CN102690335B - Polypeptide for effectively inhibiting activity of influenza virus polymerase - Google Patents

Abstract

The invention provides a polypeptide for effectively inhibiting activity of influenza virus polymerase, wherein the amino acid sequence of the polypeptide comprises amino acid of PB1 731-757locus of subunit of influenza virus polymerase.

Description

The polypeptide of establishment influenza virus polymerase activity

Technical field

The present invention relates to can establishment influenza virus polymerase activity polypeptide.

Background technology

Influenza virus can both be caused a large amount of personnel's death every year; the Global prevalence of the H1N1 that occurs has recently caused very large loss to life and the economic asset of human society, so the propagation that effectively suppresses influenza virus is to promoting and to protect mankind civilized significant.The effective influenza medicine that uses now has Amantadine (amantadine), Oseltamivir (Oseltamivir), Zanamivir (zanamivir) etc., for the ionophorous protein (M2) of influenza virus, reach surface protein (NA) (2) respectively.But also there are some problems in these small-molecule drugs, such as the appearance of resistance virus.So we need more means to suppress the propagation of influenza virus.

Influenza virus polymerase is to be responsible for the important mixture (1,16,19) that influenza virus is copied and transcribes by the heterotrimer mixture that 3 albumen (PB2, PB1, PA) form.Behind the virus infection cell, can utilize the protein-synthesizing system of host cell to synthesize the albumen of self, comprise new synthetic PB2, PB1 and PA albumen.New synthetic albumen PB1 and PA are assembled into dimer in tenuigenin, be assembled into the tripolymer with complete function with PB2 again in nuclear and exercise the function (4) of transcribing and copying.Influenza virus polymerase in vivo functionating also needs the participation of NP albumen, and NP mainly participates in the combination of RNA, and and PB2, the interaction of host's factor (12,13,16).Along with deepening continuously of infected by influenza Polymerase Structure and function understanding, influenza virus polymerase becomes the new effective target spot (2,6,17,20) that people develop the influenza medicine now.The assembling of PA and PB1 mainly is that the 1-25 amino acids that the N by the C of PA end and PB1 holds (hereinafter is called PB1 _1-25, the fragment of infected by influenza polymerase is used in this similar naming method herein) participate in, the crystalline structure of this mixture is resolved (9,14); And the assembling of PB1 and PB2 mainly is to be mediated by the 676-757 amino acids (hereinafter being called PB1c) of PB1 and the 1-40 amino acids (hereinafter being called PB2n) of PB2, and relevant crystallographic structural analysis out (15,18) is arranged; The crystalline structure of above-mentioned two mixtures all is the target of extraordinary polypeptide or small-molecule drug.On evolving, the influenza virus polymerase structure and function is very conservative all, has better broad spectrum and resistance (6,20) for the medicine of influenza virus polymerase with respect to the medicine for surface protein.

It is maximum that the functional study of infected by influenza polysaccharase is used is the micro-replication system (minireplicon system) of influenza virus polymerase, namely at needed 4 the albumen PB2 of cells influenza virus polymerase functionating, PB1, PA and NP, express again in addition a RNA reporter gene, the reporter gene reverse complemental is cloned between the 5 ' end and 3 ' end of conservative geneome RNA (vRNA) promotor of influenza virus, the first meeting of reporter gene is transcribed out one 5 ' and 3 ' end with the RNA (reporter gene is reverse complemental) of the promotor of influenza virus by intracellular rna plymerase i mixture, then the influenza virus polymerase of cell inner expression can be identified this promotor RNA, thereby copy reporter gene and be forward clone's mRNA, thereby in cell, translate the protein product (5) of reporter gene.After saying that simply transit cell dyes the carrier of expressed rna reporter gene, as long as in the cell enough influenza virus polymerases or influenza virus are arranged, just can in cell, detect the expression (5 of reporter gene, 6,22), this also is the good system of studying for the medicine of influenza virus polymerase, in the time of medicine energy establishment influenza virus polymerase activity, the expression amount of reporter gene will be low, otherwise can be high.

PB1 is found in research before _1-25Can effectively suppress copying of influenza virus.Thereby the activity that this fragment mainly is the assembling by blocking-up PA and PB1 suppresses influenza virus polymerase has suppressed copying of influenza virus, this fragment and use and apply for a patent (the patent No.: PCT/EP2009/055632) (20).Also find out thus, polypeptide drugs have broad application prospects in the prevention and control field of the especially highly pathogenic influenza virus of control of influenza virus.

