as at least 60%, and 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% sequence identity.When the sequence of non-total length was compared, the individual amino acid whose sequence homology of 10-20 was at least 75% sequence identity, and sequence identity depends on the identity with reference sequences, is at least 85%, 90%, 95% or 98%.The method of estimating short sequence identity is referring to the NCBI website.

Since the degradation mechanism of genetic code, nucleic acid sequence encoding identical or similar (guarding) aminoacid sequence that does not have height identity.Utilize this degradation mechanism, make nucleotide sequence change and produce a large amount of nucleic acid molecule, all identical albumen of these nucleic acid molecule encodings.This type homologous nucleotide sequence does, for example, have at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99% with the identical sequence of chief series (sequence of accession number or other sequence are promptly arranged).

Those skilled in the art should be with the value range of these identical sequences only as instructing; Drop on that this is extraneous, its sequence possibly have homology.

Transformant (Transformed cell): utilize the cell that imports nucleic acid molecule such as biotechnology, like the nucleic acid molecule of succinyl-coenzyme A homoserine acyltransferase or homocysteine synthase.Conversion refers to all can the technology in the nucleic acid molecule transfered cell be included but not limited to the transfection of virus vector that engage, plasmid transforms, and through electroporation, liposome transforms and the method for particle gun imports naked DNA.

Change sulphur active (Transsulfuration activity): the activity that produces methionine(Met) or SAMe through the intermediate product cystathionine.Have this active peptide and comprise cystathionine Gamma synthase (EC2.5.1.48) and cystathionine beta lyase (EC 4.4.1.8), these peptides are respectively by gene metB and metC coding.Any peptide that has combined cystathionine Gamma synthase (EC 2.5.1.48) and cystathionine beta lyase (EC 4.4.1.8) can make mikrobe have the sulphur of commentaries on classics activity.

The condition (Under conditions that permit product production) that allows product to produce: anyly make mikrobe can produce required product, like the fermentation condition of methionine(Met) or SAMe product.These conditions generally include temperature, ventilation and substratum.Substratum can be broth culture or gel substratum.Usually, substratum comprises carbon source, like the material that can directly be utilized by mikrobe of glucose, fructose, Mierocrystalline cellulose or other, or is used for the enzyme that substratum promotes utilization of carbon source.For confirming whether culture condition can generate product, and microorganism culturing was taken a sample after 24,36 or 48 hours.For example, for detecting the existence of methionine(Met) or SAMe, adopted the method for inspection that provides among the embodiment.

Carrier (Vector):, form transformant thus in order to nucleic acid molecule is imported in the cell.Carrier contains can allow its nucleotide sequence that in cell, duplicates, like replication orgin.Carrier also contains one or more selected markers and other hereditary key element known in the art.

Detailed Description Of The Invention

I. methionine(Met) production approach

As shown in Figure 1; Can adopt multiple biosynthetic pathway prepare methionine(Met) or wherein between product; Like aspartylphosphate (aspartyl phosphate), aspartic acid semialdehyde, homoserine, O-succinyl homoserine (OSHS), O-acetylhomoserine (OAHS), cystathionine, homocysteine, methionine(Met), and S-adenosylmethionine (SAMe).In order to reach the object of the invention, according to its content, intermediate product can be considered to reactant or product.For example, when discussion utilized E.C. 2.7.2.4. that aspartic acid is converted into aspartylphosphate, aspartic acid was a reactant, and aspartylphosphate is a product.In like manner, when the specification sheets description adopted aspartate-semialdehyde dehydrogenase that aspartylphosphate is converted into the aspartic acid semialdehyde, aspartylphosphate was a reactant, and the aspartic acid semialdehyde is a product.Those having ordinary skill in the art will appreciate that multiple biosynthetic pathway shown in Figure 1, reactant is converted into product because in the every kind of enzyme family that provides, all have plurality of enzymes can be used in, thus the formation approach.In addition, these reactions can be in vivo or are external, or carry out through the combination of body internal reaction and vitro reactions, such as vitro reactions, comprise non-zymochemistry reaction.

In approach, also can be through comprising intermediate product as the fermentation charging, for host microorganism provides intermediate product.Like this, if the amount of the specific intermediate product of biosynthetic pathway preparation is less than aequum, just can this intermediate product be added in the charging.In continuously ferment equipment and batch fermentation equipment, this mode can realize.

Those of ordinary skill in the art can recognize and produce host's carbon source except that glucose capable of using.Alternative carbon source comprises such as sucrose, fructose, Mierocrystalline cellulose, semicellulose, starch or glycerine.When using alternative carbon source, need be included in the enzyme that transforms carbon source in the fermentation media.

A. conversion of glucose is an aspartic acid

Mikrobe prepares aspartic acid with glucose usually, persons of ordinary skill in the art may appreciate that the method for aspartic acid concentration in a lot of raisings production bacterial strains.For example, improve the expression of pyruvate carboxylase and PEPCase, change glyoxylate cycle (glyoxylate shunt) or get rid of other product of consumption pyruvic acid generation, like acetate or ethanol.

In addition, can aspartic acid be included in the fermentation charging, in methionine biosynthesis pathway, be used as reactant, absorb by mikrobe.

Aspartic acid also can be as intermediate product in Methionin, Threonine and l-asparagine acid biosynthetic pathway.Therefore, be necessary these approach of attenuation or removal (knocking out), thereby more aspartic acid is used in the methionine(Met) production approach.

B. aspartic acid is converted into aspartylphosphate

Produce the host and can adopt recognized polypeptide to make up, to produce aspartylphosphate or excessively to produce aspartylphosphate.As can adopt the disclosed feedback inhibition E.C. 2.7.2.4. of WO04069996A2 to substitute the endogenous E.C. 2.7.2.4. or coexist with the endogenous E.C. 2.7.2.4..

The E.C. 2.7.2.4. that adopts among the present invention comprises the peptide of EC (Enzyme Classification numbers enzyme classification number) 2.7.2.4, and other can be the peptide of aspartylphosphate with aspartic acid catalysis.In addition, one of ordinary skill in the art will appreciate that, but also other reaction of catalysis of some E.C. 2.7.2.4. peptides, and for example some E.C. 2.7.2.4. peptides also can be accepted other substrate except that aspartic acid.Therefore also comprise this non-special E.C. 2.7.2.4. peptide.The aspartokinase enzyme sequence is that the public is obtainable.The E.C. 2.7.2.4. nucleotide sequence is disclosed like GenBank accession number: NZ_AAVY01000022, NC_006958 and NZ_AAWW01000055; GenBank accession number: NP_418448, NP_599504 and ZP_01638096 disclose the E.C. 2.7.2.4. peptide sequence.The analytical method of confirming the E.C. 2.7.2.4. living features of particular peptide is well known in the art.As, by Cohen, the analytical method that GN (Methods in Enzymology, 113:596:600,1985) describes can be used for confirming the living features of special peptide.

C. aspartylphosphate is converted into the aspartic acid semialdehyde

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce the aspartic acid semialdehyde with production aspartic acid semialdehyde.A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is to express or express the more aspartate-semialdehyde dehydrogenase of high reactivity form through crossing.

The aspartate-semialdehyde dehydrogenase that adopts among the present invention comprises aspartate-semialdehyde dehydrogenase polypeptide (EC1.2.1.11), and other can be the peptide of aspartic acid semialdehyde with aspartylphosphate catalysis.In addition, one of ordinary skill in the art will appreciate that, but also other reaction of catalysis of some aspartate-semialdehyde dehydrogenase peptides.For example some aspartate-semialdehyde dehydrogenase peptides also can be accepted other substrate except that aspartylphosphate, therefore also comprise this non-special aspartate-semialdehyde dehydrogenase peptide.The aspartate-semialdehyde dehydrogenase sequence is that the public is obtainable.The nucleotide sequence of aspartate-semialdehyde dehydrogenase is disclosed like GenBank accession number: NC_006958, NZ_AAVY01000015 and NZ_AAWW01000010; GenBank accession number: NP_417891, NP_599505 and ZP_0164)) 72 the aspartate-semialdehyde dehydrogenase peptide sequence is disclosed.The analytical method of confirming the aspartate-semialdehyde dehydrogenase living features of particular peptide is well known in the art.As, by Cohen, the analytical method that GN (Methods in Enzymology, 113:600-602,1985) describes can be used for confirming the living features of special peptide.

D. the aspartic acid semialdehyde is converted into homoserine

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce homoserine with the production homoserine.A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is to express or express the more aspartate-semialdehyde dehydrogenase of high reactivity form through crossing.

The homoserine dehydrogenase that adopts among the present invention comprises homoserine dehydrogenase peptide (EC1.1.1.3), and other can be the peptide of homoserine with the catalysis of aspartic acid semialdehyde.In addition, one of ordinary skill in the art will appreciate that, but also other reaction of catalysis of some homoserine dehydrogenase polypeptide also can be accepted other substrate except that the aspartic acid semialdehyde like some homoserine dehydrogenase peptides.Therefore also comprise this non-special homoserine dehydrogenase peptide.The homoserine dehydrogenase peptide sequence is that the public is obtainable.The homoserine dehydrogenase nucleotide sequence is disclosed like GenBank accession number: NC_006958, NZ_AAVY01000013 and NZ_AAWW01000033; GenBank accession number: NP_414543, ZP_01639819 and NP_600409 disclose the homoserine dehydrogenase peptide sequence.The analytical method of confirming the homoserine dehydrogenase activity characteristic of particular peptide is well known in the art.As, the analytical method of being described by (Biochem.Biophys.Acta 128:426-439,1966) such as Patte. can be used for confirming the living features of special peptide.

E. homoserine is converted into O-succinyl homoserine (OSHS)

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce OSHS with production O-succinyl homoserine (OSHS).A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is through crossing homoserine O-succinyl-transferring enzyme (homoserine O-succinyltransferase) peptide of expressing or expressing high reactivity form more or the insensitive form of feedback inhibition that adopts homoserine O-succinyl-transferring enzyme peptide.

The succinyl-coenzyme A homoserine acyltransferase that adopts among the present invention comprises homoserine O-succinyl-transferring enzyme peptide (EC2.3.1.46), and other can be the peptide of OSHS with homoserine catalysis.In addition, one of ordinary skill in the art will appreciate that, but also other reaction of catalysis of some homoserine O-succinyl-transferring enzyme peptides also can be accepted other substrate except that homoserine like some succinyl-coenzyme As-homoserine acyltransferase peptide.Therefore also comprise this non-special succinyl-coenzyme A-homoserine acyltransferase peptide.Homoserine O-succinyl-transferring enzyme peptide sequence is that the public is obtainable.Homoserine O-succinyl-transferring enzyme nucleotide sequence is disclosed like GenBank accession number: NZ_AAWW01000055; GenBank accession number: AAC76983 discloses homoserine O-succinyl-transferring enzyme peptide sequence.The analytical method of confirming the living features of succinyl-coenzyme A-homoserine acyltransferase is well known in the art.As, the analytical method of being described by Lawrence (J.Bacteriol., 109:8-11,1972) can be used for confirming the living features of special peptide.The succinyl-coenzyme A of genes encoding-homoserine acyltransferase peptide is meant metA in the present invention.

