CN102676537A - Genes originated from eucalyptus and used for increasing plant biomass, recombinant expression vector and application - Google Patents

Abstract

The invention relates to sequences and functions of two eucalyptus genes (namely a WPGS3 gene and a WPGS4 gene) used for increasing plant biomass, belongs to the technical field of biology. At first, RNA (Ribonucleic Acid) in eucalyptus is extracted and is reversely transcribed to cDNA (complementary DNA), and then is subject to deep sequencing to obtain full-length cDNA sequence library of eucalyptus, the similarity comparison is carried out between the sequence of the cDNA sequence library of eucalyptus and amino acid sequences of arabidopsis AtGRF1 protein and arabidopsis AtEBP1 protein published by NCBI (National Center of Biotechnology Information) to obtain the full-length cDNA sequence of the WPGS3 gene and the full-length cDNA sequence of the WPGS4 gene, and finally, the full-length cDNA sequence of the WPGS3 gene and the full-length cDNA sequence of the WPGS4 gene are led into arabidopsis for overexpression. As a result, the biomass of transgenic plants is remarkably improved, and the functions of the two xylophyta genes in growth of dicotyledon are determined through a plant molecular biotechnology method at first.

Description

Come from gene, recombinant expression vector and the application of the increase phytomass of eucalyptus

Technical field

The present invention relates to plant gene and proteins encoded and Application Areas, particularly relate to the WPGS3 gene and WPGS4 gene and proteins encoded and its application that come from eucalyptus at the raising phytomass.

Background technology

Eucalyptus is that Myrtaceae (Myrtaceae) eucalyptus belongs to the general name of (Eucalyptus), is the fine tree species that one was viewed and admired, was used for material, pulpwood, medicine to a kind of collection.Because the tree growth cycle is long; Heredity is assorted high with property; Many proterties belong to the quantitative character of controlled by multiple genes; Conventional breeding technique is difficult to satisfy the requirement of directive breeding eucalyptus new variety, so people place on genetic engineering technique with research emphasis and chance of success and solve the insoluble problem of eucalyptus conventional breeding, quickens the seed selection process of high-quality, high yield eucalyptus new variety.Xylophyta genetic resourceses such as forest are abundant, but the not separated as yet utilization of many natural excellent genes, the function of most gene still is in unknown state.Therefore, the gene that research can increase living weight in the eucalyptus can be and further carries out genetic engineering modified, as to obtain high yield fine tree species and lay the foundation, and is significant.

At present the separation and the Function Identification of forest gene are mainly carried out similarity relatively through the homologous gene with model plant Arabidopis thaliana or tobacco etc.; Set up evolutionary tree; Utilization reverse genetics method is through the function of regulate gene expression like technical study genes such as mistake expression or gene silencings.Su Xiaohua etc. (2009) separate from eastern cottonwood and obtain MADS-box gene PdP1, and in tobacco, cross and express, and cause it to bloom in advance.Li Haixia etc. (2009) import tobacco with the PtDRG01 gene of Cortex Populi Tomentosae, and the tobacco mosaic virus(TMV) Su Liang of transfer-gen plant significantly is less than contrast, shows that this gene has antiviral function.Sonoda etc. change eucalyptus camaldulensis HD-Zip class II transcription factor EcHB1 gene over to tobacco, and transfer-gen plant staple length and dry weight increase, and the increment of blade, root and stem all is higher than contrast.

GRF1, full name is a growth regulator 1, is a member in the GRF family.In plants such as Arabidopis thaliana, barley, wheat and paddy rice, identified the function that is separated to this gene and confirms its coordinate plant growth at present.OsGRF1 in the paddy rice has the function of regulating the stem elongation, and in Arabidopis thaliana, crosses expression AtGRF1 and AtGRF2 can cause blade and cotyledon to increase.Yet it is still blank to the separation and the evaluation of GRF gene in the forest so far.

EBP1, full name are that ErhB3-is conjugated protein, and verified is a kind of and Human genome EBP1 homologous plant-growth regulatory gene.Beatrics etc. find this gene first and confirm that this gene can promote cell proliferation in early days the allelotaxis in tomato and Arabidopis thaliana, change fissional critical size and shorten the mitotic time, promote the expansion of cell in mitosis anaphase.The expression excessively of Arabidopis thaliana EBP1 can make blade enlarge markedly.Yet research and application to forest EBP1 gene are still waiting to carry out.