Summary of the invention

Based on the understanding to PB1 and PB2 assembling process, the assembling that is PB1 and PB2 is mainly mediated by PB1c and PB2n, and with reference to the crystalline structure (PDBID 2ZTT) of the mixture of PB1c and PB2n, we infer that the 731-757 amino acids of the C end of PB1 (hereinafter is called PB1 _731-757, its aminoacid sequence is shown in SEQ ID NO.1) and may participate in PB1 and PB2 assembling.Cytologic experiment shows PB1 _731-757The activity of infected by influenza polysaccharase has good inhibition.The virusology experiment shows PB1 _731-757Copying of infected by influenza has good inhibition.And find PB1 _731-757With the infected by influenza polysaccharase of having reported the fragment PB1 of inhibition is arranged _1-25(its aminoacid sequence is shown in SEQ ID NO.2) effect aspect the inhibition virus replication is suitable.Therefore, polypeptide PB1 of the present invention _731-757Have extraordinary practical value and application prospect as a kind of polypeptide drugs that can the establishment influenza virus.

More specifically, the invention provides the following:

1. polypeptide that be used for to suppress the influenza virus polymerase activity, its aminoacid sequence comprises the amino acid (SEQ ID NO:1) of influenza virus polymerase PB1 731-757 position.

2. nucleotide sequence, its coding is according to 1 polypeptide.

3. comprise the expression vector according to 2 nucleotide sequence.

4. comprise the cell according to 3 expression vector.

5. a use suppresses the method for influenza virus polymerase activity according to 1 polypeptide, and described method comprises can be by in people's cell of virus infection after being transfected in advance according to 3 carrier.

According to 1 polypeptide, according to 2 nucleotide sequence, according to 3 expression vector or according to 4 cell for the preparation of the application in the medicine that suppresses the influenza virus polymerase activity.

The invention will be further described below in conjunction with specific embodiment.

Description of drawings

Fig. 1 .PB1 _731-757Interaction object and intensity;

Fig. 2. polypeptide fragment PB1 _731-757The inhibition of infected by influenza WSN33 polymerase activity (Fig. 2 A) and the inhibition (Fig. 2 B) that viral WSN33 is copied.

Embodiment

Embodiment 1, fragment PB1 _731-757Selection

Can find out that according to the crystalline structure (PDB ID 2ZTT) (18) of PB1c and PB2n the 2nd α spiral of the 3rd α spiral of PB1c and PB1c and PB2n are very close, the side chain of a lot of residues has direct interaction.Whether the 3rd α spiral not mentioned PB1c in the existing document can participate in separately the interaction with PB1c or PB2n directly, and what function this zone has also unclear in the assembling of PB1c and PB2n.We think that the 3rd the α spiral of PB1c may can interact with the 2nd α spiral or the PB2n of PB1c.Therefore we choose upper the 3rd the α spiral (PB1 of PB1c _736-755) and respectively prolonged 5 and 2 amino acid at N end and C end, with the stability of maintenance αhelix, namely with PB1 _731-757As detected object, see that can this fragment interact with PB1c or PB2n, and see the activity that can suppress influenza virus polymerase after crossing expression in vivo.

Embodiment 2, detection PB1 _731-757Interaction with PB1c or PB2n

Method with BiFc (bimolecular fluorescence complementary mensuration) detects PB1 _731-757Interaction with PB1c or PB2n.

The principle of BiFc is: fluorescin is cut in some specific site, form 2 polypeptide of not fluorescent N and C end, be called N fragment (N-fragment) and C fragment (C-fragment).These 2 fragments when coexpression or external mixing, can not spontaneously be assembled into complete fluorescin in cell, can not produce fluorescence when the excitation of this fluorescin.But, when being connected respectively to 1 group, the fragment of these 2 fluorescins has on the interactional target protein, in cell during this 2 fusion roteins of coexpression or external mixing, because the interaction of target protein, the spatially complementation adjacent to each other of 2 fragments of fluorescin, be reconfigured to the activated fluorescin molecule of complete tool, and under the excitation of this fluorescin, emitting fluorescence.In brief, if interaction is arranged between the target protein, then under the exciting of exciting light, produce the fluorescence of this fluorescin.Otherwise if do not interact between the protein, then can not be excited produces the fluorescence (10,11,21) of corresponding fluorescin.