E. homoserine is converted into O-acetylhomoserine (OAHS)

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce OAHS with production O-acetylhomoserine (OAHS).A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is to express or express the more homoserine O-Transacetylase peptide (EC2.3.1.31) of high reactivity form through crossing.

The homoserine O-Transacetylase that adopts among the present invention comprises homoserine O-Transacetylase peptide (EC2.3.1.31), and other can catalysis be the peptide of OAHS.In addition, one of ordinary skill in the art will appreciate that, but also other reaction of catalysis of some homoserine O-Transacetylase peptides also can be accepted other substrate except that homoserine like some homoserine O-Transacetylase peptides.Therefore also comprise this non-special homoserine O-Transacetylase peptide.Homoserine O-acetyl translocation peptide sequence is that the public is obtainable.Like GenBank accession number: Y10744 zone: 2822..3961, NZ_AAAH02000004 zone: 166057..167193, and the NZ_AAAY02000081 zone: complement (11535..12605) discloses homoserine O-Transacetylase nucleotide sequence; GenBank accession number: CAA71733, ZP_00766367 and ZP_00107218 disclose homoserine O-Transacetylase peptide sequence.The analytical method of confirming the homoserine dehydrogenase activity characteristic of particular peptide is well known in the art.As, the analytical method of being described by Lawrence (J.Bacteriol., 109:8-11,1972) can be used for confirming the living features of special peptide.The homoserine O-Transacetylase peptide of genes encoding is meant metX in the present invention.

G. sulfhydrylation

Through directed sulfhydrylation approach, with the production of homocysteine synthase (homocysteine synthase enzyme) completion homocysteine, it is substrate that the some of them enzyme adopts OSHS, and it is substrate that some enzymes adopt OAHS.In addition, some enzyme employing OSHS or OAHS are substrate.

1.O-succinyl homoserine (OSHS) is converted into homocysteine

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce homocysteine with the production homocysteine.A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is to express or express the more homocysteine synthase peptide (EC4.2.99.-) of high reactivity form through crossing.

The homocysteine synthase that adopts among the present invention comprises homocysteine synthase peptide (EC4.2.99.-), and other can be the peptide of homocysteine with O-succinyl homoserine (OSHS) catalysis.OSHS through with the sulfide reaction conversion be that homocysteine is meant directed sulfhydrylation in the present invention.In addition, one of ordinary skill in the art will appreciate that, but also other reaction of catalysis of some homocysteine synthase peptides also can be accepted other substrate except that OSHS like some homocysteine synthase peptides.Therefore also comprise this non-special homocysteine synthase peptide.Homocysteine synthase peptide sequence is that the public is obtainable.Homocysteine synthase (O-succinyl--L-homoserine sulfhydrylase) nucleotide sequence is disclosed like GenBank accession number: AE004091; GenBank accession number: AAG06495 discloses homocysteine synthase (O-succinyl--L-homoserine sulfhydrylase) aminoacid sequence.The analytical method of confirming the homocysteine synthase activity characteristic of particular peptide is well known in the art.As, the analytical method by Yamagata (Methods in Enzymology, 143:478,1987) describes adopts suitable substrate, can be used for confirming the living features of special peptide.The homocysteine synthase peptide of genes encoding is meant metZ in the present invention.

2.O-acetylhomoserine (OAHS) is converted into homocysteine

Produce the host and can adopt recognized polypeptide to make up,, or cross the expression homocysteine with the production homocysteine.A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is to express or express the more homocysteine synthase peptide (EC2.5.1.49) of high reactivity form through crossing.

The homocysteine synthase that adopts among the present invention comprises homocysteine synthase peptide (EC2.5.1.49), and other can be the peptide of homocysteine with O-succinyl homoserine (OAHS) catalysis.OAHS through with the sulfide reaction conversion be that homocysteine is meant directed sulfhydrylation in the present invention.In addition; One of ordinary skill in the art will appreciate that; But also other reaction of catalysis of some homocysteine synthase peptides also can be accepted other substrate except that OSHS like some homocysteine synthase peptides, the homocysteine synthase of mentioning like embodiment 2; Just can select OSHS or OAHS as substrate, therefore also comprise this non-special homocysteine synthase peptide.Homocysteine synthase peptide sequence is that the public is obtainable.Regional like GenBank accession number: AE004091: 5655648..5656925, Y10744 zone: 1485..2813, NZ_AAAH02000004 zone: 164536..165990 and NZ_AAAY02000081 zone: complement (12750..14054) discloses homocysteine synthase (O-acetyl-L-homoserine sulfhydrylase) nucleotide sequence; GenBank accession number: AAG08410, CAA71732, ZP_00766366 and ZP_00107219 disclose homocysteine synthase (O-acetyl-homoserine sulfhydrylase) aminoacid sequence.The analytical method of confirming the homocysteine synthase activity characteristic of particular peptide is well known in the art.As, the analytical method by Yamagata (Methods in Enzymology, 143:478,1987) describes adopts suitable substrate, is used for confirming the living features of special peptide.The homocysteine synthase peptide of genes encoding is meant metY in the present invention.

H. transsulfuration

1.O-succinyl homoserine (OSHS) or acetylhomoserine (OAHS) are converted into cystathionine

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce cystathionine with the production cystathionine.A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is to express or express the more cystathionine gamma-synthase peptide of high reactivity form (EC 2.5.1.48) through crossing.

The cystathionine gamma-synthase that adopts among the present invention comprises cystathionine gamma-synthase peptide (EC2.5.1.48), and other can be the peptide of cystathionine with OSHS or OAHS catalysis.In addition; One of ordinary skill in the art will appreciate that; But also other reaction of catalysis of some cystathionine gamma-synthase peptides also can be accepted except that OSHS or other substrate the OAHS like some cystathionine gamma-synthase peptides, therefore also comprises this non-special cystathionine gamma-synthase peptide.The cystathionine gamma-synthase peptide sequence is that the public is obtainable.The cystathionine gamma-synthase nucleotide sequence is disclosed like GenBank accession number: NC_006958, NZ_AAWW01000006 and NC_004129; GenBank accession number: NP_418374, YP_348978 and NP_601979 disclose the cystathionine gamma-synthase peptide sequence.The analytical method of confirming the cystathionine gamma-synthase living features of particular peptide is well known in the art.Like, Methods in Enzymology, 17:425-433,1971 analytical methods described can be used for confirming the living features of special peptide.The cystathionine gamma-synthase peptide of genes encoding is meant metB in the present invention.

2. cystathionine is converted into homocysteine

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce homocysteine with the production homocysteine.A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is to express or express the more cystathionine beta-lyase peptide (EC4.4.1.8) of high reactivity form through crossing.

The cystathionine beta-lyase that adopts among the present invention comprises cystathionine beta-lyase peptide (EC4.4.1.8), and other can be the peptide of homocysteine with cystathionine catalysis.In addition; One of ordinary skill in the art will appreciate that; But also other reaction of catalysis of some cystathionine beta-lyase peptides also can be accepted other substrate except that cystathionine like some cystathionine beta-lyase peptides, therefore also comprises this non-special cystathionine beta-lyase peptide.The cystathionine beta-lyase peptide sequence is that the public is obtainable.The cystathionine beta-lyase nucleotide sequence is disclosed like GenBank accession number: NZ_AAWW01000001, NC_006958 and NZ_AAVY01000004; GenBank accession number: NP_746463, YP_226552 and NP_417481 disclose the cystathionine beta-lyase peptide sequence.The analytical method of confirming the cystathionine beta-lyase living features of particular peptide is well known in the art.As, Methods in Enzymology, 143:483-486, the analytical method of 1987 descriptions can be used for confirming the living features of special peptide.The cystathionine beta-lyase peptide of genes encoding is meant metC in the present invention.

I. homocysteine is converted into methionine(Met)

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce methionine(Met) with the production methionine(Met).In the methionine(Met) biosynthetic pathway, improving product, is to express or express the more homocysteine methyl enzyme peptide of high reactivity form (homocysteine methlyase peptide) (EC 2.1.1.14 and 2.1.1.13) through crossing like a kind of method of methionine(Met) or SAMe output.

The homocysteine methyl enzyme that adopts among the present invention comprises homocysteine methyl enzyme peptide (EC 2.1.1.14 and 2.1.1.13), and other can be the peptide of methionine(Met) with homocysteine catalysis.In addition, one of ordinary skill in the art will appreciate that, but also other reaction of catalysis of some homocysteine methyl enzyme peptides also can be accepted other substrate except that homocysteine like some homocysteine methyl enzyme peptides.Therefore also comprise this non-special homocysteine methyl enzyme peptide.Homocysteine methyl enzyme peptide sequence is that the public is obtainable.Homocysteine methyl enzymatic nucleic acid sequence is disclosed like GenBank accession number: NC_004129, NC_006958 and NC_000913; GenBank accession number: AP_004520, YP_225791 and CAK16133 disclose homocysteine methyl enzyme peptide sequence.The analytical method of confirming the homocysteine methyl enzymic activity characteristic of particular peptide is well known in the art.Like, AnalyticalBiochemistry, 228,323-329,1995 analytical methods described can be used for confirming the living features of special peptide.The homocysteine methyl enzyme peptide of genes encoding is meant metH or metE in the present invention.

J. methionine(Met) is converted into S-adenosylmethionine

Produce the host and can adopt recognized polypeptide to make up,, or excessively produce SAMe with production S-adenosylmethionine (SAMe).A kind of method that in the methionine(Met) biosynthetic pathway, improves product output is to express or express the more methionine adenosyltransferase peptide of high reactivity form (methionine adenosyltransferase peptides) (EC 2.2.1.6) through crossing.One of ordinary skill in the art will appreciate that, when methionine(Met) is required product, need the active or expression of attenuation by the methionine adenosyltransferase peptide (EC 2.2.1.6) of metK coding.

The methionine adenosyltransferase that adopts among the present invention comprises methionine adenosyltransferase peptide (EC 2.2.1.6), and other can be the peptide of SAMe with methionine(Met) catalysis.In addition, one of ordinary skill in the art will appreciate that, but also other reaction of catalysis of some methionine adenosyltransferase peptides also can be accepted other substrate except that methionine(Met) like some methionine adenosyltransferase peptides.Therefore also comprise this non-special methionine adenosyltransferase peptide.The methionine adenosyltransferase peptide sequence is that the public is obtainable.The methionine adenosyltransferase nucleotide sequence is disclosed like GenBank accession number: NC_002516, NC_006958 and NC_000913; GenBank accession number: NP_747070, CAI37180 and NP_600817 disclose the methionine adenosyltransferase peptide sequence.The analytical method of confirming the methionine adenosyltransferase living features of particular peptide is well known in the art.Like, Methods in Enzymology, 94:219-222,1983 analytical methods described can be used for confirming the living features of special peptide.The methionine adenosyltransferase peptide of genes encoding is meant metK in the present invention.

