CN102690894A - Detection method of BK virus as well as kit and application thereof - Google Patents
Detection method of BK virus as well as kit and application thereof Download PDFInfo
- Publication number
- CN102690894A CN102690894A CN2011101526839A CN201110152683A CN102690894A CN 102690894 A CN102690894 A CN 102690894A CN 2011101526839 A CN2011101526839 A CN 2011101526839A CN 201110152683 A CN201110152683 A CN 201110152683A CN 102690894 A CN102690894 A CN 102690894A
- Authority
- CN
- China
- Prior art keywords
- bkv
- virus
- group
- detection method
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a detection method of a virus and a kit and particularly relates to a detection method of a BK virus and a kit thereof. The detection method comprises the following steps of: firstly, designing specific primers BKV-F and BKV-R and a Taqman fluorescence probe BKV-P aiming at a BK virus gene group; marking a fluorophore on a 5' end of the Taqman fluorescence probe BKV-P and marking a quencher at any position the Taqman fluorescence probe BKV-P except the 5' end; then treating a sample to be detected and carrying out PCR (Polymerase Chain Reaction); and finally, detecting a reaction result by using a fluorescent quantitation PCR instrument. The detection method disclosed by the invention has the advantages that the qualitative and quantitative detection can be realized, and high sensibility, good specificity, rapid reaction and low cost also can be realized. The invention further relates to a detection kit of the BK virus and an application of the detection method.
Description
Technical field
The present invention relates to a kind of detection method and test kit of virus, specifically, relate to a kind of detection method and test kit thereof of BK virus.
Background technology
BK virus (BKV) is a kind of of polyomavirus (Polyomaviruses), and primary infection mostly occurred in the Childhood, and adult's BK virus seroprevalence is up to more than 80%.Virus mainly is present in renal tissue and the urothelial tissue with latent state after the primary infection, and Lymphoid tissue and liver, lung, eye, brain etc. also have the existence of latent virus in addition.Normal crowd is asymptomatic in immunity, and virus can activate again and duplicate when host immune function reduces or is suppressed, and causes a disease.Taking anti-rejection drugs (immunosuppressor) after the organ transplantation for a long time, to cause the patient immune function lowly be that BK virus activates the main inducing duplicate.6～10% renal transplant recipients can cause BK virus dependency ephrosis (BKVAN) because of BK virus infects, and 50～70% BKVAN patient finally understands graft failure.BKVAN has become behind the renal transplantation severe complications and has influenced one of key factor of renal transplantation long-term efficacy and function.The infection of BK virus also with bone marrow transplantation patient's hemorrhagic cystitis, progressive multifocal leukoencephalopathy, pulmonary disorder, tumour, autoimmune disorder etc. are relevant.Be exactly early diagnosis to the efficacious therapy mode of BK virus dependency ephrosis clinically at present, thereby the consumption of control anti-rejection drugs (immunosuppressor) cooperate the use of antiviral (like HPMPC) simultaneously.So prognosis has the important clinical meaning to renal transplant recipients in the early diagnosis that BK virus infects.
The gold standard of BK virus dependency ephrosis (BKVAN) diagnosis is the nephridial tissue biopsy.Because the limitation of BKVAN focus causes accurately sampling difficulty, the sensitivity meeting is affected.And the nephridial tissue puncture has traumatic, is difficult for being accepted by patient.Nephridial tissue biopsy simultaneously also will be got rid of acute rejection, the influence of drug toxicity and other potential diseases.Patient B K activated viral duplicates the back urine and at first shows as viruria, can judge through urine decoy cell microscopy.The decoy cell is the cast-off cells that derive from urothelial, microscopically visible nuclear inner virus inclusion body and cytopathic effect.But this method is subject to the difference between individuals of urine pathology difference and urethra structure, and the result judges subjectivity, is difficult to accomplish stdn.BK virus carrying capacity in research detection by quantitative transplant patient's urine and the blood is abroad arranged, be used for prediction and the treatment monitoring of BKVAN, shown good effect.Domestic research to BK virus is just at the early-stage, does not have sophisticated BK virus detection kit.China's organ transplantation development is rapid, and the transplanting case load had reached 10000 examples in 2009, occupied the second place of the world, and renal transplantation is maximum, accounts for more than 60% of sum.BKVAN due to wherein BK virus infects has become influence and has transplanted one of key factor of success or failure.
To sum up need the product that to realize fast, effectively and accurately detect BK virus badly, to be used for the detection of BK virus carrying capacity, the prediction of BKVAN and treatment monitoring.
Summary of the invention
Primary and foremost purpose of the present invention provides a kind of method that is used to detect BK virus;
Second goal of the invention of the present invention is to propose to detect the test kit of BK virus;
The 3rd goal of the invention of the present invention is to propose the application of this detection BK virus test kit.