Summary of the invention

Technical problem to be solved by this invention is, from eucalyptus, clone two with increase relevant gene WPGS3 and the WPGS4 of phytomass, and change its function of Arabidopis thaliana checking over to, thereby the genetic modification that further is applied to forest for this gene lays the foundation.

Another technical problem to be solved of the present invention is that the recombinant expression vector of said gene is provided.

Another technical problem to be solved of the present invention is that the method for the increase living weight of using said gene is provided.

The present invention carries out degree of depth order-checking through the RNA to eucalyptus and obtains eucalyptus full-length cDNA library; Find the aminoacid sequence of AtGRF1 and AtEBP1 proteins encoded then among the NCBI genebank; And carry out sequence similarity with the full-length cDNA library of eucalyptus and compare (tBLASTn); Obtain GRF1 and the cDNA sequence (SEQ ID NO:3, SEQ ID NO:4) of EBP1 in the eucalyptus, and called after WPGS3 (WPGS is WOody PLant GRowth SThe acronym of timulator) and WPGS4.Wherein the WPGS3 mrna length is 783bp; Its encoded protein sequence is SEQ ID NO:1, contains the proteic sequence similarity degree of 260 amino acid and AtGRF1 and reaches 94%; And the WPGS4 mrna length is 987bp; 328 amino acid of encoding, sequence is that the proteic sequence similarity degree of SEQ ID NO:2 and Arabidopis thaliana EBP1 is 84%.

The present invention provides the gene of the increase phytomass that comes from eucalyptus, comprises WPGS3 gene and WPGS4 gene, and the cDNAs of said WPGS3 gene is one of following nucleotide sequence:

1) dna sequence dna of SEQ ID NO:3 in the sequence table;

2) the amino acid acid sequence of SEQ ID NO:1 in the code sequence tabulation;

And the cDNA of said WPGS4 gene is one of following nucleotide sequence:

1) dna sequence dna of SEQ ID NO:4 in the sequence table;

2) the amino acid acid sequence of SEQ ID NO:2 in the code sequence tabulation.

The present invention also provides a kind of recombinant expression vector, is used to express WPGS3 gene or WPGS4 gene, and this recombinant expression vector comprises above-mentioned gene at least.

Further, this recombinant expression vector is pEUV (Eucalyptus Vector).

The present invention also provides a kind of method that improves phytomass, and with the gene transfered plant tissue of above-mentioned increase phytomass, cell or organ impel phytomass to obtain to improve.

Further, said plant is monocotyledons or dicotyledons.

The purpose of this invention is to provide a kind of method that improves phytomass.

The method of raising phytomass provided by the present invention is that the WPGS3 gene with eucalyptus separates with currently known methods with the WPGS4 gene, modifies and designing institute gets.The WPGS3 gene of separating inserts the pEUV carrier with the WPGS4 gene after separating; Utilize binary vector, infect through Agrobacterium and add in the seed that inserts in Arabidopis thaliana, utilize the cauliflower mosaic virus 35S promoter; Make its overexpression, thus the phenotype that phytomass is increased.Utilize 35S promoter to make the gene overexpression on the carrier, the living weight that makes plant gets a promotion under identical planting environment than the plant of wild species.Detailed step is with reference to embodiment.

The present invention has following beneficial effect: the invention provides a WPGS3 gene and a proteins encoded thereof that derives from eucalyptus.Transgenic experiments proves that the mistake of WPGS3 gene is expressed strain system can increase transcribing of growth factor, increases the size of blade and cotyledon.The size of its female leaf and cotyledon is showing and is being higher than wild-type, and therefore under same growing environment and growth time, the expression strain of crossing of WPGS3 gene is to produce more high-biomass, improves phytomass output.

The present invention also provides a WPGS4 gene that derives from eucalyptus.Its proteins encoded ErbB3-conjugated protein 1 is a plant growth regulatory gene, all follows human WPGS4 homology on the function or on the structure.In the early process that organ is grown up, WPGS4 can promote cell amplification, cell size and shortening tissue differentiation time when influencing cell fission.Transgenic experiments proves, the mistake of WPGS4 is expressed plant significantly to be increased than the leaf dish diameter of its wild-type plant, makes it under identical growing environment and growth time, than wild-type plant higher biomass yield is arranged.

Description of drawings

Figure 1A is the carrier data synoptic diagram of pEUV-WPGS3, and 35S represents the cauliflower mosaic virus 35S promoter, and D35S represents away TATA sequence cauliflower mosaic virus 35S promoter.

Figure 1B is the carrier data synoptic diagram of pEUV-WPGS4, and 35S represents the cauliflower mosaic virus 35S promoter, and D35S represents away TATA sequence cauliflower mosaic virus 35S promoter.