II. will produce the strain gene through engineering approaches to improve the output of methionine(Met)

The output of aspartic acid can adopt any method well known in the art to improve.For example, the output of aspartic acid can adopt several kinds of different modes, is improved the output of aspartic acid by the output of the oxaloacetic acid of cell output through raising.(Gokarn etc., Appl.Microbiol.Biotechnol., 56:188-95,2001; Sanchez etc., Metabolic Eng., 8:209-226,2006).

The output of product also can improve through crossing the range gene of expressing in the L-methionine(Met) biosynthetic pathway.For example, can be with such as metA, metB, metC, metE and metH, and the gene of cysD, cysN, cysC, cysH, cysI, cysJ, cysK and cysM is arranged under the control of various promotors, to improve the amount of the enzyme of being produced.

MetA genes encoding homoserine succinyltransferase, this enzyme are the first kind of enzymes that carries out the methionine(Met) biosynthetic pathway with homoserine, are the check points that methionine(Met) is produced.MetA albumen is temperature sensitivity albumen, has 186 amino-acid residues, and the calculating molecular weight is 35.7kDa.By end product, it is known (Lee etc., J.Biol.Chem.241:5479-5780,1966) that methionine(Met) and S-adenosylmethionine suppress the metA activity.The feedback inhibition of these two kinds of products has synergy, and promptly the methionine(Met) of lower concentration only has slight restraining effect separately, and has strong effect restraining effect after the combination.Therefore, producing bacterial strain can resist the agent metA activity benefited from feedback inhibition.

In methionine production bacterin strain, another kind can attenuation or the gene of removal be metJ.Several expression of gene in the peptide regulation and control methionine(Met) biosynthetic pathway of metJ coding.The metJ encoded protein is connected on the S-adenosylmethionine, and prevents metA, metC and metF gene.

Albumen by the metF genes encoding; 5; 10-MTHFR (methylenetetrahydrofolate reductase) is participated in the synthetic of N (5)-methylene tetrahydrofolate; The latter produces the methyl donor (Sheppard etc., J.Bacteriol.181:718-25,1999) of L-methionine(Met) for homocysteine.US 2002/0049305 discloses can be through improving in the corynebacterium (Corynebacteria) 5, and the expression of 10-MTHFR (metF) improves the production of L-methionine(Met).Therefore, the mikrobe of the through engineering approaches described in the present invention also can be through through engineering approaches to improve the output of metF.

The regulation and control of metK gene also can improve the output of methionine(Met) and SAMe, and in all organisms, S-adenosylmethionine (SAMe) is main methyl donor, participate in polyamines biosynthesizing (polyamine biosynthesis).SAMe also is methionine adenosyltransferase (methionine adenosyltransferase) (MAT or MetK, EC 2.5.1.6).The unique known SAMe biosynthetic pathway of MetK catalysis.Complete tri-polyphosphate chain breaks off from ATP, forms sulfonium (sulfonium) compound.

The formation of SAMe has reduced concentration of methionine, attenuation the activity of the methionine(Met) biosynthetic pathway through the MetA feedback inhibition.Therefore, the functional deficiency of metK or attenuation can improve the production of methionine(Met).

Those having ordinary skill in the art will appreciate that; It is very important that the cell of any preparation methionine(Met) utilizes the efficient of sulphur; Especially in the sulfur assimilation process, utilizing the mikrobe of adenosine phosphate acyl sulfate (phosphoadenylylsulfate (PAPS)), because preparation PAPS need consume 1 mole of ATP as intermediate product.

Vitriol is quite inactive, in order must at first to be translated into more active form by the cell utilization.In intestinal bacteria (E.coli), through the kytoplasm transport system, it absorbs into cell by three cytoplasmic membrane compositions and conjugated protein composition of substrate specificity that is arranged in kytoplasm with vitriol.Three film components of vitriol permeases are by cysT, cysW and cysA (cysA locus) genes encoding.The product of regulation and control cysA locus makes it consistent with other sulphur-assimilation approach, as the part of cys regulon.Activate vitriol through being connected to nucleosides then, to obtain high energy nucleosides phosphinylidyne sulfuric acid through the approach similar with most of organisms.

As shown in Figure 6; Mikrobe; Utilize the approach that vitriol is converted into adenosine-5'-phosphosulfate(APS) (adenylylsulfate (APS)) like intestinal bacteria, it is through utilizing sulfate adenylyl transferase peptide (sulfate adenylyl transferase peptide) (EC 2.7.7.4 is by the cysNcysD coding).APS is converted into PAPS through APS kinases (EC 2.7.1.25 is encoded by cysC) then.This step needs an ATP.PAPS is converted into sulphite through PAPS reductase enzyme (EC 1.8.4.8 is by the cysH coding), and sulphite is converted into sulfide through NADPH-sulfite reductase (EC1.8.1.2 is by the cysIcysJcysG coding) subsequently.Alternative approach adopts APS reductase (EC 1.8.99.2 or 1.8.4.9) that APS is converted into sulphite shown in Fig. 6 right side.Persons of ordinary skill in the art may appreciate that any can the APS reductase that APS is converted into sulphite can use.For example, come from the APS reductase of Bacillus subtilus (Bacillus subtilis, accession number CAA04409) or Pseudomonas aeruginosa (Pseudomonas aeruginosa, accession number NP_250447).

The APS reductase of nucleic acid sequence encoding can be introduced into any mikrobe that is used for producing methionine(Met).For example; The bacterial strain of describing among the present invention; And the bacterial strain of in WO2005/108561 and WO2006138689, describing by Metabolic Explorer; And can benefit from the approach of disclosed omission PAPS among the present invention, thereby in sulfate assimilation, need an ATP molecule less by the bacterial strain that Kumar and Gomes describe in (Biotechnology Advances 23:41-61,2005).

Embodiment

One of multipath that embodiment 1. methionine(Met)s are produced adopts exogenous expression's nucleotide sequence to utilize directed sulfhydrylation.

A. the structure that has the mikrobe of metABC (transsulfuration) and metAZ (directed sulfhydrylation) simultaneously

As previously mentioned, main through changeing the endogenous product that reaction of Salmon-Saxl produces methionine(Met) in the intestinal bacteria.Present embodiment has been described colibacillary through engineering approaches to increase directed sulfhydrylation, has also kept endogenous metAZ approach simultaneously.

Through clone's O-succinyl-sulfhydrylase (O-succinylsulfhydrylase) (EC4.2.99.-) (it is through changing into homocysteine with the O-succinyl homoserine with hydrogen sulfide reaction) increase directed sulfhydrylation.This kind of enzyme is encoded by metZ, and can in some Rhodopseudomonass (Pseudomonas species), find (Vermeij and Kertesz, J Bacteriol.181:5833 – 5837,1999 and Inoue etc., J.Bacteriol.179:3956-3962,1997).

More particularly; Be cloned to the methionine(Met) auxotrophy of bacterial strain TF4076BJF from the metZ of Pseudomonas aeruginosa (Pseudomonas aeruginosa); This bacterial strain is produced bacterial strain TF4076 by Threonine and is produced; (other that have further described among the following embodiment 3 that the disappearance by thrB and metJ forms are modified, and the insertion of metF under the control of pTrc promotor).These auxotrophys have metB genetically deficient, or metB and metC genetically deficient.MetZ from Pseudomonas aeruginosa (Pseudomonas aeruginosa) has strengthened metB and the growth of metBC deletion mutant in minimum medium.As shown in table 1, even methionine(Met) production recovers fully in flask is cultivated, metZ expresses the methionine(Met) production of still having induced in the metBC deletion mutant up to ~ 100mg/L.This shows that metZ is responsible for the production of homocysteine in the cell.

The low yield of the methionine(Met) of the deletion mutant that is transformed by metZ possibly be owing to received the restriction of sulfide in the cellular content (below the method that increases sulfide concentration is provided).Under the existence that is grown in 2mM sodium sulphite of the metBC deletion mutant that transforms by metZ in the M9 substratum enhanced find to have supported this saying.In analyzed in vitro, O-succinyl-sulfhydrylase has protosulphide avidity.Through orthogenesis, might develop into O-succinyl-sulfhydrylase with higher sulfide avidity and more highly active improvement.In the methionine(Met) approach, high reactivity O-succinyl-sulfhydrylase can substitute metB and metC, perhaps can subsidize this approach, increases the carbon flux (carbon flux) of methionine(Met).

Complementary and the methionine(Met) production of the growth of table 1 TF4076BFJ-BC

The promotor of metB and its oneself among the pCL-metB:pCL1920

MetB and metC and their promotor among the pCL-metB-metC:pCL1920

In the pPro-Z:pProLar carrier (ClonTech) from the metZ of Pseudomonas aeruginosa

B. the structure that has the mikrobe of metABC (transsulfuration) and metXZ (directed sulfhydrylation) simultaneously

Present embodiment has shown in intestinal bacteria, carries out methionine(Met) production simultaneously with two kinds of approach.First kind of approach is endogenous metABC approach, and second kind of approach allows through carrying out directed sulfhydrylation from the expression of organic metY of difference and metX.

As shown in Figure 1, intestinal bacteria utilize transsulfuration pathway gene metA, metB and metC and through OSHS, endogenous ground produces methionine(Met).Through adopting clone's and expressing gene metX and metY in intestinal bacteria genetically engineered, to other approach of intestinal bacteria interpolation, it has produced the host's organism for preparing methionine(Met) simultaneously through transsulfuration and directed sulfhydrylation.

Below described from leptospiral bacterium (Leptospira meyeri), radioresistant bacterium (Deinococcus radiodurans), orange green subduing and cloned metX and the metY gene that is used to make up the heterology approach bacterium (Chloroflexus aurantiacus), extension brevibacterium (Brevibacterium linens), beads algae (Nostoc punctiforme) and Pseudomonas aeruginosa (Pseudomonas aeruginosa) DNA, made up several kinds of different bacterial strains and analyzed the influence of adding these gene pairs methionine(Met)s productions.Also clone and detected homocysteine synthase from Corynebacterium glutamicum (Corynebacterium glutamicum) and saccharomyces cerevisiae (Saccharomyces cerevisiae).Proved that these two kinds of approach take place simultaneously, this interpolation has improved methionine(Met) production.

Whether can assist the auxotrophic growth of intestinal bacteria methionine(Met) in order to estimate leptospiral bacterium metX and metY enzyme; Leptospiral bacterium metYX gene flora is enlarged from plasmid metXY-pCR2.0-TOPO, and be cloned in the pPRO-Nde-del carrier.In this plasmid metYX because of transcribe by the lac/ara promotor that is positioned on the carrier and start.