In order to accomplish the object of the invention, the technical scheme of employing is:
The present invention relates to a kind of detection method of BK virus, may further comprise the steps:
(1) to BK virus genome design specific primers BKV-F and BKV-R; Taqman fluorescent probe BKV-P; 5 ' the end of Taqman fluorescent probe BKV-P is marked with fluorophor, in any position marked except that 5 ' end quenching group is arranged, and is preferably 3 ' end;
(2) handle sample to be tested, carry out the PCR reaction;
(3) through quantitative real time PCR Instrument detection reaction result;
Wherein, the nucleotide sequence of BKV-F shown in SEQ ID NO:1, or by the nucleotide sequence shown in the SEQ ID NO:1 through replacing, disappearance, adding the nucleotide sequence that forms;
The nucleotide sequence of BKV-R shown in SEQ ID NO:2, or by the nucleotide sequence shown in the SEQ ID NO:2 through replacing, disappearance, adding the nucleotide sequence that forms;
The nucleotide sequence of BKV-P shown in SEQ ID NO:3, or by the nucleotide sequence shown in the SEQ ID NO:3 through replacing, disappearance, adding the nucleotide sequence that forms.
Wherein, the nucleotides sequence of SEQ ID NO:1 is classified AGAACTGCTCCTCAATGGATG as;
The nucleotides sequence of SEQ ID NO:2 is classified AGCTGCCCCTGGACACTCT as;
The nucleotides sequence of SEQ ID NO:3 is classified TGCTCTTGAAGCATATGAAGATGGCCCCA as.
First optimal technical scheme of the present invention does; The fluorescence report group of described Taqman fluorescent probe is selected from by 6-Fluoresceincarboxylic acid, chlordene-6-methyl resorcinolphthalein, VIC optical dye, tetrachloro-6-Fluoresceincarboxylic acid, carboxyl-X-rhodamine, 6-carboxyl tetramethyl-rhodamine, sulphonyl rhodamine, 6-carboxyl-4 '; At least a in 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester, Hua Jing 3, Hua Jing 5 or the flower cyanines 5.5; Said fluorescent quenching group is selected from least a in 6-carboxyl tetramethyl-rhodamine, 4-(4-dimethylamino phenylazo-) phenylformic acid, black hole quencher 1, black hole quencher 2 or the black hole quencher 3;
Preferably; When the fluorescent quenching group is selected from 4-(4-dimethylamino phenylazo-) phenylformic acid; The fluorescence report group is selected from 6-Fluoresceincarboxylic acid, tetrachloro-6-Fluoresceincarboxylic acid, 6-carboxyl-4 '; At least a among 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester, chlordene-6-methyl resorcinolphthalein, the Hua Jing 3;
When the fluorescent quenching group is selected from 6-carboxyl tetramethyl-rhodamine; The fluorescence report group is selected from 6-Fluoresceincarboxylic acid, tetrachloro-6-Fluoresceincarboxylic acid, 6-carboxyl-4 '; At least a in 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester or chlordene-6-methyl resorcinolphthalein;
When the fluorescent quenching group is selected from black hole quencher 1; The fluorescence report group is selected from 6-Fluoresceincarboxylic acid, tetrachloro-6-Fluoresceincarboxylic acid, 6-carboxyl-4 '; At least a in 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester, chlordene-6-methyl resorcinolphthalein or the flower cyanines 3;
When the fluorescent quenching group was selected from black hole quencher 2, the fluorescence report group was selected from least a in 6-carboxyl tetramethyl-rhodamine, Hua Jing 3, carboxyl-X-rhodamine or the sulphonyl rhodamine;
When the fluorescent quenching group was selected from black hole quencher 3, the fluorescence report group was selected from a kind of in the cyanines 5.5 of Hua Jing 5 or flower.
Most preferably, said fluorescence report group is 6-FAM; Said fluorescent quenching group is BHQ1.
Second optimal technical scheme of the present invention is that the reaction system of PCR reaction comprises in the step (2): PCR reaction solution 19.8 μ l, archaeal dna polymerase 0.2 μ l, template to be checked 5.0 μ l;
Wherein, the consisting of of PCR reaction solution: 10 * reaction buffer, 2.5 μ l, BKV-F (10 μ M) 0.5 μ l, BKV-R (10 μ M) 0.25 μ l, BKV-P (10 μ M) 0.5 μ l, dNTP 2.0 μ l mend reaction system to 19.8 μ l with aseptic ultrapure water at last.
The 3rd optimal technical scheme of the present invention is: the reaction conditions of PCR reaction is in the step (2): 92～95 ℃, and 3～5 minutes; 92～95 ℃ then, 10～15 seconds, 55～65 ℃, 10～35 seconds, totally 40 circulations; Preferably: 94 ℃, 4 minutes; 94 ℃ then, 15 seconds, 60 ℃, 35 seconds, totally 40 circulations.
The 4th optimal technical scheme of the present invention is: described PCR reaction all is provided with negative Quality Control group and BK virus quantitative criterion article I～IV group; The template to be measured of wherein negative Quality Control group is a pure water, and the template to be measured of BK virus quantitative criterion article I-IV is respectively BKV quantitative criterion article I, BKV quantitative criterion article II, BKV quantitative criterion article III, BKV quantitative criterion article IV.
The 5th optimal technical scheme of the present invention is: the construction process of BKV quantitative criterion article I～IV may further comprise the steps:
(1) preparation detection reaction system adds the viral genome of purifying, and carries out the PCR reaction;
(2) amplified production is inserted T vector construction recombinant plasmid, increase behind the recombinant plasmid transformed bacterium;
(3) utilize uv analysis method to measure absorbancy behind the purification recombinant plasmid, calculate plasmid concentration, at last recombinant plasmid is diluted to 4 gradients 5 * 10
5～5 * 10
8Copies/ml is respectively as BKV quantitative criterion article I, BKV quantitative criterion article II, BKV quantitative criterion article III, the BKV quantitative criterion article IV of test kit.