In this experiment, we are divided into N end (1-154) and C end (155-238) with YFP albumen (yellow fluorescence protein) in 154 site, be cloned into carrier pBiFC1 and pBiFc3 upper (21), primer such as following table 1, constructed carrier is designated as respectively pYF-YN155 and pYF-YC155, and the fragment of this plasmid expression is noted by abridging respectively and is YN and YC; Design primer (seeing Table 1), PB1 will encode _731-757Nucleotide sequence (SEQ ID NO.3), the nucleotide sequence of coding PB1c and PB2n is respectively from template pBD-PB1 and the pBD-PB2 (gene that comes from the A type high pathogenic avian influenza H5N1 that separated in 1996 in the goose body in Guangdong, the strain name is called: A/Goose/Guangdong/1/96 (H5N1), about the source of plasmid referring to document (9) and (18)) in amplification out, PB1c and PB2n are cloned into respectively the upward downstream of the nucleotide sequence of coding YN fragment of pYF-YN155, the fusion rotein of expressing is designated as respectively YN-PB1c and YN-PB2n, with PB1 _731-757Be structured in the downstream of the nucleotide sequence of the upper coding of pYF-YC155 YC fragment, the fusion rotein of expression is designated as YC-PB1 _731-757, primer sees Table 1; The promotor of carrier is the GalI promotor, and this promotor can make downstream gene expression when having semi-lactosi to induce, and can not express at the substratum middle and lower reaches gene that contains raffinose.

The used restriction enzyme site of table 1 molecular biology experiment and primer

After building carrier, with PEG/LiAc method (7,21) (genotype is: MAT α it to be transformed into yeast ySC8, ade2-1ura3-1his3-11,15trp1-1leu2-3,112can1-100lys2::hisGbar1::hisGpep4::kanM) in (3), the yeast through transforming is applied to 2 scarce solid mediums, and (every 100ml substratum contains: 0.17g yeast nitrogen (YNB), 0.5g (NH ₄) ₂SO ₄, 2g glucose, 2g agar, the 16 kind indispensable amino acid powder of 0.065g except leucine, tryptophane, all available from Beijing ancient cooking vessel state company) solid plate on.Coat in the incubator that is put in 30 ℃ behind the flat board and cultivated 2 days, afterwards with the bacterium picking that grows on the flat board and be transferred to 2 of liquid and lack that (every 100ml substratum contains: 0.17g yeast nitrogen (YNB), 0.5g (NH in the substratum ₄) ₂SO ₄, 2g raffinose, the 16 kind indispensable amino acid powder of 0.065g except leucine, tryptophane), cultivated 40 hours for 30 ℃.Remove substratum, (every 100ml substratum contains: 0.17g is without amino yeast nitrogen (YNB), 0.5g (NH to change inducing culture into ₄) ₂SO ₄, 2g raffinose, 4g semi-lactosi, the 16 kind indispensable amino acid powder of 0.065g except leucine, tryptophane), cultivated 40 hours in 20 ℃, remove substratum, add 100ul phosphate buffered saline buffer (PBS), detect (available from Tecan with microplate reader, model is GENios) YFP signal and OD600, the value of the value OD600 of measured YFP is carried out normalization method, obtains relative fluorescence value (YFP/OD600).If the relative fluorescence value of test set just thinks that than two control groups all significant high (student t check, p value＜0.05) interaction is positive, otherwise negative (21).

For detecting PB1 _731-757With the interaction of PB2n, with the expression YC-PB1 of correspondence _731-757Forward to simultaneously among the yeast strain ySC8 with as the test set (YN-PB2n+YC-PB1 among Figure 1A with two plasmids of YN-PB2n _731-757, "+" expression plasmid cotransformation yeast of expressing two fragments), prepare simultaneously two control group: YN-PB2n+YC and YN+YC-PB1 _731-757, namely only express wherein a kind of control group of albumen.

Result (Figure 1A) shows YN-PB2n+YC-PB1 _731-757The relative fluorescence value of group is unlike two control groups (YN-PB2n+YC and YN+YC-PB1 _731-757) the relative fluorescence value high.So PB1 _731-757Can not interact with PB2n.