Four kinds of coli strains that comprise W3110 Δ metA (stopping the generation of OSHS), TF4076BJF (increasing homoserine production), TF4076BJF Δ metA (stopping the generation of OSHS) and TF4076BJF Δ metAmetB (stop OSHS and from the generation of the cystathionine of OAHS or OSHS) have been estimated.Bacterial strain TF4076BJF is a Threonine auxotrophy, and for producing methionine(Met), to increase the carbon flux to the homoserine downward modulation, wherein homoserine can produce methionine(Met) through the natural approach of intestinal bacteria.

Bacterial strain can be respectively transformed by cloning vector and the plasmid that contains metYX, then with the transformant streak inoculation to the basic plate culture medium of M9 that contains glucose (2g/L), Isoleucine (0.15g/L), Threonine (0.3g/L), kantlex (50mg/L) and IPTG.In 24 hours, subsidize the growth of W3110 Δ metA from the metYX gene flora of leptospiral bacterium.Only expressing the W3110 Δ metA bacterial strain of metX can not grow on the M9 minimum medium.Therefore, intestinal bacteria W3110 lacks and utilizes the effective enzyme of O-ethanoyl-L-homoserine as precursor biosynthesizing methionine(Met).Described in WO2006113897, bacterial strain W3110 Δ metA is transformed by contrast bare pPRO-Nde-del, not growth within 48 hours.When by cloning vector or when containing plasmid from the metYX of leptospiral bacterium and transforming, bacterial strain TF4076BJF can grow on basic plate culture medium.

Also detected the growth complementation that optional metYX gene is used for minimum medium.From radioresistant bacterium, orange green when subduing bacterium, extension brevibacterium, the beads algae clone metYX gene; Owing to lack the effective intestinal bacteria ribosome bind site (rbs) adjacent with downstream gene metX, the translation of metX gene is carried out with the translation of the metY gene that is started by the rbs that is positioned on the carrier.

Is the most effective from leptospiral bacterium, radioresistant bacterium and orange green metYX gene flora of subduing bacterium for the growth of subsidizing the methionine(Met) auxotrophic strain.It is complementary in methionine(Met) auxotrophy, also to have observed growth, and wherein metY (leptospiral bacterium) is substituted by the metY (Pseudomonas aeruginosa) in the leptospiral bacterium metYX gene flora.These cells have shown the growth rate of the reduction relevant with the identical methionine(Met) auxotrophy of expressing leptospiral bacterium metYX.

The output of utilizing fask oscillating method to measure methionine(Met) has been described among the embodiment 3.In brief, culture was grown 50 hours under 30 ° of C in the substratum that has replenished 150mg/L methionine(Met) (to improve initial growth), adopted HPLC to measure methionine(Met).Table 2 shows with those only has transsulfuration or directed sulfhydrylation to compare, and the output of methionine(Met) is higher in the bacterial strain with two kinds of approach.

Table 2 methionine(Met) output

The synthetic gene metA and the metB of needing of methionine(Met) in coli strain.When arbitrary gene inactivation, intestinal bacteria have just lost the ability of from the beginning producing methionine(Met).Top data show that the interpolation of metYX operon can make methionine(Met) production return to the similar level of methionine(Met) that obtains with methionine(Met) prototroph.When cell obtained two kinds of approach, methionine(Met) output can be more than twice under some situation.These results have proved that two kinds of approach are not mutually exclusive, and homoserine can change into methionine(Met) through these two kinds of approach.

In order further to prove the benefit of this pair of approach, described the employing fermentation method among the embodiment 3 and in the 5L fermentor tank, various bacterial strains have been compared.After about 24 hours, methionine(Met) begins accumulation, and lasts till and stop charging.By from the enzyme of most of organic metY genes encodings by the methionine(Met) feedback inhibition of high density.In some cases, by the enzyme of metX genes encoding also by feedback inhibition.The result has observed the obvious accumulation of homoserine and OAHS in these fermentations.The contrast that methionine(Met) is produced in the fermentor tank is as shown in Figure 2, and data are summarized in the table 3.These results have confirmed being seen observation in flask, through the suitable expression of the directed sulfhydrylation approach of heterology, can significantly improve the output of methionine(Met); If enzyme is by suitable expression, this approach can be responsible for most of methionine(Met) productions.

The heterology of the directed sulfhydrylation approach of table 3 is expressed

In order to increase the product amount that is converted into methionine(Met), can use feedback inhibition opposing agent metY and metX.The expression of expression level and metH that can also regulate metX is so that homoserine is converted into methionine(Met) faster.

The difference of methionine(Met) production shows that the metXY approach is more effective in intestinal bacteria, in such as this downward modulation bacterial strain, adds the metXY approach, can cause the accumulation more than the methionine(Met) of twice.

Embodiment 2. utilizes the homocysteine synthase of O-ethanoyl-L-homoserine (OAHS) or O-succinyl-L-homoserine (OSHS)

Present embodiment has been described the method that is used for separating the homocysteine synthase of being encoded by the metY from Pseudomonas aeruginosa (ATCC 47085).This kind of enzyme can be by L-methionine(Met) and S-adenosine-the two inhibition of L-methionine(Met).According to Yamagata, Methods in Enzymology, 143:478,1987 enzyme analysises are active.This method is changed slightly, adopted a plurality of sample points, use guanidine to come termination reaction, when analyzing metA, adopt DTNB (5, two (2-nitrobenzoic acid) SigmaD8130 of 5-two sulphur) to detect the generation of homocysteine, see the description among the embodiment 3.B.A unit of enzyme (U) is defined as the generation of PM one micromole's homocysteine under the room temperature.

Adopt 17.5 μ g pure protein (the N-mark) expression and analyze MetY from Pseudomonas aeruginosa.With respect to metY and other disclosed homocysteine synthase of great majority from the leptospiral bacterium, this kind of enzyme all has activity under acetylhomoserine and succinyl homoserine.To these two kinds of substrates, enzyme active similar, it is by methionine(Met) and SAMe feedback inhibition, the situation when the feedback inhibition level seem is lower than OSHS as substrate.Some inhibition under the 1mM methionine(Met), have been observed.OAHS is during as substrate, 10,50 and 100mM under the enzymic activity that contains be about for 50%, 19% and 9% when not having methionine(Met) respectively.When 5 with 10mM SAMe when existing, its activity is about 72% and 21% of initial activity.As OSHS during as substrate, when 50 existed with the 100mM methionine(Met), its activity dropped to 53% and 31%, and 5 and 10mM SAMe when existing, its activity drops to 86% and 19%.

Embodiment 3. heredity make up host strain to increase the method for methionine(Met) output

Except adding the methionine(Met) biosynthetic pathway to host's organism like what describe among the embodiment 1; Can also further suppress the methionine(Met) biosynthetic pathway, increase the utilization ratio of reactant and/or the katabolism of minimizing product through host's organism heredity structure is reduced.

A. the deactivation of general repressor of methionine(Met) and threonine kinase, together with strengthening 5, the expression of 10-MTHFR increases methionine(Met) production.

A kind of method of preparation methionine production bacterin strain is to modify to make up in order to produce amino acid, like the bacterial strain of Threonine.For example, can use the Threonine of describing among the Korean Patent Publication No. No.92-8365 (KFCC 10718) to produce bacterial strain TF 4076, even it is a methionine(Met) auxotrophy.Other example bacterial strain comprises the bacterial strain of in ATCC (13070,13071,21148,21149,21150,21151,21272,21277,21278,21318,21319,21320), listing that is described to the Threonine overproducer.

Adopt bacterial strain TF 4076 as starting point,, improve methionine(Met) output through making thrB genetically deficient to avoid Threonine production and metJ genetically deficient is prevented with the expression that discharges the methionine(Met) biosynthetic pathway.Can also modify bacterial strain to cross expression metF gene.

The thrB disappearance

Adopt loxP-paraxin (loxP-Cm) box (Gene 2000 vol.247, p255 – 264) to make the thrB disappearance.Adopt primer sequence 1 and 2 (SEQ ID NOS:5 and 6), the karyomit(e) of e. coli k12 as template, is cloned the thrB gene through PCR.The PCR condition be 94 ℃ 30 seconds; Then 94 ℃ 30 seconds the circulation 25 times, 55 ℃ 30 seconds, 72 ℃ 3 minutes; 72 ℃ 7 minutes, adopt HL PCR Premix (Bioneer Co, Korea S).With gel wash-out PCR product, and be cloned into pCR2.1-topo clone test kit (Invitrogen, USA), called after pCR-thrB.Adopt pflMI digestion pCR-thrB, and insert the loxP-Cm box.From plasmid, adopt primer 1 and 2 (SEQ ID NOS:11 and 12) to contain the thrB gene of loxP-Cm box through pcr amplification.The PCR product is through gel-purified.The PCR fragment gets into the TF4076 bacterial strain through electroporation, selects the chlorampenicol resistant bacterium colony and confirms the thrB disappearance.From the bacterium colony of identifying, remove the paraxin mark, with the bacterial strain called after TF4076B that finally obtains.When not containing Threonine, this bacterial strain is not grown in M9 minimum medium (DIFCO), and this shows that this bacterial strain is a Threonine auxotrophy.

1.thrB SEQ?ID?NO:11

5′-GCT?AGC?c?atg?gtt?aaa?gtt?tat?gcc?ccg?-3′

2.thrB SEQ?ID?NO:12

5′-GAG?CTC?tta?gtt?ttc?cag?tac?tcg?tgc?gc-3′

The metJ disappearance

Adopt FRT one step deletion method to make the general repressor metJ of methionine(Met) genetically deficient (Datsenko and Wanner PNAS 97:6640-6645,2000).Adopt primer sequence 3,4 (SEQ ID NOS:13 and 14) and template pKD3 amplification PCR fragment (seeing Datsenko and Wanner, PNAS 97:6640-6645,2000).The PCR condition be 94 ℃ 30 seconds; Then 94 ℃ 30 seconds the circulation 25 times, 55 ℃ 30 seconds, 72 ℃ 1 minute; 72 ℃ 7 minutes, adopt HL PCR Premix (Bioneer Co, Korea S).Select the chlorampenicol resistant bacterium colony, adopt PCR primer sequence 5 and 6 (SEQ ID NOS:15 and 16) to confirm metJ genetically deficient.Adopt the pCP20 plasmid to transform, remove the paraxin marker gene, adopt PCR to confirm to remove.With the bacterial strain called after TF4076BJ that obtains.