The 6th optimal technical scheme of the present invention is: the treatment process of described sample to be tested comprises: magnetic bead extraction method, post formulation, boiling lysis and cetyl trimethylammonium bromide method.
The 7th optimal technical scheme of the present invention is: quantitative real time PCR Instrument detection reaction result; If S type amplification curve does not appear in sense channel, be judged to the BK virus feminine gender; If S type amplification curve appears in sense channel, the typical curve that utilizes the detection of BKV quantitative criterion article to be generated calculates the concentration (copies/ml) of sample to be tested.
The 8th optimal technical scheme of the present invention is: quantitative real time PCR Instrument detection reaction result, adopt the ABI7500 quantitative real time PCR Instrument, and fluorescent signal is set at the FAM resorcinolphthalein when collecting, and fluorescent signal is collected and is located at 60 ℃.
The invention still further relates to a kind of detection kit of BK virus, described test kit comprises: PCR reaction solution, hot resistant DNA polymerase, template to be checked, negative Quality Control group and BK virus quantitative criterion article I～IV group.
Wherein, wherein, the nucleotide sequence of BKV-F shown in SEQ ID NO:1, or by the nucleotide sequence shown in the SEQ ID NO:1 through replacing, disappearance, adding the nucleotide sequence that forms;
The nucleotide sequence of BKV-R shown in SEQ ID NO:2, or by the nucleotide sequence shown in the SEQ ID NO:2 through replacing, disappearance, adding the nucleotide sequence that forms;
The nucleotide sequence of BKV-P shown in SEQ ID NO:3, or by the nucleotide sequence shown in the SEQ ID NO:3 through replacing, disappearance, adding the nucleotide sequence that forms.
Do further explanation and explanation in the face of technical scheme of the present invention down:
Primary and foremost purpose of the present invention is the problem that solves the product that lacks the BK virus detection; A kind of method that is used to detect BK virus is provided; Use this method can realize quantitative fast, effectively and accurately or qualitative detection to BK virus; Guarantee the detection of BK virus carrying capacity timely, the prediction of BKVAN and treatment monitoring.
The invention still further relates to a kind of test kit that is used to detect BK virus, this test kit has susceptibility height, specificity is good, reaction is quick and cost is low advantage, is suitable for extensive clinical the development; Detection by quantitative fast, effectively and accurately can be realized, thereby case diagnosis and treatment timely and result of treatment monitoring can be guaranteed BK virus.
The present invention is directed to BK virus genome design specific primers BKV-F and BKV-R; Taqman fluorescent probe BKV-P; 5 ' the end of Taqman fluorescent probe BKV-P is marked with fluorophor, in any position marked except that 5 ' end quenching group is arranged, and is preferably 3 ' end; The present invention adds a specific fluorescent probe when adding a pair of primer when pcr amplification, this probe is an oligonucleotide, and two ends are mark report fluorophor and a cancellation fluorophor respectively.When probe was complete, the reporter group fluorescent signal emitted was absorbed by quenching group; 5 '-3 ' 5 prime excision enzyme activity of Taq enzyme is cut degraded with probe enzyme during pcr amplification; The report fluorophor is separated with the cancellation fluorophor; Thereby the fluorescence monitoring system can receive fluorescent signal; Be DNA chain of every amplification, just have a fluorescence molecule to form, realized that the accumulation of fluorescent signal and PCR product form fully synchronously.
Said fluorescence report group and said fluorescent quenching group be selected from by the 6-Fluoresceincarboxylic acid (6-carboxyfluorescein, FAM), tetrachloro-6-Fluoresceincarboxylic acid (tetrachloro-6-carboxyfluorescein, TET), chlordene-6-methyl resorcinolphthalein (Hexachloro-6-methylfluorescein; HEX), 6-carboxyl tetramethyl-rhodamine (6-carboxytetramethylrhodamine; TAMRA), sulphonyl rhodamine (Sulforhodamine 101, Texas Red), carboxyl-X-rhodamine (Carboxy-x-rhodamine, ROX), Hua Jing 3 (cyanine3; Cy3), Hua Jing 3.5 (cyanine3.5; Cy3.5), Hua Jing 5 (cyanine5, Cy5), Hua Jing 5.5 (cyanine5.5, Cy5.5), biological search technique (the Biosearch Technologies of company; Inc) black hole quencher 1 (Black Hole Quencher 1; BHQ1), black hole quencher 2 (Black Hole Quencher 2, BHQ2), black hole quencher 3 (Black Hole Quencher 3, BHQ3), 4-(4-dimethylamino phenylazo-) phenylformic acid (4-(4 '-dimethylaminophenylazo) benzoic acid; DABCYL), 6-carboxyl-4 '; 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester (6-Carboxy-4 ', 5 ' dichloro-2 '; 7 '-dimethoxyfluorescein is in the group of JOE) being formed with the VIC optical dye of u.s.a. applied biosystem company.Preferably; Said fluorescence report group is selected from by 6-Fluoresceincarboxylic acid, chlordene-6-methyl resorcinolphthalein, VIC optical dye, tetrachloro-6-Fluoresceincarboxylic acid, carboxyl-X-rhodamine, 6-carboxyl tetramethyl-rhodamine, sulphonyl rhodamine, 6-carboxyl-4 '; In the group that 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester, Hua Jing 3, Hua Jing 5 and Hua Jing 5.5 are formed; Said fluorescent quenching group is selected from the group of being made up of 6-carboxyl tetramethyl-rhodamine, 4-(4-dimethylamino phenylazo-) phenylformic acid DABCYL, BHQ1, BHQ2 and BHQ3.More preferably, according to selecting fluorescence report group and fluorescent quenching group shown in the following table 1.