Fig. 2 A is that WPGS3 crosses expression mutant strain DNA evaluation.

Fig. 2 B is that WPGS4 crosses expression mutant strain DNA evaluation.

Fig. 3 A is that WPGS3 crosses the T2 generation of expression system and the photo of wild-type plant, and the blade of visible transgenic plant obviously increases.

Fig. 3 B is that WPGS3 crosses T2 generation of expressing system and wild species at after planting 17 days, 20 days, and the comparative graph of 27 days leaf dish diameters, sample size>10, among the t test, P < 0.01.

Fig. 4 A be WPGS3 spend T2 generation of expressing system and with reference to Col 0 (Columbia 0) at 34 days photo after planting, the height of visible transgenic plant is apparently higher than wild-type plant.

Fig. 4 B be WPGS3 spend T2 generation of expressing system and with reference to the height comparison diagram of Col 0 (Columbia 0) at after planting 34 days, sample size 10, in t test, P value < 0.01.

Fig. 5 A is in Arabidopis thaliana, WPGS4 crosses and expresses be T2 generation with wild species at 41 days photo after planting, it is thus clear that the blade of transgenic plant obviously increases.

Fig. 5 B is that WPGS4 crosses and expresses system (left side) and wild species at after planting 41 days blade diameter comparison diagram, and error line is represented standard variance.In t test, P value < 0.01.

Embodiment

The present invention will be described in more detail through specific embodiment and with reference to accompanying drawing below.The embodiment that it should be understood that the following stated is used for explanation rather than restriction the present invention.

One, the preparation of the cDNA of eucalyptus

Method so that Guo at al. 2008 is adopted is chosen fresh eucalyptus (Eucalyptus urophylla x grandis cv DH32-29) blade and petal, and it is freezing to put into liquid nitrogen, puts into-80 ℃ of refrigerators then and preserves subsequent use.

Use CTAB (Cetyltrimethyl Ammonium Bromide, CTAB) method is extracted total tissue RNA, practical implementation: 1) preheating 15 ml CTAB extracting solutions in 65 ℃ of water-baths; 2) grind 2-3 gram eucalyptus freezing tissue in the liquid nitrogen; 3) shift sample to the centrifuge tube that the CTAB extracting solution is arranged, immediately at room temperature with the fierce vortex 30s of 100 ~ 300 rev/mins rotating speed, then 65 ℃ water-bath 4-5 minute; 4) add isopyknic chloroform/primary isoamyl alcohol, vortex mixed, centrifugal 15 minutes of 10000 rev/mins of normal temperature; 5) supernatant is transferred in the new centrifuge tube, repeats extracting once; 6) supernatant is transferred in the new centrifuge tube, adds the lithium chloride of 1/3 volume, to final concentration be 2 M, 4 ℃ of depositions are spent the night; 7) 4 ℃ of full speed centrifugal (rotating speed is 10000 ~ 15000 rev/mins, down together) are 1 hour, abandon supernatant, wash deposition with 500 μ l, 70% ethanol, wash deposition with 500 μ l, 100% ethanol then; 8) with 500 μ l SSTE dissolution precipitations, be transferred in the 1.5 ml centrifuge tubes, add that isopyknic chloroform/the primary isoamyl alcohol extracting once; 9) absolute ethyl alcohol of 2 times of volumes of adding precipitated 2 hours in 30 minutes or-20 ℃-70 ℃ of depositions; 10) 4 ℃ of full speed is centrifugal 20 minutes, precipitated rna; 11) wash deposition with 400 μ l, 70% ethanol earlier, wash deposition with 400 μ l, 100% ethanol then, dry up the water dissolution RNA that handle with the diethylammonium pyrocarbonate of 100 μ l the back; 12) handle the RNA that extracts with the DNA enzyme ,-20 ℃ of preservations are subsequent use.

With total RNA of about 5 μ g eucalyptus leaf tissues, adopt the synthetic cDNA of reverse transcription test kit (Superscript III First Strand) of Invitrogen company.

Two, the clone of WPGS3 and WPGS4 gene

Eucalyptus (name of an article DH32-29) cDNA is delivered to company (Tianjin Bioarray Solutions Ltd.) carry out degree of depth order-checking (deep sequencing) to obtain the cDNA full length sequence.Search the Argine Monohydrochloride sequence that obtains Arabidopis thaliana GRF1 and EBP1 genes encoding through NCBI Genebank; Carry out the similarity comparison with the eucalyptus full length cDNA sequence; Obtain similarity is the highest in the eucalyptus full length cDNA sequence and difference called after WPGS3 and WPGS4, wherein the identical aminoacid sequence of WPGS3 and AtGRF1 accounts for 90%, and similarity is 94%; And the identical aminoacid sequence of WPGS4 and AtEBP1 accounts for 79% of total length, sequence similarity degree 84%.