3.metJ+ paraxin SEQ ID NO:13

5’-atggctgaat?ggagcggcga?atatatcagc?ccatacgctg?agcacggcaaggtgtaggct?ggagctgctt?c-3’

4.metJ+ paraxin SEQ ID NO:14

5’-gtattcccac?gtctccgggt?taatccccat?ctcacgcatg?atctccatatgaatatcctc?cttag-3’

5.metJ?SEQ?ID?NO:15

5’-gggctttgtc?ggtgaaatg-3’

6.metJ?SEQ?ID?NO:16

5’-actttgcgat?gagcgagag-3’

MetF integrates

In order to subsidize the methionine(Met) auxotrophy of TF4076BJ, express the metF gene with bacterial strain TF4076BJ.Adopt primer sequence 7 and 8 (SEQ ID NOS:17 and 18) the metF gene that increases, with the karyomit(e) of e. coli k12 strain as template.The PCR condition be 94 ℃ 30 seconds, then 94 ℃ of circulations in 30 seconds 25 times, 55 ℃ 30 seconds, 72 ℃ 1 minute, 72 ℃ 7 minutes, adopt HL PCR Premix (Bioneer Co, Korea S).With gel wash-out PCR fragment, be inserted into NheI and SacI site in the pSE380 carrier (Invitrogen Co.).With plasmid called after pSE380-metF.PSE380-metF is converted into the TF4076BJ bacterial strain.Transformant is grown in containing the M9 minimum medium (Difco) of Threonine and Isoleucine, shows subsidy methionine(Met) auxotrophy.

Measured metF expression of gene level under the control of two kinds of different promoters.These two kinds of promotors are pCJ1 promotor (PCT/KR2005/004338) and p Threonine promotor.Adopt primer sequence 9 and 10 (SEQ ID NOS:19 and 20) the metF gene that increases, with the karyomit(e) of e. coli k12 strain as template.The PCR condition be 94 ℃ 30 seconds, then 94 ℃ of circulations in 30 seconds 25 times, 55 ℃ 30 seconds, 72 ℃ 1 minute, 72 ℃ 7 minutes, adopt HL PCRPremix (Bioneer Co, Korea S).With gel wash-out PCR fragment, and be connected to the PvuII and the HindIII site of the pCL1920 carrier (Lerner and Inouye, Nucleic acids Research 18:4631,1990) that contains pCJ1 promotor or p Threonine promotor.Adopt primer sequence 11 and 12 (SEQ ID NOS:21 and 22) that the pCJ1 promotor is carried out pcr amplification, adopt primer sequence 13 and 14 (SEQ ID NOS:23 and 24) from e. coli k12 chromosome amplification p Threonine promotor.With gel wash-out PCR fragment, and be integrated into the KpnI and the EcoRV site of pCL1920 carrier.The PCR condition is the same.The plasmid that contains the metF gene under the control of pCJ1 promotor is named as pCL-pCJ1-metF, and the plasmid that under the control of p Threonine promotor, contains the metF gene is named as pCL-pThr-metF.Each plasmid all is converted into the TF4076BJ bacterial strain, measures methionine(Met) output.

The shaking culture that is used to detect bacterial strain is following: by 10g yeast extract, 6gNa ₂HPO ₄12H ₂O, 0.5g NaCl, 3g KH ₂PO ₄, 2g glucose, 0.49gMgSO ₄7H ₂O and 0.015g CaCl ₂2H ₂In the substratum (1L) that O forms, inoculum was hatched 6 hours at 31 ℃.Use following substratum (1L) flasks then: 17g (NH ₄) ₂SO ₄, 1g MgSO ₄7H ₂O, 2g yeast extract, 0.3g L-Threonine, 10mgMnSO ₄7H ₂O, 10mg FeSO ₄7H ₂O, 10mg ZnSO ₄, 30g CaCO ₃, 40g glucose and 2g KH ₂PO ₄PH 7.2.Flask was hatched 64 to 72 hours with the 250rpm jolting at 31 ℃.After centrifugal, separation and Culture thing supernatant is used for the methionine(Met) analysis.

For the cell cultures that contains the pSE380-metF plasmid, in substratum, add 100 μ g/L Ampicillin Trihydrates and 0.5mM IPTG.As shown in table 4, the methionine(Met) that the metF gene under the control of pCJ1 promotor produces is maximum.

Table 4 contains methionine(Met) output in the cell of different metF expression cassettes

For more stable expression metF gene, with the metF gene integration under pTrc, pCJ1 and the p Threonine promotor to the chromosomal lacZ locus of TF4076BJ.Each metF gene all from plasmid separately through pcr amplification and be inserted into the NsiI site (Borgne et al., Gene 223:213-219,1998) of pBrint carrier.Carrier is transformed in the TF4076BJ bacterial strain, and the transformant of in containing the substratum of paraxin, growing under selecting 37 ℃ is used for confirming that the metF gene integration is to chromosomal LacZ locus.The bacterium colony of selecting is transformed by pJW168, removes the paraxin mark.Can not obtain to contain the cell of pCJ1-metF gene, the transformant that contains the pThr-metF box is also grown not good.Cell growth fine that only contains the pTrc-metF gene at the LacZ locus.When having 0.5mM IPTG in the substratum, the flask of this bacterial strain is cultivated the output that shows methionine(Met) and is ~ 600mg/L.The final bacterial strain that contains the pTrc-metF gene is named as TF4076BJF, and is further analyzed.

In a word, by the Threonine that the produces bacterial strain TF 4076 TF4076BJF bacterial strain of deriving, wherein through the disappearance of thrB and metJ and under the control of pTrc promotor the insertion of metF bacterial strain TF 4076 is modified.Table 5 illustrates by the homoserine of TF4076BJF generation and the output of methionine(Met).

The methionine(Met) output of table 5 bacterial strain TF4076BJF

7.metF?SEQ?ID?NO:17

5′-GCT?AGC?c?atgagcttttttcacgccag?-3′

8.metF?SEQ?ID?NO:18

5′-GAG?CTC?ttataaaccaggtcgaaccc-3′

9.metF?SEQ?ID?NO:19

5′-CAGCTGatgagcttttttcacgccag-3′

10.metF SEQ?ID?NO:20

5′-AAGCTT?ttataaaccaggtcgaaccc-3′

11.CJ1 promotor SEQ ID NO:21

5′-cgg?ggt?acc?acc?gcg?ggc?tta?ttc?cat?tac?at-3′

12.CJ1 promotor SEQ ID NO:22

5′-acg?cga?tat?ctt?aat?ctc?cta?gat?tgg?gtt?tc-3′

13. Threonine promotor SEQ ID NO:23

5′-cgg?ggt?acc?tgg?tta?caa?caa?cgc?ctg?g-3′

14. Threonine promotor SEQ ID NO:24

5′-cat?gat?atc?tac?ctcg?tta?cc?ttt?ggt?cg-3′

According to following method bacterial strain TF4076BJF is grown in the 5L fermentor tank, the methionine(Met) output that in 96 hours, obtains is approximately 2.2g/L.

Carry out the 5L fermentation according to the methods below.Be cloned in the effect in the coli strain in order to compare different genes, adopt the basic fermentation method of 5L jar.Inoculum is grown in the 25mL substratum, and this substratum is by 10.0g yeast extract, 4.49g Na ₂HPO ₄7H ₂O, 0.5gNaCl, 3.0g KH ₂PO ₄, 0.49g MgSO ₄7H ₂O, 0.015g CaCl ₂2H ₂O and 2g/L glucose are made into the 1L volume and make.Use the suitable microbiotic of 50mg/L according to the resistance of bacterial strain to be measured.31 ℃ with after the 250rpm jolting hatches 8-24 hour, culture is transferred in the identical substratum of 200mL, hatched under the same conditions 16 to 20 hours.This culture is used to inoculate the fermentor tank that contains the 2.5L substratum.

Consisting of of fermention medium: 17.0g/L (NH ₄) ₂SO ₄, 2.0g/L yeast extract, 2.0g/L KH ₂PO ₄, 1.0g/L L-Threonine, 0.3g/L Isoleucine, 0.01g/LMnSO ₄-H ₂O, 0.01g/L FeSO ₄-7H ₂O, 0.01g/L ZnSO ₄-7H ₂O, 1.0g/LMgSO ₄-7H ₂O, 2mg/L pyridoxal, 2mg/L cobalamin and 40g/L glucose.Add microbiotic and IPTG according to the bacterial strain that will grow.Leavening temperature maintains 31 ℃, and saturation dissolved oxygen is used 28% NH greater than 30% ₄The pH that OH control is initial.After glucose exhausts, pH will raise.At that constantly, the charging of 100-150mL is perhaps added in the charging of beginning continous-stable at certain hour according to the pH that raises.Charging is by 4.0g/L yeast extract, 33g/L (NH ₄) ₂SO ₄, 3.0g/L KH ₂PO ₄, 1.5g/L L-Threonine, 1.0g/LMgSO ₄-7H ₂O, 2mg/L cobalamin and 400g/L glucose are formed.Can carry out some small changes to substratum and charging according to bacterial strain.Fermenting process amounts to 72 to 96 hours.Measure the omnidistance concentration and the cell growth of methionine(Met) through optical density(OD) and glucose utilization rate.

B. be used for the generation of the homoserine sulfhydrylation feedback resistance of methionine(Met) production

Structure has lacked the coli strain of metA and metB gene.This bacterial strain is owing to the MetA loss of activity shows the accumulation homoserine.When wild-type metA box (metA cassette) is expressed in this bacterial strain, lacking under the situation of methionine(Met) by the active OSHS of generation of MetA.Yet when adding to methionine(Met) in the substratum, the bacterial strain that contains the wt-metA box is accumulated homoserine once more owing to the active feedback inhibition of MetA.Therefore, in the presence of methionine(Met), can differentiate feedback opposing agent metA gene through the accumulation that detects the O-succinyl homoserine.When in substratum, having a large amount of methionine(Met), it is maximum to produce the feedback inhibition opposing agent metA that contains in the two mutants of more OSHS.

The synoptic diagram of screening method is seen Fig. 3.

The structure of metB deletion mutant

Adopt FRT one step deletion method (Datsanko and Wanner, PNAS 97:6640-6645,2000) in TF4076BJF, to prepare the metB deletion mutant.Adopt primer sequence 15 and 16 (SEQ ID NOS:25 and 26) that the PCR fragment is increased, with template pKD3 electroporation in the TF4073BJF cell.The PCR condition be 94 ℃ 30 seconds, 94 ℃ of circulations in 30 seconds 25 times, 55 ℃ 30 seconds, 72 ℃ 1 minute, then 72 ℃ 7 minutes, adopt HL PCR Premix (Korea S, Bioneer Co).Select the chlorampenicol resistant bacterium colony, and adopt PCR to confirm metB genetically deficient.Adopt the pCP20 plasmid to transform and remove the paraxin marker gene, confirm to remove through PCR.With the bacterial strain called after TF4076BJF-B that this step obtained.