Table 1:
Most preferably, said fluorescence report group is 6-FAM; Said fluorescent quenching group is BHQ1.
Handle testing sample then; The processing of testing sample can be adopted existing DNA treatment kits; The viral nucleic acid process for extracting that also can adopt is: magnetic bead extraction method, post formulation, boiling lysis and CTAB (cetyl trimethylammonium bromide) method, and preferred boiling lysis is handled sample and is extracted nucleic acid.
Described boiling lysis is handled sample and is comprised with the method for extracting nucleic acid:
Blood sample: get 100 μ l serum or plasma sample and 50 μ l liquid concentrator mixings, remove supernatant behind the centrifugal 10min of 13000rpm/min, add 25 μ l lysate mixings deposition, 100 ℃ are boiled 10min, and centrifugal 10min, supernatant are the viral nucleic acid of purifying.
Urine specimen: get 1000 μ l urine specimens, remove supernatant behind the centrifugal 10min of 13000rpm/min, add 50 μ l lysate mixings deposition, 100 ℃ are boiled 10min, and centrifugal 10min, supernatant are the viral nucleic acid of purifying.
The present invention adopts PCR method to detect, and wherein the reaction system of PCR reaction comprises: PCR reaction solution 19.8 μ l, archaeal dna polymerase 0.2 μ l, template to be checked 5.0 μ l; Wherein, the consisting of of PCR reaction solution: 10 * reaction buffer, 2.5 μ l, BKV-F (10 μ M) 0.5 μ l, BKV-R (10 μ M) 0.25 μ l, BKV-P (10 μ M) 0.5 μ l, dNTP 2.0 μ l mend reaction system to 19.8 μ l with aseptic ultrapure water at last.
The reaction conditions of PCR reaction is: 94 ℃, and 4 minutes; 94 ℃, 15 seconds; 60 ℃, 35 seconds, 40 circulations.
In the PCR reaction process; Negative Quality Control group and BK virus quantitative criterion article I～IV group all is set; The template to be measured of wherein negative Quality Control group is a pure water, and the template to be measured of BK virus quantitative criterion article I-IV is respectively BKV quantitative criterion article I, BKV quantitative criterion article II, BKV quantitative criterion article III, BKV quantitative criterion article IV.
The construction process of BKV quantitative criterion article I～IV may further comprise the steps:
(1) preparation detection reaction system: the viral genome 5.0 μ l of PCR reaction solution 19.8 μ l, archaeal dna polymerase 0.2 μ l, purification, carry out the PCR reaction, the reaction conditions of PCR reaction is: 94 ℃, 4 minutes; 94 ℃, 15 seconds; 60 ℃, 35 seconds, 40 circulations;
(2) amplified production is inserted T vector construction recombinant plasmid, increase behind the recombinant plasmid transformed bacterium;
(3) utilize uv analysis method to measure absorbancy behind the purification recombinant plasmid, calculate plasmid concentration, at last recombinant plasmid is diluted to 4 gradients 5 * 10
5～5 * 10
8Copies/ml is respectively as BKV quantitative criterion article I, BKV quantitative criterion article II, BKV quantitative criterion article III, the BKV quantitative criterion article IV of test kit.
The present invention adopts quantitative real time PCR Instrument detection reaction result: adopt the ABI7500 quantitative real time PCR Instrument, fluorescent signal is set at the FAM resorcinolphthalein when collecting, and fluorescent signal is collected and is located at 60 ℃; If S type amplification curve does not appear in sense channel, be judged to the BK virus feminine gender; If S type amplification curve appears in sense channel, the typical curve that utilizes the detection of BKV quantitative criterion article to be generated calculates the concentration (copies/ml) of sample to be tested.
The invention still further relates to a kind of detection kit of BK virus, described test kit comprises: PCR reaction solution, archaeal dna polymerase, template to be checked, negative Quality Control group and BK virus quantitative criterion article I～IV group; Wherein, contain BKV-F, BKV-R and BKV-P in the described PCR reaction solution.
Can also comprise the DNA extraction test kit in the BK virus detection kit of the present invention, the DNA extraction test kit can adopt existing DNA extraction technology.
The detection kit that the invention still further relates to described BK virus is detecting and/or the application of diagnosis BK virus in diseases related.The infection of BK virus and BK virus dependency ephrosis, bone marrow transplantation patient's hemorrhagic cystitis, progressive multifocal leukoencephalopathy, pulmonary disorder, tumour, autoimmune disorder etc. are relevant.
That utilizes that test kit of the present invention can be quick, easy carries out examination to BK virus dependency ephrosis, has changed the present situation that need carry out biopsy in the prior art.Detection method susceptibility of the present invention is high, and minimum detecting can reach 2 * 10
3Copies/ml; Also has the good advantage of specificity simultaneously, other the virus generation cross reaction of getting along well, hepatitis B virus (HBV) for example, hepatitis C virus (HCV), Epstein-Barr virus (EBV), Human cytomegalic inclusion disease virus (HCMV), human parvovirus B19 (HPV B19) and JC virus (JCV); Detection method reaction of the present invention can obtain reaction result in general 1.5 to 2 hours, and cost is low, non-false positive fast, is suitable for extensive clinical the development.Thereby realize detection by quantitative fast, effectively and accurately, thereby can guarantee case diagnosis and treatment timely and result of treatment monitoring BK virus.