In order to detect PB1 _731-757With the interaction of PB1c, will express YC-PB1 _731-757Forward to simultaneously among the yeast strain ySC8 with as the test set (YN-PB1c+YC-PB1 among Figure 1B with two plasmids of YN-PB1c _731-757, "+" expression plasmid cotransformation yeast of expressing two fragments), also prepare simultaneously two control group: YN-PB2n+YC and YN+YC-PB1 _731-757, namely only express wherein a kind of control group of albumen.

Result (Figure 1B) shows YN-PB2n+YC-PB1 _731-757The relative fluorescence value of group is than control group (YN-PB2n+YC and YN+YC-PB1 _731-757) the relative fluorescence value double about.So PB1 _731-757Energy and PB1c interact.

Embodiment 3, polypeptide fragment PB1 _731-757Be cloned on the carrier for expression of eukaryon pFA-Flag-GFP carrier

Method with rite-directed mutagenesis suddenlys change the NdeI restriction enzyme site among the carrier pcDNA3.1-6HA (8) fall, and primer is NdeI-F:CATCAAGTGTATCGTATGCCAAGTAC; NdeI-R:CGTACTTGGCATACGATACACTTGATG.The correct postscript that checks order is pcDNA3.1-6HA-M, design primer: Flag-F:CCCAAGCTT CATATGGACTACAAAGACGATGACGACAAG GGATCCGTGAGCAAGGGCGAGGAG; Flag-R:CCGGAATTCCCCGGGACTACTTGTACAGCTCGTCCATGC, Flag-GFP is increased out from template pEGFP-N1 (available from clontech), use HindIII, EcoRI (production of Takara company) enzyme is cut resulting PCR product, and reclaim enzyme and cut product, this enzyme is cut product to be connected to and to use HindIII, on the carrier pcDNA3.1-6HA-M that EcoRI (production of Takara company) enzyme is cut and reclaimed, obtain pFA-Flag-GFP, wherein the Flag both sides are with NdeI, the restriction enzyme site of BamHI (underscore represents), after order-checking is correct, the vector construction after being used for.

Design special primer (seeing Table 1) is with PB1 _731-757From the template pBD-PB1 (gene that comes from the A type high pathogenic avian influenza H5N1 that in the goose body in Guangdong, separated in 1996, the strain name is called: A/Goose/Guangdong/1/96 (H5N1), about the source of plasmid referring to document (9) and (18)) in amplification out, use NdeI, PCR product and the carrier pFA-Flag-GFP of BamHI (production of Takara company) double digestion gained, connect with T4 ligase enzyme (production of Takara company), be transformed in the TOP10 competent cell (available from Beijing GenStar company), order-checking is identified correct and is designated as in this article pFA-PB1 _731-757-GFP, the Flag fragment that is about in the pFA-Flag-GFP carrier replaces with PB1 _731-757Fragment.The clone of other fragments adopts same strategy.Hereinafter unless otherwise indicated, just represent to express the carrier of the fusion rotein (peptide-GFP) that different peptide (peptide) links to each other with GFP with pFA-peptide-GFP.

Embodiment 4, in the 293T cell, detect fragment PB1 _731-757The inhibition of infected by influenza WSN33 polysaccharase

Spread HEK293T cell (ATCC:CRL-11268) the day before yesterday of transfection in 6 orifice plates (available from Corning company); Transfection when treating that cell grows to 60%-80% density; The required plasmid pcDNA-PB2 in every hole, pcDNA-PB1, pcDNA-PA are 90ng, pcDNA-NP is 300ng, it is respectively applied to express albumen PB2, PB1, PA and the NP of viral A/WSN/33, this is in vivo 4 essential albumen of functionating of influenza virus polymerase, and the source of these 4 kinds of plasmids sees also reference (4); PPolI-NP-Luc is 50ng, gene reverse complemental with Photinus pyralis LUC during carrier construction is cloned in the conservative promotor 5 ' of A type influenza virus and 3 ' end centre, activity for detection of influenza virus polymerase, the influenza virus polymerase activity is high, then the activity of Photinus pyralis LUC is just high, vice versa, and the source of this plasmid is referring to document (6); PRenilla (available from Promega) is 100ng, directly express sea pansy (Renilla) luciferase after the transfection, the height of transfection efficiency is embodied directly on the active height of renilla luciferase, is used for normalization method transfection efficiency (signal of Photinus pyralis LUC is divided by the signal of renilla luciferase); And the multiple plasmid pFA-peptide-GFP (pFA-PB1 that makes up among 900ng the present invention _731-757-GFP or pFA-PB1 _1-25-GFP), be used for the fusion rotein (PB1 of expression of peptides and GFP _731-757-GFP or PB1 _1-25-GFP); Detailed process is as follows:

1) during transfection, (polyethyleneimine writes a Chinese character in simplified form first to prepare PEI in the EP pipe, available from Sigma company) mixture, according to plasmid: PEI=1: 2 (mass volume ratio) transfection, PEI is added among the 100ul opti MEM (Gibicol) concussion mixing, centrifugal 30 seconds (whizzer model C entrifuge 5424 of 3000rpm, available from Eppendorf company), room temperature is placed 5min;

2) get another EP pipe prepare dna mixture, above-mentioned 7 kinds of plasmids are mixed, add among the 100ul opti-MEM, the concussion mixing, centrifugal 30 seconds of 3000rpm is the DNA mixture;

3) after the PEI mixture is placed 5min, the PEI mixture is dropwise joined in the DNA mixture, the concussion mixing, centrifugal 30 seconds of 3000rpm, room temperature is placed 25min;

4) behind the 25min, the 3rd mixture that goes on foot evenly is added drop-wise in 6 orifice plates of 293T cell, puts into cell culture incubator, cultivate after 24 hours, lysing cell detects.The difference of negative control and experimental group is to replace pcDNA-PB2 with pcDNA3.1-6HA.

Detect the activity (Dual-Luciferase with promega is measured test kit) of Lampyridea and renilla luciferase behind the transfection 24h, specific practice is: remove first substratum, wash cell once with the 1mlPBS/ hole, remove PBS; With 300ul PLB lysate lysing cell, put room temperature 2-3min, then all cell pyrolysis liquids are collected in repeatedly piping and druming; Put again to-80 ℃ of freeze thawing once; After putting dissolving on ice, the centrifugal 1min of 12000rpm gets the 30ul supernatant and detects Photinus pyralis LUC and renilla luciferase signal with GENiosPlus microplate reader (available from Tecan company), and each gets final product the damping fluid of detection with 50ul; Photinus pyralis LUC activity value after the normalization method of one group of Flag-GFP is made as 100%, other groups with its relatively, be worth lowlyer, illustrate that the inhibition of polypeptide infected by influenza polymerase activity is better; Be worth highlyer, illustrate that the inhibition of polypeptide infected by influenza polymerase activity is poorer.

Result (Fig. 2 A) shows PB1 _731-757The activity that can well suppress influenza virus polymerase, and PB1 _1-25Effect suitable.

Embodiment 5, in the human lung cancer cell A549, detect PB1 _731-757The inhibition of fragment infected by influenza

In 24 orifice plates (available from Corning company), cultivate A549 cell (ATCC, CCL-185), when Growth of Cells to full scale is 60%, with the pFA-peptide-GFP (pFA-PB1 of 0.45ug _731-757-GFP or pFA-PB1 _1-25-GFP is respectively applied to express PB1 _731-757-GFP, PB1 _1-25-GFP) pPolI-Gluc-Infection (22) with 0.35ug is transfected in the cell by embodiment 4 described PEI transfection methods, wherein pPolI-Gluc-Infection is for detection of what of virus, principle is the same with pPolI-NP-Luc, difference is that reporter gene is not Photinus pyralis LUC, but Gluc.Behind this carrier transfection A549 cell, as long as there is A type influenza virus in the cell, cell will be secreted Gluc in substratum, virus is more in the cell, luciferase signal in the substratum can be stronger, vice versa, can detect polypeptide with this method whether virus is had inhibition.(90-100% full scale) removes cell culture medium behind the transfection 12h; Wash 2 times with PBS; With 1ml WSN33 virus infection liquid inductance transfect cell (infection multiplicity is 0.01-0.03, and the full name of WSN33 is A/WSN/33, is the A type H1N1 virus that was separated at Wisconsin in 1933 at first), 37 ℃, 2h; Remove supernatant, wash 2 times with PBS; Add virus infection liquid liquid 2ml; Contrast is not for infecting the group (Mock) of virus.