15.metB+ paraxin SEQ ID NO:25

5’-TTACTCTGGT GCCTGACATT?TCACCGACA

AAGCCCAGGGAACTTCATCA?Cgtgtaggct?ggagctgctt?c-3’

16.metB+ paraxin SEQ ID NO:26

5’-TTACCCCTTG?TTTGCAGCCC?GGAAGCCATT

TTCCAGGTCGGCAATTAAA?Tcatatgaat?atcctcctta?g-3’

The structure of metA deletion mutant

Adopt FRT one step deletion method (PNAS.97:6640-6645,2000) in TF4076BJF-B, to prepare the metA deletion mutant.Adopt primer sequence 17 and 18 (SEQ ID NOS:27 and 28) that the PCR fragment is increased, with template pKD3 electroporation in the TF4073BJF-B cell.The PCR condition be 94 ℃ 30 seconds, 94 ℃ of circulations in 30 seconds 25 times, 55 ℃ 30 seconds, 72 ℃ 1 minute, then 72 ℃ 7 minutes, adopt HL PCR Premix (Korea S, Bioneer Co).Select the chlorampenicol resistant bacterium colony, and adopt PCR to confirm metA genetically deficient.Adopt the pCP20 plasmid to transform and remove the paraxin marker gene, confirm to remove through PCR.With the bacterial strain called after TF4076BJF-BA that this step obtained.

17.metA+ paraxin SEQ ID NO:27

5’-CAATTTCTTGCGTGAAGAAAACGTCTTTGTGATGACAACTTCTCGTGCGTgtgtaggctggagctgcttcc-3’

18.metA+ paraxin SEQ ID NO:28

5’-AATCCAGCGTTGGATTCATGTGCCGTAGATCGTATGGCGTGATCTGGTAGcatatgaatatcctccttag-3’

The structure of metA expression vector

In order to make the metA gene pool, made up the metA expression vector.Adopt primer sequence 19 and 20 (SEQ ID NOS:29 and 30) that the metA gene is increased, will be from the karyomit(e) of e. coli k12 strain as template.The PCR condition be 94 ℃ 30 seconds, 94 ℃ of circulations in 30 seconds 25 times, 55 ℃ 30 seconds, 72 ℃ 1 minute, then 72 ℃ 7 minutes, adopt HL PCRPremix (Korea S, Bioneer Co).With gel wash-out PCR fragment, and be connected to the SmaI site of pCL1920.With plasmid called after pA-CL.The pA-CL plasmid is transferred in the TF4076BJF-AB bacterial strain, and under the situation that contains and do not contain methionine(Met), carried out flask and cultivate.Adopt the method identical to measure OSHS and homoserine with above-mentioned measurement methionine(Met).As shown in table 6, when not having methionine(Met), the cell that contains the pA-CL plasmid produces 3.8g/LOSHS and 0.24g/L homoserine.Yet when having the 1g/L methionine(Met), cell produces 5.8g/L OSHS and 4.9g/L homoserine.The increase of OSHS amount is owing to added methionine(Met), has promoted growth, and the increase of homoserine is since methionine(Met) to the active feedback inhibition of metA.

Table 6 contains the output of O-succinyl homoserine and homoserine in the TF4076BJF-AB bacterial strain of pA-CL plasmid

19:metA SEQ?ID?NO:29

5’-aatggatccTGCCGTGAGCGGCGAATAC-3’

20:metA SEQ?ID?NO:30

5’-agctctagaCTGCTGAGGTACGTTTCGG-3’

The structure in pA-CL mutant gene storehouse

Adopt error-prone PCR (error-prone PCR) to make pA-CL mutant gene storehouse.As template, adopt primer sequence 21 and 22 (SEQ ID NOS:31 and 32) to carry out error-prone PCR the pA-CL plasmid.The PCR condition be 94 ℃ 30 seconds, 94 ℃ of circulations in 30 seconds 25 times, 55 ℃ 30 seconds, 68 ° of C 2 minutes, then 72 ℃ 7 minutes, adopt BD change the PCR mutagenesis kit (BD, USA).The PCR fragment is digested by BamHI and XbaI, and is connected to pCL1920.Gene pool is transferred among the bacterial strain TF4076BJF-AB, and collection ~ 30,000 transformant is used for further analysis.

21:pCL1920 SEQ?ID?NO:31

5’-CGAAGTAATCGCAACATCCG-3’

22:pCL1920 SEQ?ID?NO:32

5’-GTCTGCTATGTGGTGCTATC-3’

The preparation of MetB enzyme crude extract

In order to measure OSHS, adopted from colibacillary MetB enzyme through enzyme process.MetB enzyme and OSHS and halfcystine generate cystathionine with the ratio reaction of 1:1.The free SH radical reaction of DTNB (5, two (2-nitrobenzoic acid) the Sigma D8130 of 5-two sulphur) reagent and halfcystine forms yellow, and it can detect at the 415nm place.Before the MetB reaction, halfcystine and DTNB reaction become yellow.After MetB reaction, halfcystine change into can not with DTNB bonded cystathionine.Reaction along with the minimizing of the OD of 415nm place, can record the amount of OSHS in the reaction mixture after taking place.

For cross expressing of MetB enzyme, being digested by BamHI and HindIII of pcr amplification from the chromosomal metB gene of e. coli k12, and be cloned in the pCDF-Duet carrier (Novagene, USA).As template, adopt primer sequence 23 and 24 (SEQ ID NOS:33 and 34) to carry out the PCR reaction e. coli k12 karyomit(e).The PCR condition be 94 ℃ 30 seconds, 94 ℃ of circulations in 30 seconds 25 times, 55 ℃ 30 seconds, 72 ℃ 1 minute, then 72 ℃ 7 minutes, adopt HL PCR Premix (Bioneer, Korea S).Use the plasmid that the Tuner cell will contain the metB gene to transfer in the intestinal bacteria, transformant is overnight growth in the LB substratum that contains 50 μ g/mL spectinomycins (spectinomycin).With the LB substratum dilution incubated overnight broth culture that contains 50 μ g/mL spectinomycins, hatch up to OD reaches 0.6 at 600nm place at 37 ℃, adding IPTG at this moment is 0.2mM to ultimate density, culture was hatched 4 hours at 30 ℃.Through 12, the 000rpm centrifugal cell harvesting, (pH 7.5) are resuspended in 0.1M potassium hydrogenphosphate damping fluid, make its fracture through sonication (5x30 second).With 12,000rpm obtained cell crude extract in centrifugal 20 minutes, then supernatant was used for the enzyme analysis.

23:metB?SEQ?ID?NO:33

5’-gccaggatccgATGACGCGTAAACAGGCCAC-3’

24:metB SEQ?ID?NO:34

5’-ccgcaagcttTTTACCCCTTGTTTGCAGCC-3’

The examination of feedback inhibition agent metA

TF4076BJF-AB inoculation through will containing the pA-CL two mutants was cultivated 48 hours 31 ℃ of joltings in 96 orifice plates that contain little fermention medium, differentiated feedback inhibition agent metA sudden change.Little fermention medium is 1 volume shake-flask culture base of describing among the embodiment 3 and the 1 volume 0.05M potassium hydrogenphosphate pH of buffer 6.5 that contains the 5g/LL-methionine(Met).

Then with 96 orifice plates 3, centrifugal 10 minutes of 000rpm adopts above-mentioned (preparation of MetB crude extract) enzyme process in supernatant, to measure OSHS.The supernatant of 50 μ L cultures is mixed (reaction buffer: 0.1M potassium hydrogenphosphate damping fluid (pH 7.5)+2.5mM halfcystine+1/500 10mM PLP (pyridoxal 5 '-aqueous phosphate compound, SigmaP9255)+1/100 MetB crude extract (5mg/mL)) with 50 μ L reaction buffers.Being reflected at 37 ℃ hatched 10 minutes.Add 100 μ L DTNB (4mg/10mL 0.1M potassium hydrogenphosphate damping fluid, pH 7.5), obtain the OD at 415nm place.From each 96 orifice plate, be chosen in 1 or 2 bacterium colony that 415nm shows minimum absorption, they are lined on the LB substratum that contains 50 μ g/mL spectinomycins.The colony inoculation that obtains is contained to another on 96 orifice plates of little fermention medium, carry out second and take turns examination.Then the bacterial strain of selecting is detected under above-mentioned shake-flask culture condition, in substratum, add the 5g/L methionine(Met), measure the output of O-succinyl homoserine.

In 12,000 bacterium colonies, select 24 two mutants to be used for shake-flask culture, selected 14 two mutants to be used for examination.Therefrom identify 5 new two mutants.All the other have the existing report of 9 two mutants of identical sudden change.The semi-invariant of 14 two mutants O-SHS and homoserine is as shown in table 7 in the shake-flask culture, and the amino acid whose variation in the metA sequence of selected two mutants is as shown in table 8.

The selected two mutants of table 7 shake a bottle performance

The sequential analysis of the selected two mutants of table 8

The feedback resistance of two mutants metA

Because when in shake-flask culture, having the 5g/L methionine(Met), all feedback inhibition opposing agent metAs all can produce the OSHS of analog quantity, so the methionine(Met) of greater concn is added in the shake-flask culture base, measure the output of OSHS.After cultivating 64 hours with 30g/L L-methionine(Met), the output of OSHS only descends in #37 two mutants sample, similar OSHS yield level when other samples all show and exist with the 5g/L methionine(Met).These results that appear in the table 9 show that feedback inhibition opposing agent metAs has resistance to the concentration of methionine up to 30g/L.

The OSHS output of two mutants metAs when table 9 30g/L methionine(Met) exists

The proteinic vitro characteristics of two mutants metA

Adopt pcr amplification, will differentiate then to five metA mutant genes of pCL-A#10, pCL-A#11, pCL-A#32, pCL-A#37 and pCL-A#41 and be cloned in the pET30a carrier.All constructs are passed through dna sequence analysis to confirm existing of two mutants.Be used for enzyme purification with the terminal His label of C-clone gene.Like Lawrence, J.Bacteriol., 109:8-11 describes in 1972., and enzyme is crossed expressions, purifying, mensuration activity in the presence of different levels methionine(Met) and SAMe.This is analyzed only change is to have adopted a plurality of sample points, and comes termination reaction with guanidine.Table 10 has been summarized the activity from different mutants, and clearly shows that when with wild-type enzyme relatively the time, all two mutants are feedback inhibition opposing agent, and two mutants #10 all has maximum resistance with #11 to methionine(Met) and SAM inhibition.

The characteristic of table 10 two mutants and wild-type MetA enzyme

* wherein U is that PM forms 1 micromole CoA under the room temperature

Select two mutants metA#10 and metA#11 (being respectively SEQ ID NOS:5 and 7) to be used for further analysis.Adopt the 300mM methionine(Met) that the inhibition shortage of metA two mutants #10 and #11 is analyzed in the experiment.Concentration of methionine is near the analysis condition maximum concentration that can reach.The solubleness of methionine(Met) in water is 5.6g/100mL under 30 ° of C, is equivalent to the concentration of 375mM.In the presence of the 300mM methionine(Met), two mutants metA#10 has kept 70% of its specific activity, and two mutants metA#11 has kept 55% of its specific activity.Therefore, metA#10 and #11 two mutants can be used in and produce mikrobe in the methionine(Met).