Description of drawings
Fig. 1 detects the curve that sample to be tested obtains for adopting quantitative real time PCR Instrument;
Fig. 2 detects the curve that BKV quantitative criterion article obtain for adopting quantitative real time PCR Instrument.
Embodiment of the present invention only limits to further explain and explanation the present invention, content of the present invention is not constituted restriction.The reagent that the present invention adopted is commercially available.
Embodiment
Embodiment 1
1. the design of primer and probe: to BK virus genome design specific primers BKV-F and BKV-R, with Taqman fluorescent probe BKV-P.Taqman fluorescent probe BKV-P 5 ' end mark fluorophor be the 6-Fluoresceincarboxylic acid (6-carboxyfluorescein, FAM), 3 ' end mark quenching group be black hole quencher 1 (Black Hole Quencher 1, BHQ1).
BKV-F：AGAACTGCTCCTCAATGGATG
BKV-R：AGCTGCCCCTGGACACTCT
BKV-P：TGCTCTTGAAGCATATGAAGATGGCCCCA
(sequence direction 5 '-3 ')
2.BK the preparation of viral dna polymerase Kettenreaktion liquid: each composition (primer, probe and reaction buffer) is mixed by a certain percentage.Single reactive polymeric PCR liquid comprises 10 * reaction buffer, 2.5 μ l, BKV-F (10 μ M) 0.5 μ l, and BKV-R (10 μ M) 0.25 μ l, BKV-P (10 μ M) 0.5 μ l, dNTP 2.0 μ l mend reaction system to 19.8 μ l with aseptic ultrapure water at last.
3. detection reaction: get NDM-1 polymerase chain reaction liquid 19.8 μ l and archaeal dna polymerase 0.2 μ l (1 unit) is mixed with reaction system, add 5.0 μ l template to be checked then.
Every batch of reaction all is provided with negative Quality Control (H
2O) and BK virus quantitative criterion article I-IV.Reaction conditions: 94 ℃, 4 minutes; 94 ℃, 15 seconds; 60 ℃, 35 seconds, 40 circulations.
Adopt the ABI7500 quantitative real time PCR Instrument, fluorescent signal is set at the FAM resorcinolphthalein when collecting, and fluorescent signal is collected and is located at 60 ℃.
4.BK the processing and the DNA extraction of Virus Sample (urine and blood): adopt boiling lysis to handle sample and extraction nucleic acid.
Blood sample: get 100 μ l serum or plasma sample and 50 μ l liquid concentrator mixings, remove supernatant behind the centrifugal 10min of 13000rpm/min, add 25 μ l lysate mixings deposition, 100 ℃ are boiled 10min, and centrifugal 10min, supernatant are the viral nucleic acid of purifying.
Urine specimen: get 1000 μ l urine specimens, remove supernatant behind the centrifugal 10min of 13000rpm/min, add 50 μ l lysate mixings deposition, 100 ℃ are boiled 10min, and centrifugal 10min, supernatant are the viral nucleic acid of purifying.
5. make up BKV quantitative criterion article I-IV.
6. the result judges: if S type amplification curve does not appear in sense channel, be judged to the BK virus feminine gender.If S type amplification curve appears in sense channel, the typical curve that utilizes the detection of BKV quantitative criterion article to be generated calculates the concentration (copies/ml) of sample to be tested.During detection reaction, (concentration is respectively 5 * 10 to BKV quantitative criterion article I-IV
5～5 * 10
8Copies/ml) detect simultaneously with sample, the target gene concentration of BKV quantitative criterion article I-IV is known.According to quantitative criterion article concentration and detected result CT value, system generates a typical curve automatically.According to the detection CT value of testing sample, can calculate the concentration of target gene in the sample.
Utilize aforesaid method to 2 routine BK virus serum samples, 2 routine BK virus urine specimens, 5 routine healthy human urine's fluid samples; 5 routine healthy human blood's samples, hepatitis B virus (HBV) blood sample, hepatitis C virus (HCV) blood sample, Epstein-Barr virus (EBV) blood sample, Human cytomegalic inclusion disease virus (HCMV) blood sample, human parvovirus B19 (HPV B19) blood sample and JC virus (JCV) blood sample; Amount to 20 increments and originally detect, the result is as shown in Figure 1:
Wherein, 2 routine BK virus serum samples and 2 routine BK virus urine specimens detect all positive, and S type amplification curve is arranged; Through the typical curve that computingmachine generates, from left to right, the concentration of calculating 4 positive sample is respectively: 7.1 * 10
6Copies/ml, 2.8 * 10
5Copies/ml, 4.7 * 10
4Copies/ml, 5.1 * 10
3Copies/ml.
Healthy human urine's fluid samples (5 example), blood sample (5 example), and clinical other common pathogenic agent; Comprise hepatitis B virus (HBV); Hepatitis C virus (HCV), Epstein-Barr virus (EBV), Human cytomegalic inclusion disease virus (HCMV); Human parvovirus B19 (HPV B19) and JC virus (JCV) detect all negative, no S type amplification curve.Thereby confirmed the specificity of detection method of the present invention.