Infect the uciferase activity that detects cell after 12 hours: get supernatant 60ul, 8000rpm, 2min gets supernatant, is put in-20 ℃ of freeze thawing and once detects afterwards; Be made as 100% after the uciferase activity value of the transfection Flag-GFP fusion rotein group that records being cut the uciferase activity value of the group that does not infect virus, after the uciferase activity value of other groups that record cuts the luciferase value of the group that does not infect virus equally, compare with the Flag-GFP group, obtain the relative reactivity value, the relative reactivity value is lower, illustrates that the inhibition that the polypeptide infected by influenza copies is better; The relative reactivity value is higher, illustrates that the inhibition that polypeptide convection current induced current Influenza Virus copies is poorer.

Shown in the result (Fig. 2 B), PB1 _731-757Can well suppress copying of influenza virus, itself and the infected by influenza polysaccharase of having reported have the fragment PB1 of inhibition _1-25Effect is suitable aspect the inhibition virus replication.

Reference

1.Boivin，S.，S.Cusack，R.W.Rnigrok，and?D.J.Hart.2010.Influenza?A?virus?polymerase：structural?insights?into?replication?and?host?adaptation?mechanisms.J?Biol?Chem?285：28411-7.

2.Boltz，D.A.，J.R.Aldridge，Jr.，R.G.Webster，and?E.A.Govorkova.2010.Drugs?in?development?for?influenza.Drugs?70：1349-62.

3.Clerc，S.，C.Hirsch，D.M.Oggier，P.Deprez，C.Jakob，T.Sommer，and?M.Aebi.2009.Htm1protein?generates?the?N-glycan?signal?for?glycoprotein?degradation?in?the?endoplasmic?reticulum.J?Cell?Biol?184：159-72.

4.Deng，T.，J.Sharps，E.Fodor，and?G.G.Brownlee.2005.In?vitro?assembly?of?PB2?with?a?PB1-PA?dimer?supports?a?new?model?of?assembly?of?influenza?A?virus?polymerase?subunits?into?a?functional?trimeric?complex.J?Virol?79：8669-74.

5.Fodor，E.，L.Devenish，O.G.Engelhardt，P.Palese，G.G.Brownlee，and?A.Garcia-Sastre.1999.Rescue?of?influenza?A?virus?from?recombinant?DNA.J?Virol?73：9679-82.

6.Ghanem，A.，D.Mayer，G.Chase，W.Tegge，R.Frank，G.Kochs，A.Garcia-Sastre，and?M.Schwemmle.2007.Peptide-mediated?interference?with?influenza?A?virus?polymerase.J?Virol81：7801-4.

7.Gietz，R.D.，and?R.H.Schiestl.2007.Large-scale?high-efficiency?yeast?transformation?using?the?LiAc/SS?carrier?DNA/PEG?method.Nat?Protoc?2：38-41.

8.He，W.，X.Ma，X.Yang，Y.Zhao，J.Qiu，and?H.Hang.2011.A?role?for?the?arginine?methylation?of?Rad9?in?checkpoint?control?and?cellular?sensitivity?to?DNA?damage.Nucleic?Acids?Res39：4719-27.

9.He，X.，J.Zhou，M.Bartlam，R.Zhang，J.Ma，Z.Lou，X.Li，J.Li，A.Joachimiak，Z.Zeng，R.Ge，Z.Rao，and?Y.Liu.2008.Crystal?structure?of?the?polymerase?PA(C)-PB1(N)complex?from?an?avian?influenza?H5N1?virus.Nature?454：1123-6.

10.Hu，C.D.，Y.Chinenov，and?T.K.Kerppola.2002.Visualization?of?interactions?among?bZIP?and?Rel?family?proteins?in?living?cells?using?bimolecular?fluorescence?complementation.Mol?Cell9：789-98.

11.Hu，C.D.，A.V.Grinberg，and?T.K.Kerppola.2006.Visualization?of?protein?interactions?in?living?cells?using?bimolecular?fluorescence?complementation(BiFC)analysis.Curr?Protoc?Cell?Biol?Chapter?21：Unit?21?3.