Contain the methionine(Met) production of feedback inhibition opposing agent metA

MetA#10 and metA#11 are cloned among the methionine(Met) generation bacterial strain TF4076BJF individually.MetA#10 is also cloned with the metYX from the leptospiral bacterium.Fermentation method according to describing among the embodiment 3A detects the clone.Ferment and after 78 hours methionine(Met) concentration is assessed, the result sees table 11.In any fermentation, all there is not the accumulation of O-succinyl homoserine.The time course that methionine(Met) is produced is as shown in Figure 4.

Table 11 methionine(Met) semi-invariant

Bacterial strain	Final methionine(Met) titre (g/L)
		TF4076BJF	2.1
TF4076BJF?metA#10	6.3
		TF4076BJF?metA#11	4.5
TF4076BJF?metA#10+metYX(Lm)	6.6

These results show that the expression of feedback inhibition opposing agent metAs can improve methionine(Met) output, binding ratio observed synergy that has still less in natural MetA of directed sulfhydrylation approach and feedback inhibition opposing agent metABC approach.Observed synergy still less shows that the accumulation of methionine(Met) can suppress MetY.In order further to improve methionine(Met) output, can use feedback inhibition opposing agent MetY.

C. the active strategy of MetK in the attenuation intestinal bacteria

As previously mentioned, the formation of SAMe has reduced concentration of methionine, and has reduced the activity through the methionine(Met) biosynthetic pathway of metA feedback inhibition.

Some methionine(Met)s-opposing agent two mutants has to reduce the metK level and cross the observations of producing methionine(Met) makes that the separation of two mutants is easy in the metK gene.Table 12 has been listed and has been described to cause the active different metK sudden changes that reduce of MetK.Make up these two mutants as follows.

The clone is from the metK gene of intestinal bacteria (accession number AP_003499 or BAE77005), and in the pET28b carrier, crosses expression with N-end or the terminal His label of C-.Adopt the metK clone of the terminal His mark of C-to carry out site-directed mutagenesis, to produce required two mutants.Confirm the proteic expression of two mutants MetK.

Purifying MetK two mutants (adopting the terminal His label of C-), and carry out analyzed in vitro.With the MetK albumen of the terminal His mark of wild-type C-as contrast.Adopt radioanalysis that two mutants is analyzed.Analysis condition is following:

Analysis of mixtures:

1.0mL?0.5M?HEPES/KOH，pH?8.0

0.5mL?1.0M?KCl

0.2mL?1.0M?MgCl ₂

1.0mL 100mM ATP (disodium salt, using KOH is 8.0 with pH regulator)

0.1mL 50mM methionine(Met)

0.1mL NEN [methyl- ¹⁴C] methionine(Met)

6.6mL?H ₂O

Come termination analysis with 25mM EDTA pH 8.0.

45 μ l analysis of mixtures and 5 μ L enzymes are joined in the Eppendorf pipe (standardized data is seen table 13).To react the required time (1 to 10 minute) of (or 25 ℃) cultivation at room temperature.Adding 150 μ L 25mM EDTA stops reaction.100 μ L reaction solutions are added on the Whatman P-81 phosphorylated cotton circular filter paper sheet that diameter is 2.5cm (using the pencil mark).With 3L distilled water wash filter paper, the gas dry doubling places the scintillation vial of aqueous sol.Use from ¹⁴C extends to about 0 window enumeration emission measure.Through adding the pure of known count number ¹⁴C-SAM and computing in whole procedure, determination and analysis efficient with stop level.Background is general<(according to reaction, the grand total calculated value is 10 to 100cpm ⁵Cpm).

Table 12 normalized activity

* WT reference substance MetK albumen also is with the terminal His mark of C-, is used for comparing with the two mutants metK albumen of mark.When comparing with unlabelled MetK protein-active, the WT MetK protein-active of observing mark has approximately reduced by 6 times.

The activity in * 5 minute reaction times of report

The product S AMe of MetK reaction is the noncompetitive inhibitor of MetK.Therefore, the analysis of reaction kinetics is very complicated, and people expect that wild-type and the active difference of mutant are higher.Through understanding the activity of different mutants MetK enzyme, can define suitable product host.

The D.SAMe translocator is regulated

The S-adenosine Met (SAMe) that in all organisms, all can be used as elementary methyl group donor is used for the polyamines biosynthesizing, is the key of cell growth.(MetK, EC2.5.1.6) the only known SAMe biosynthetic pathway of catalysis in intestinal bacteria is because this organism can not absorb SAMe to the S-adenosyl transferase from growth medium.The optional method of reducing metK as stated provides the intestinal bacteria that have the active of picked-up SAMe and can knock out the metK gene simultaneously, to reduce or to avoid using methionine(Met) through the sort of approach.Can control the cell growth through in fermention medium, adding SAMe then.

Identified Rickettsiae high-affinity SAMe movement system (Rickettsia high-affinity SAMe transport system, Tucker etc., J.Bact.185:3031-3035,2003).The KT value of this SAMe translocator is 2-8 μ M, has comparability with value from the translocator of saccharomyces cerevisiae (3.3 μ M), carnitine (4.5 μ M) and rat liver (8.9 μ M).Reported that in addition Rickettsiae translocator system can subsidize intestinal bacteria metK deletion mutant (Driskell etc., J.Bact.187:5719-5722,2005).

Bacterial strain W3110 and TF4076BJF are transformed by the plasmid that contains the above-mentioned SAM translocator of mentioning.Will be from the metK gene knockout of W3110, and confirm through PCR.Modify according to these, the new bacterial strain of only when SAM exists, growing, but when not having SAM, the new bacterial strain of can not growing.Yet, existing and do not exist under the situation of exogenous SAM, it can both continued growth.

E. in fermention medium, knock out methionine(Met) picked-up translocator to increase methionine(Met)

In intestinal bacteria, identify two L-methionine tRNA albumen, one has very high avidity (Km=0.1-0.13 μ M), and second has lower avidity (Km=20-40 μ M).The locus of high-affinity translocator system is defined as metD, because the metD two mutants can not deliver the D-methionine(Met) and utilize it as methionine source.The metD locus is corresponding with abc (metN), yaeE (metI) and yaeC (metQ) gene, and these genes encodings absorb necessary abc transport albumen to L-methionine(Met) and D-methionine(Met).The ATP enzyme that the metN coding is inferred, the proteic film of metI coding metD abc transport-leap district.People expect the 3rd component metQ coding substrate-binding zone.Because when the L-methionine(Met) exists, metI, metN and metQ deletion mutant can also be grown, and this is considered to the circumstantial evidence that low-affinity metP system exists.

As shown in Figure 5, metD input D-and L-methionine(Met), and the translocator metP that does not have characteristic on the genetics only imports the L-methionine(Met).MetD represents typical A BC translocator, and it has three components: the A, E and the C that represent abc (ATP enzyme), yaeE (permeases), yaeC (D-methionine(Met)-conjugated protein) respectively.(Merlin etc., J.Bacteriol.184:5513-5517,2002).

The negative control of the operon of general methionine(Met) repressor albumen metJ code displaying metD locus is expressed.Depriving of methionine(Met) makes metJ assist repressor: the metD gene transcription increases.In cell, be accompanied by metJ disappearance, translocator is by higher expression, and can not prevented (Merlin etc., J.Bacteriol.184:5513-5517,2002) by methionine(Met).Usually, the disappearance of methionine production bacterin strain meeting attenuation metJ sequence or metJ is with increase output, so this is even more important to reducing methionine(Met) input activity.Can modify these bacterial strains through knocking out the methionine(Met) capturing system.The unhelpful circulation of picked-up/excretory that this will stop the methionine(Met) picked-up and avoided potential waste energy.

Knock out metD and can cause the cumulative rises 25% of methionine(Met) in the fermenting broth, the result measured with the fask oscillating method of describing in the foregoing description 3 is consistent.

Crossing of F.metH expressed

Described herein because bacterial strain is modified, through the increase of the carbon flux due to the methionine(Met) approach, can cause homocysteine in intracellular accumulation.The toxicity of homocysteine pair cell is very big.For fear of accumulation, and make homocysteine change into methionine(Met), have extremely important by metE and homocysteine methyl enzymic activity (EC2.1.1.13 and 2.1.1.14) the metH coding, very active respectively.A kind of approach that reaches this purpose be exactly through under the control of strong promoter in pUC pUC or place the karyomit(e) copy and came to express these genes.

In bacterial strain, descended expression at several kinds of different promoters from colibacillary natural metH gene, said bacterial strain contains two approach metABC and metXY, in our standard fask oscillating method, has also measured methionine(Met) output.MetH crosses and expresses three kinds of used carriers is pCL-P (cysK), pCL-P (pro) and pCL-P (CJ-1); They are with the promotor of intestinal bacteria cysK gene, substitute the Plac promotor respectively from the promotor of commercially available carrier pPROLar and the proprietary promotor CJ1 of CJ company, commercially available obtainable plasmid pCL1920 are modified obtain.Intestinal bacteria metH gene ORF is positioned at the downstream of these promotors just.The result who obtains is shown in following table 13.Can find out very clearly in fask oscillating method that even the accumulation of methionine(Met) is low-level relatively, the existence of the homocysteine methyl enzyme of high density also has the positively effect of highly significant to the output of methionine(Met).In fermentor tank, this effect even more obvious.

Table 13 metH crosses the effect that expression is produced methionine(Met)

G. produce at methionine(Met) and improve the vitriol picked-up in the organism and increase the APS pond

Present embodiment has been described in endogenous sulfur assimilation approach, with the method for intestinal bacteria through engineering approaches with omission intermediate product PAPS.The new way that makes up requires one and is used for each vitriol molecule is simplified the molecule less than ATP into sulfide, therefore, and the higher (see figure 6) of its efficiency.

As previously mentioned, Fig. 6 has shown two kinds of methods utilizing optional sulfur assimilation approach.A kind of method is clone's APS reductase, from cysH (EC1.8.4.9) gene of bacillus or pseudomonas aeruginosa, and is integrated into the bacillus coli gene group or it is expressed from plasmid.This can change into sulphite with APS in one step, therefore avoided catalytic by the conversion of APS to PAPS by intestinal bacteria APS kinases (cysC).The cysH homologue that second method is based on bacterium mutates intestinal bacteria PAPS reductase enzyme, so that make its substrate specificity ground become APS by PAPS.

Will (accession number AJ000974 zone: 548..1249) (accession number NC_002516 zone: cysH gene clone 1895692..1896495) be in plasmid with pseudomonas aeruginosa PA01 from Bacillus subtilus 168; And detect to confirm whether they can subsidize intestinal bacteria cysC or cysH knocks out two mutants, these two kinds of auxotrophys that two mutants all is halfcystine and methionine(Met).

In brief, will become BL21 (DE3) Δ cysH (promptly knocking out the BL21 (DE3) of cysH) to detect complementary action from the cysH gene transformation of Bacillus subtilus 168 and pseudomonas aeruginosa PA01.Use is inoculated from the single bacterium colony of following four kinds of bacterial strains and is contained the 5mL substratum of expressing substratum (OnEX: be defined as with amino acid but the substratum that non-halfcystine or methionine(Met) replenish) from spending the night of Novagen.