7. result verification: will detect the male amplified production and carry out gene sequencing, sequencing result turns out to be the BK virus gene order after the BLAST comparison.
The structure of embodiment 2 BKV quantitative criterion article I-IV:
(1) preparation detection reaction system: the viral genome 5.0 μ l of PCR reaction solution 19.8 μ l, archaeal dna polymerase 0.2 μ l, purification, carry out the PCR reaction, the reaction conditions of PCR reaction is: 94 ℃, 4 minutes; 94 ℃, 15 seconds; 60 ℃, 35 seconds, 40 circulations;
The PCR reaction solution comprises 10 * reaction buffer, 2.5 μ l, BKV-F (10 μ M) 0.5 μ l, and BKV-R (10 μ M) 0.25 μ l, BKV-P (10 μ M) 0.5 μ l, dNTP 2.0 μ l mend reaction system to 19.8 μ l with aseptic ultrapure water at last.
(2) amplified production is inserted T vector construction recombinant plasmid, increase behind the recombinant plasmid transformed bacterium.
The dna sequence dna of gained is directly connected on the pSTV28DNA carrier through T4 phage DNA ligase enzyme, and the pSTV28 dna vector is available from precious biological (Takara) company.Then with recombinant plasmid vector transformed into escherichia coli (using the Trans5 α Chemically Competent Cell of Beijing Quanshijin Biotechnology Co., Ltd); Extract plasmid (using the little extraction reagent kit of high purity plasmid of TIANGEN Biotech (Beijing) Co., Ltd., TIANpure Mini Plasmid Kit) behind the screening positive clone.A part of amplified production to the gained DNA checks order, and proves that the dna fragmentation that said amplification obtains has aim sequence.To have the recombinant plasmid vector transformed into escherichia coli and cultivate in a large number, and extract plasmid, the concentration of target gene is measured and calculated to ultraviolet spectrophotometry.
(3) utilize uv analysis method to measure absorbancy behind the purification recombinant plasmid, calculate plasmid concentration (copies/ml).At last recombinant plasmid is diluted to 4 gradients (5 * 10
5～5 * 10
8Copies/ml), respectively as BKV quantitative criterion article, BKV quantitative criterion article II, BKV quantitative criterion article III, the BKV quantitative criterion article IV of test kit;
BKV quantitative criterion article are carried out detecting behind the gradient dilution, as shown in Figure 2, be respectively 2 * 10 from left to right
9Copies/ml, 2 * 10
8Copies/ml, 2 * 10
7Copies/ml, 2 * 10
6Copies/ml, 2 * 10
5Copies/ml, 2 * 10
4Copies/ml, 2 * 10
3Copies/ml, 2 * 10
2The amplification curve of copies/ml.2 * 10
1Copies/ml concentration detects negative (no S type amplification curve).Linearity range is 2 * 10
3～2 * 10
8Copies/ml.Minimum detectability is 2 * 10
3Copies/ml.
Claims (10)
1. the detection method of a BK virus is characterized in that, described detection method may further comprise the steps:
(1) to BK virus genome design specific primers BKV-F and BKV-R; Taqman fluorescent probe BKV-P; 5 ' the end of Taqman fluorescent probe BKV-P is marked with fluorophor, in any position marked except that 5 ' end quenching group is arranged, and preferably is connected in 3 ' end;
(2) handle sample to be tested, carry out the PCR reaction;
(3) through quantitative real time PCR Instrument detection reaction result;
Wherein, the nucleotide sequence of BKV-F shown in SEQ ID NO:1, or by the nucleotide sequence shown in the SEQ ID NO:1 through replacing, disappearance, adding the nucleotide sequence that forms;
The nucleotide sequence of BKV-R shown in SEQ ID NO:2, or by the nucleotide sequence shown in the SEQ ID NO:2 through replacing, disappearance, adding the nucleotide sequence that forms;
The nucleotide sequence of BKV-P shown in SEQ ID NO:3, or by the nucleotide sequence shown in the SEQ ID NO:3 through replacing, disappearance, adding the nucleotide sequence that forms.