12.Ng，A.K.，M.K.Lam，H.Zhang，J.Liu，S.W.Au，P.K.Chan，J.Wang，and?P.C.Shaw.2012.Structural?basis?for?RNA-binding?and?homo-oligomer?formation?by?influenza?B?virus?nucleoprotein.J?Virol.

13.Ng，A.K.，H.Zhang，K.Tan，Z.Li，J.H.Liu，P.K.Chan，S.M.Li，W.Y.Chan，S.W.Au，A.Joachimiak，T.Walz，J.H.Wang，and?P.C.Shaw.2008.Structure?of?the?influenza?virus?A?H5N1nucleoprotein：implications?for?RNA?binding，oligomerization，and?vaccine?design.FASEB?J22：3638-47.

14.Obayashi，E.，H.Yoshida，F.Kawai，N.Shibayama，A.Kawaguchi，K.Nagata，J.R.Tame，and?S.Y.Park.2008.The?structural?basis?for?an?essential?subunit?interaction?in?influenza?virus?RNA?polymerase.Nature?454：1127-31.

15.Poole，E.L.，L.?Medcalf，D.Elton，and?P.Digard.2007.Evidence?that?the?C-terminal?PB2-binding?region?of?the?influenza?A?virus?PB1?protein?is?a?discrete?alpha-helical?domain.FEBS?Lett581：5300-6.

16.Ruigrok，R.W.，T.Crepin，D.J.Hart，and?S.Cusack.2010.Towards?an?atomic?resolution?understanding?of?the?influenza?virus?replication?machinery.Curr?Opin?Struct?Biol?20：104-13.

17.Su，C.Y.，T.J.Cheng，M.I.Lin，S.Y.Wang，W.I.Huang，S.Y.Lin-Chu，Y.H.Chen，C.Y.Wu，M.M.Lai，W.C.Cheng，Y.T.Wu，M.D.Tsai，Y.S.Cheng，and?C.H.Wong.2010.High-throughput?identification?of?compounds?targeting?influenza?RNA-dependent?RNA?polymerase?activity.Proc?Natl?Acad?Sci?U?S?A?107：19151-6.

18.Sugiyama，K.，E.Obayashi，A.Kawaguchi，Y.Suzuki，J.R.Tame，K.Nagata，and?S.Y.Park.2009.Structural?insight?into?the?essential?PB1-PB2?subunit?contact?of?the?influenza?virus?RNA?polymerase.EMBO?J?28：1803-11.

19.Torreira，E.，G.Schoehn，Y.Fernandez，N.Jorba，R.W.Ruigrok，S.Cusack，J.Ortin，and?O.Llorca.2007.Three-dimensional?model?for?the?isolated?recombinant?influenza?virus?polymerase?heterotrimer.Nucleic?Acids?Res?35：3774-83.

20.Wunderlich，K.，D.Mayer，C.Ranadheera，A.S.Holler，B.Manz，A.Martin，G.Chase，W.Tegge，R.Frank，U.Kessler，and?M.Schwemmle.2009.Identification?of?a?PA-binding?peptide?with?inhibitory?activity?against?influenza?A?and?B?virus?replication.PLoS?One?4：e7517.

21.Zhang，H.，J.Chen，Y.Wang，L.Peng，X.Dong，Y.Lu，A.E.Keating，and?T.Jiang.2009.Acomputationally?guided?protein-interaction?screen?uncovers?coiled-coil?interactions?involved?in?vesicular?trafficking.J?Mol?Biol?392：228-41.

22.Zhu，W.，J.Zhou，K.Qin，N.Du，L.Liu，Z.Yu，Y.Zhu，W.Tian，X.Wu，and?Y.Shu.2011.A?reporter?system?for?assaying?influenza?virus?RNP?functionality?based?on?secreted?Gaussia?luciferase?activity.Virol?J?8：29.

Claims (5)

1. polypeptide that be used for to suppress the influenza virus polymerase activity, its aminoacid sequence is shown in SEQ ID NO:1.

2. nucleotide sequence, its polypeptide according to claim 1 of encoding.

3. the expression vector that comprises nucleotide sequence according to claim 2.

4. the cell that comprises expression vector according to claim 3.

One kind can be by in people's cell of virus infection after using polypeptide according to claim 1 to come method in vitro inhibition influenza virus polymerase activity, described method to comprise carrier according to claim 3 is transfected in advance.

Images