Under constant jolting, culture was hatched 48 hours at 30 ℃.Result in the table 14 shows that can both in intestinal bacteria, subsidize cysH from the cysH gene of Bacillus subtilus and pseudomonas aeruginosa knocks out and keep growth.

The optical density(OD) at 600nm place in the experiment of table 14 Δ cysH complementary action

Bacterial strain	?OD 600
		BL21 (DE3) (wild type strain)	?5.2
BL21 (DE3) Δ cysH (cysH disappearance)	?0
		BL21 (DE3) cysH+pET23BscysH (interpolation of bacillus cysH)	?7.2
BL21 (DE3.) cysH+pET23PacysH (interpolation of pseudomonas cysH)	?6.8

Same, use the bacterial strain that knocks out the cysC gene to detect the complementary action of Bacillus subtilus and pseudomonas aeruginosa cysH gene.Bacterial strain BL21 (DE3.) cysC is transformed by plasmid pET23a, pET23a (Bacillus subtilus)+cysH and pET23a+cysH (pseudomonas aeruginosa) respectively.The single bacterium colony of above-mentioned three kinds of bacterial strains with BL21 (DE3) at the amino acid whose 5mL OnEx inoculation of medium that contains except that L-halfcystine and L-methionine(Met).Cell is cultivated 48h 37 ℃ of following joltings, through OD _600nmMeasure its growth.Result displayed shows in the table 15, from the cysC sudden change that the APS reductase enzyme of the cysH of Bacillus subtilus and pseudomonas aeruginosa coding can be subsidized BL21 (DE3), has proved the formation that possibly omit PAPS.

The optical density(OD) at 600nm place in the experiment of table 15 Δ cysC complementary action

Bacterial strain	OD 600nm a
		BL21(DE3)	4.5
BL21(DE3)?cysC+pET23a	0.0
		BL21 (DE3.) cysC+pET23a+cysH (Bacillus subtilus)	2.5
BL21 (DE3.) cysC+pET23a+cysH (pseudomonas aeruginosa)	4.2

^aThe result is three MVs of cultivating.

Crossing of enzyme expressed in the sulfur assimilation action pathway

As stated, in order to increase the output of methionine(Met), it is helpful to have a meeting of sulfur assimilation effect efficiently.For the directed sulfhydrylation that makes acylhomoserine becomes easily, SH ₂Operability be very necessary.All oligogenes of sulfur assimilation effect are all cloned and are crossed and express in methionine production bacterin strain TF4076BJF.Gene overexpression is:

Cys PUWA: vitriol permeases

CysDN:ATP sulfate adenylyl transferase (EC 2.7.7.4)

CysCCysH:APS kinases and PAPS sulfurtransferase (EC 2.7.1.25 and EC 1.8.4.8)

CysIJCysG:NADPH-sulfite reductase (EC 1.8.1.2)

CysB: transcriptional activation agent

These genes are crossed in the bacterial strain that contains two approach metABC and metXY and are expressed, and in our standard fask oscillating method, measure methionine(Met) output.Aforementioned five groups of vitriol assimilation gene is cloned into respectively among the carrier pCL-(Prmf), and this carrier makes up through the promotor that the Plac promotor with plasmid pCL1920 replaces with intestinal bacteria rmf gene.The result who obtains is the table 16 of face as follows.

The mistake expression of results of the different sulfur assimilation path enzymes of table 16

Bacterial strain	OD	Met	Met/OD
						mg/L
TF4076BJF?metYX(Lm)	8.0	934	116
				TF4076BJF?metYX(Lm)cysPUWA	4.2	206	49
TF4076BJF?metYX(Lm)cysDN	10.3	1271	123
				TF4076BJF?metYX(Lm)cysCcysH	9.9	1348	136
TF4076BJF?metYX(Lm)cysJIcysG	7.7	1038	134
				TF4076BJF?metYX(Lm)cysB	9.4	425	45

The expression excessively and the transcribing of regulator of transhipment enzyme can cause low-producing methionine(Met), and the amount of the methionine(Met) of per unit cell quality also significantly descends.Increase the activity of sulfate adenylyl transferase, APS kinases and sulfurtransferase, all caused the increase of total methionine(Met) of increase and generation of the methionine(Met) output of per unit cell.Suppose that in the bacterial strain of implicit two kinds of different plasmids, observing these increases, in case then can expect and adjustment and optimize the expression of enzyme will further improve the result.

Embodiment 4. methionine production bacterin strain examples

As previously mentioned, the various genetic modifications that the present invention describes can be accomplished through the integration that is independent of chromosomal recombinant DNA sequence, and perhaps the recombinant DNA sequence can be incorporated into and produces in the strain chromosome.The recombinant DNA sequence can be used as single copy or is attached in the host cell with multiple copy.

I) a kind of mikrobe is like intestinal bacteria ATCC # 13070 or TF4076, through the functional deficiency of through engineering approaches formation thrB and metJ, so that the attenuation gene.This microbial expression metX and metY gene, and can express the recombinant nucleic acid sequence that causes natural metH gene overexpression.Additional approaches has been introduced in being expressed in of metX and metY in the intestinal bacteria, the expression of crossing of natural metH gene causes being increased by the flux of homocysteine to methionine(Met).

Ii) through to i) in the mikrobe described carry out following modification and make up the another kind of bacterial strain of producing.I) mikrobe of describing in is through further being modified this microbial transformation with the recombinant DNA molecules of active metZ gene (like the gene from Pseudomonas aeruginosa) coding.

Iii) through to i) in the mikrobe described carry out following modification and make up another and produce bacterial strain.I) mikrobe of describing in is through replacing natural metA gene with feedback inhibition opposing agent metA gene (such as those genes of describing among the embodiment 3) and further being modified.

Iv) carry out following modification and make up the another kind of bacterial strain of producing through mikrobe to iii) middle description.With the mikrobe of describing in the active metZ gene transformation iii).

V) through to i) in the mikrobe described carry out following modification and make up the another kind of bacterial strain of producing.I) mistake of describing in is expressed the mikrobe of metF gene product and is modified with attenuation transcription repressor gene lacI again.

Vi) carry out the another kind of bacterial strain of producing of following modification structure through any that describe among the present invention being produced bacterial strain.To produce bacterial strain and combine to improve sulfur assimilation with mistake expressing gene cysDN, cysIJ or cysCH or its through the heredity structure.Alternatively, these are produced bacterial strains and can be modified again, use single cysH gene substitution from Pseudomonas aeruginosa or Bacillus subtilus from colibacillary natural cysC and cysH.

Vii) modify the another kind of bacterial strain of producing of structure, with attenuation methionine(Met) input gene metD through any that describe among the present invention being produced bacterial strain.

Claims (19)

1. have homoserine O-succinyl-transferase active isolated polypeptide; Compare with the wild-type homoserine O-succinyl-transferring enzyme polypeptide that has like the described aminoacid sequence of gene pool accession number No.AAC76983, it shows that through the L-methionine(Met) susceptibility to feedback inhibition reduces.

2. isolated polypeptide according to claim 1, it is at the amino acid 24,29,79,114 corresponding to wild-type homoserine O-succinyl-transferring enzyme polypeptide; 140,163,222,275,290; One or more amino acid positions of 291,295,297,304 and 305 contain sudden change.

3. isolated polypeptide according to claim 2, it is containing sudden change corresponding to the amino acid/11 63,222 of wild-type homoserine O-succinyl-transferring enzyme polypeptide and one or more amino acid positions of 295.

4. isolated polypeptide according to claim 2, it is containing sudden change corresponding to the amino acid 24,275,297 of wild-type homoserine O-succinyl-transferring enzyme polypeptide and one or more amino acid positions of 305.

5. isolated polypeptide according to claim 2, it contains sudden change at the amino acid position corresponding to the amino acid 290 of wild-type homoserine O-succinyl-transferring enzyme polypeptide.

6. isolated polypeptide according to claim 2, it is containing sudden change corresponding to the amino acid 29,114 of wild-type homoserine O-succinyl-transferring enzyme polypeptide and one or more amino acid positions of 140.

7. isolated polypeptide according to claim 2, it is containing sudden change corresponding to the amino acid 79,140,291 of wild-type homoserine O-succinyl-transferring enzyme polypeptide and one or more amino acid positions of 304.

8. isolated polypeptide according to claim 2, wherein 24 amino acid Threonine is replaced by Serine; 29 amino acid serine is replaced by proline(Pro); 79 amino acid l-asparagine is replaced by Serine; 114 amino acid L-glutamic acid is replaced by glycocoll; 140 amino acid phenylalanine(Phe) is by Serine or Isoleucine replacement; 163 amino acid lysine is replaced by Stimulina; 222 amino acid phenylalanine(Phe) is replaced by leucine; 275 amino acid alanine is replaced by L-glutamic acid; 290 amino acid l-asparagine is replaced by Histidine; 291 amino acid tyrosine is replaced by l-asparagine; 295 amino acid Stimulina is replaced by l-arginine; 297 amino acid Threonine is replaced by L-Ala; Replaced by leucine with 304 amino acids methionine; And 305 amino acid l-asparagine is replaced by tyrosine.

9. isolated polypeptide according to claim 3, wherein 163 amino acid lysine is replaced by Stimulina; 222 amino acid phenylalanine(Phe) is replaced by leucine; And 295 amino acid Stimulina is replaced by l-arginine.

10. isolated polypeptide according to claim 4, wherein 24 amino acid Threonine is replaced by Serine; 275 amino acid alanine is replaced by L-glutamic acid; 297 amino acid Threonine is replaced by L-Ala; And 305 amino acid l-asparagine is replaced by tyrosine.

11. isolated polypeptide according to claim 5, wherein 290 amino acid l-asparagine is replaced by Histidine.

12. isolated polypeptide according to claim 6, wherein 29 amino acid serine is replaced by proline(Pro); 114 amino acid L-glutamic acid is replaced by glycocoll; And 140 amino acid phenylalanine(Phe) is by Serine or Isoleucine replacement.

13. isolated polypeptide according to claim 1, wherein 79 amino acid l-asparagine is replaced by Serine; 140 amino acid phenylalanine(Phe) is by Serine or Isoleucine replacement; 291 amino acid tyrosine is replaced by l-asparagine; And 304 amino acids methionine is replaced by leucine.

14. isolated polypeptide according to claim 1, it comprises and is selected from SEQ ID NO:2,4,6,8 and 10 aminoacid sequence.

15. the separating nucleotide of the described isolated polypeptide of coding claim 1.

16. separating nucleotide according to claim 15, it contains and is selected from SEQ ID NO:1,3,5,7 and 9 nucleotide sequence.

17. contain the plasmid of the described separating nucleotide of claim 15.

18. with the said plasmid microorganism transformed of claim 17 bacterial strain.

19. prepare the method for L-methionine(Met), it comprises: under the condition that allows the L-methionine(Met) to produce, cultivate mikrobe according to claim 18; And separation produces the L-methionine(Met).

Images