2. detection method according to claim 1; It is characterized in that; The fluorescence report group of described Taqman fluorescent probe is selected from by 6-Fluoresceincarboxylic acid, chlordene-6-methyl resorcinolphthalein, VIC optical dye, tetrachloro-6-Fluoresceincarboxylic acid, carboxyl-X-rhodamine, 6-carboxyl tetramethyl-rhodamine, sulphonyl rhodamine, 6-carboxyl-4 '; At least a in 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester, Hua Jing 3, Hua Jing 5 or the flower cyanines 5.5; Said fluorescent quenching group is selected from least a in 6-carboxyl tetramethyl-rhodamine, 4-(4-dimethylamino phenylazo-) phenylformic acid, black hole quencher 1, black hole quencher 2 or the black hole quencher 3;
Preferably; When the fluorescent quenching group is selected from 4-(4-dimethylamino phenylazo-) phenylformic acid; The fluorescence report group is selected from 6-Fluoresceincarboxylic acid, tetrachloro-6-Fluoresceincarboxylic acid, 6-carboxyl-4 '; At least a among 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester, chlordene-6-methyl resorcinolphthalein, the Hua Jing 3;
When the fluorescent quenching group is selected from 6-carboxyl tetramethyl-rhodamine; The fluorescence report group is selected from 6-Fluoresceincarboxylic acid, tetrachloro-6-Fluoresceincarboxylic acid, 6-carboxyl-4 '; At least a in 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester or chlordene-6-methyl resorcinolphthalein;
When the fluorescent quenching group is selected from black hole quencher 1; The fluorescence report group is selected from 6-Fluoresceincarboxylic acid, tetrachloro-6-Fluoresceincarboxylic acid, 6-carboxyl-4 '; At least a in 5 '-two chloro-, 2 ', 7 '-dimethoxy resorcinolphthalein succinimide ester, chlordene-6-methyl resorcinolphthalein or the flower cyanines 3;
When the fluorescent quenching group was selected from black hole quencher 2, the fluorescence report group was selected from least a in 6-carboxyl tetramethyl-rhodamine, Hua Jing 3, carboxyl-X-rhodamine or the sulphonyl rhodamine;
When the fluorescent quenching group was selected from black hole quencher 3, the fluorescence report group was selected from a kind of in the cyanines 5.5 of Hua Jing 5 or flower; Most preferred, said fluorescence report group is the 6-Fluoresceincarboxylic acid; Said fluorescent quenching group is a black hole quencher 1.
3. detection method according to claim 1 is characterized in that, the reaction system of PCR reaction comprises in the step (2): PCR reaction solution 19.8 μ l, archaeal dna polymerase 0.2 μ l and template to be checked 5.0 μ l;
Wherein, the consisting of of PCR reaction solution: 10 * reaction buffer, 2.5 μ l, BKV-F (10 μ M) 0.5 μ l, BKV-R (10 μ M) 0.25 μ l, BKV-P (10 μ M) 0.5 μ l, dNTP 2.0 μ l mend reaction system to 19.8 μ l with aseptic ultrapure water at last.
4. detection method according to claim 1 is characterized in that, the reaction conditions of PCR reaction is in the step (2): 92～95 ℃, and 3～5 minutes; 92～95 ℃, 10～15 seconds, 55～65 ℃, 10～35 seconds, totally 40 circulations; Be preferably: 94 ℃, 4 minutes; 94 ℃, 15 seconds, 60 ℃, 35 seconds, totally 40 circulations.
5. detection method according to claim 1; It is characterized in that; PCR reaction in the step (2) is provided with negative Quality Control group and BK virus quantitative criterion article I～IV group; The template to be measured of wherein negative Quality Control group is a pure water, and the template to be measured of BK virus quantitative criterion article I～IV is respectively BKV quantitative criterion article I, BKV quantitative criterion article II, BKV quantitative criterion article III, BKV quantitative criterion article IV.
6. detection method according to claim 5 is characterized in that, the construction process of BKV quantitative criterion article I～IV may further comprise the steps:
(1) preparation detection reaction system adds the viral genome of purifying, and carries out the PCR reaction;
(2) amplified production is inserted T vector construction recombinant plasmid, increase behind the recombinant plasmid transformed bacterium;
(3) utilize uv analysis method to measure absorbancy behind the purification recombinant plasmid, calculate plasmid concentration, at last recombinant plasmid is diluted to 4 gradients 5 * 10
5～5 * 10
8Copies/ml is respectively as the BKV quantitative criterion article I-IV of test kit.
7. according to the described detection method of claim 1～6, it is characterized in that the treatment process of described sample to be tested comprises: magnetic bead extraction method, post formulation, boiling lysis and cetyl trimethylammonium bromide method, preferred boiling lysis.
8. detection method according to claim 1 is characterized in that, the quantitative real time PCR Instrument detection reaction if S type amplification curve does not appear in sense channel, is judged to the BK virus feminine gender as a result the time; If S type amplification curve appears in sense channel, the typical curve that utilizes the detection of BKV quantitative criterion article to be generated calculates the concentration of sample to be tested.
9. the detection kit of a BK virus; It is characterized in that; Described test kit comprises: PCR reaction solution, hot resistant DNA polymerase, template to be checked, negative Quality Control group and BK virus quantitative criterion article I～IV group; Wherein, contain Auele Specific Primer BKV-F, Auele Specific Primer BKV-R and Taqman fluorescent probe BKV-P in the described PCR reaction solution.
10. the detection kit of the described BK virus of claim 9 is detecting and/or the application of diagnosis BK virus in diseases related diseases related hemorrhagic cystitis, progressive multifocal leukoencephalopathy, pulmonary disorder, tumour or the autoimmune disorder that is selected from BK virus dependency ephrosis, bone marrow transplantation patient of BK virus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101526839A CN102690894B (en) | 2011-06-08 | 2011-06-08 | Detection method of BK virus as well as kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011101526839A CN102690894B (en) | 2011-06-08 | 2011-06-08 | Detection method of BK virus as well as kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102690894A true CN102690894A (en) | 2012-09-26 |
| CN102690894B CN102690894B (en) | 2013-05-01 |
Family
ID=46856630
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011101526839A Expired - Fee Related CN102690894B (en) | 2011-06-08 | 2011-06-08 | Detection method of BK virus as well as kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102690894B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745723A (en) * | 2015-01-30 | 2015-07-01 | 湖北永邦医疗科技有限公司 | Primers, probe and kit used for detecting BK viruses (BKVs) |
| CN106065420A (en) * | 2016-07-29 | 2016-11-02 | 北京思尔成生物技术有限公司 | The detection method of BK virus, test kit and application thereof |
| CN112522440A (en) * | 2020-11-13 | 2021-03-19 | 苏州奥根诊断科技有限公司 | Primer group and probe group for simultaneously detecting BK virus and JC virus and application thereof |
| CN114107571A (en) * | 2022-01-18 | 2022-03-01 | 复旦大学附属中山医院 | Kit for LAMP detection of BK virus |
| WO2023019671A1 (en) * | 2021-08-20 | 2023-02-23 | 广州达安基因股份有限公司 | Method and kit for constructing fluorescent oligonucleotide standard curve |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101511995A (en) * | 2005-08-02 | 2009-08-19 | 焦点诊断公司 | Methods and compositions for detecting BK virus |
| US20090246754A1 (en) * | 2008-02-19 | 2009-10-01 | Intelligent Mdx | Optimized probes and primers and methods of using same for the detection and quantitation of bk virus |
| CN102066580A (en) * | 2008-02-20 | 2011-05-18 | 岩城公輔 | Detection of polyomavirus |
-
2011
- 2011-06-08 CN CN2011101526839A patent/CN102690894B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101511995A (en) * | 2005-08-02 | 2009-08-19 | 焦点诊断公司 | Methods and compositions for detecting BK virus |
| US20090246754A1 (en) * | 2008-02-19 | 2009-10-01 | Intelligent Mdx | Optimized probes and primers and methods of using same for the detection and quantitation of bk virus |
| CN102066580A (en) * | 2008-02-20 | 2011-05-18 | 岩城公輔 | Detection of polyomavirus |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104745723A (en) * | 2015-01-30 | 2015-07-01 | 湖北永邦医疗科技有限公司 | Primers, probe and kit used for detecting BK viruses (BKVs) |
| CN106065420A (en) * | 2016-07-29 | 2016-11-02 | 北京思尔成生物技术有限公司 | The detection method of BK virus, test kit and application thereof |
| CN112522440A (en) * | 2020-11-13 | 2021-03-19 | 苏州奥根诊断科技有限公司 | Primer group and probe group for simultaneously detecting BK virus and JC virus and application thereof |
| WO2023019671A1 (en) * | 2021-08-20 | 2023-02-23 | 广州达安基因股份有限公司 | Method and kit for constructing fluorescent oligonucleotide standard curve |
| CN114107571A (en) * | 2022-01-18 | 2022-03-01 | 复旦大学附属中山医院 | Kit for LAMP detection of BK virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102690894B (en) | 2013-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102690895B (en) | Detection method of JC virus as well as kit and application thereof | |
| CN110184389B (en) | Application of crRNA-targeted PCR-CRISPR system in detection of HBV DNA | |
| US9745638B2 (en) | Methods and compositions for detecting BK virus | |
| WO2021175298A1 (en) | Novel coronavirus detection reagent and detection method | |
| CN103045755B (en) | A kind of fluorescent quantitative PCR detection method detecting Ebola virus and primer thereof and test kit | |
| CN102690894B (en) | Detection method of BK virus as well as kit and application thereof | |
| CN103820573A (en) | Fluorescent quantitation PCR (polymerase chain reaction) detection kit for four conventional herpesvirus hominises | |
| CN103642945A (en) | Reference-containing high-sensitivity fluorescent quantitative polymerase chain reaction (PCR) kit for Epstein-Barr virus | |
| CN101633964A (en) | RNA detection kit for influenza A H1N1 virus | |
| CN103773898A (en) | Triple detection kit for human herpes viruses HSV-1, HSV-2 and HCMV | |
| CN106676198A (en) | High-sensitivity quantitative detection kit for herpes virus 4 and herpes virus 5 | |
| CN113846191B (en) | Primer and probe for detecting novel coronavirus and application of primer and probe | |
| CN103484568B (en) | Method and kit for dual fluorescence quantitative PCR detection of grass carp reovirus types I and II | |
| CN103014135B (en) | A kind of method identifying mycobacterium tuberculosis | |
| CN103820574B (en) | Human herpes virus type 6 real-time fluorescence quantitative PCR parting detecting reagent | |
| CN107119148B (en) | PCR primer group and probe for detecting HIV-12-L TR DNA, kit and detection method thereof | |
| Ozoemena et al. | Comparative evaluation of measles virus specific TaqMan PCR and conventional PCR using synthetic and natural RNA templates | |
| CN105039599A (en) | Primers, probes and kit for typing qualitative detection of hepatitis B virus (HBV) | |
| CN104911277A (en) | Kit for detecting HIV-1 in dried blood spot specimen and detection method thereof | |
| US20170233832A1 (en) | Quantitative measurement of Hepatitis B virus cccDNA | |
| CN104745724A (en) | Primers, probe and kit used for detecting JC viruses (JCVs) | |
| CN102108423A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting type-16 and type-18 human papilloma viruses (HPVs) | |
| CN104745722A (en) | Primers, probe and kit used for detecting varicella zoster viruses (VZVs) | |
| CN109913589B (en) | Primer probe composition, kit and method for detecting herpes zoster virus | |
| CN104004837B (en) | PCR (polymerase chain reaction) primer, primer group, probe and kit for detecting mycobacterium tuberculosis and detection method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130501 Termination date: 20150608 |
|
| EXPY | Termination of patent right or utility model |