Obtain WPGS3 full length cDNA sequence (SEQ ID No:3) and WPGS4 full length cDNA sequence (SEQ ID No:4) thus, in view of the above the primer of design clone eucalyptus WPGS3 and WPGS4:

WPGS3-F:?AGAAGTAATGACGCGTGCCGCCGCCGCACCG

WPGS3-R:?GATGGGGCCCACGCGTGGCCTTGGCTGTTTCTTTG

WPGS4-F:?AGAAGTAATGACGCGTTCGGACGACGAGAGAGAG

WPGS4-R:?GATGGGGCCCACGCGTTCTGACCCATTTGGCATTAA

With the method for the Polymerase Chain Reaction (PCR) of existing Kary Mulis research and development, carry out WPGS3 gene amplification, its amplification system is following: 10 X pfx damping fluids, 5 μ l; Sal epsom (50 mM) 2 μ l, dNTPs (10 mM) 1 μ l, primer GRF1-F (10 μ M) 1 μ l; Primer GRF1-R (10 μ M) 1 μ l, eucalyptus cDNA template 2 μ l, pfx high-fidelity enzyme 0.4 μ l (available from Takara company); Water 38 μ l, TV 50 μ l.The pcr amplification program is: 94 ℃ of preparatory sex change of elder generation 5 minutes; Then 94 ℃ 40 seconds, 53 ℃ 40 seconds, 68 ℃ 40 seconds, totally 40 circulations, last 68 ℃ were extended 5 minutes.Its PCR product carries out glue purification with reference to the QIAquick glue pure love test kit of QIAGEN company.

With the method for existing P olymerase Chain Reaction (PCR), carry out WPGS4 gene amplification, its amplification system is following: 10 X pfx damping fluids, 5 μ l; Sal epsom (50 mM) 2 μ l, dNTPs (10 mM) 1 μ l, primer EBP1-F (10 μ M) 1 μ l; Primer EBP1-R (10 μ M) 1 μ l, eucalyptus cDNA template 2 μ l, pfx high-fidelity enzyme 0.4 μ l (available from Takara company); Water 38 μ l, TV 50 μ l.The pcr amplification program is: 94 ℃ of preparatory sex change of elder generation 5 minutes; Then 94 ℃ 40 seconds, 53 ℃ 40 seconds, 68 ℃ 40 seconds, totally 40 circulations, last 68 ℃ were extended 5 minutes.Its PCR product carries out glue purification with reference to the QIAquick glue purification test kit of QIAGEN company.

Three, the acquisition of WPGS3 and WPGS4 transgenic arabidopsis and the observation of proterties thereof

According to the specification sheets of New England Biolab the pEUV carrier is cut at 37 ℃ of enzymes with the MluI restriction enzyme and to be made it become linearity in 4 hours; With target gene PCR product behind the glue purification and the In-fusion test kit that utilizes Invitrogen company after linear pEUV carrier mixes; Goal gene is linked to the pEUV expression vector to be transformed agrobacterium tumefaciens (Agrobacterium tumefaciens) bacterial strain GV3101 and carries out bacterium colony PCR evaluation with the primer of amplification gene; Positive colony is cultivated in a large number; Through dipping in colored dip method arabidopsis thaliana transformation, the present age, results were that T0 is for transgenic seed.T0 is contained the enterprising row filter of MS substratum of 50mg/L Totomycin (hygromycin) for transgenic seed, obtaining transgenic positive plant T1 generation.T1 obtains T2 for seed after for the plant maturation.At last T2 is being contained the enterprising row filter of MS substratum of 25mg/L Totomycin for planting seed; The seed that only changes the pEUV carrier over to could germinate containing on the MS substratum of 25mg/L Totomycin; Germinateing changed the earth field planting over to after 6 days, regularly the upgrowth situation that becomes plant alive was carried out measurement (plant height, the leaf dish diameter of each item growth indexes; Impeller blade number etc.); And compare with the growth indexes (plant height, leaf dish diameter, impeller blade number etc.) of wild-type Arabidopis thaliana of growth under the same conditions.The visible Fig. 3 to Fig. 5 of comparison test result.Shown in Fig. 3 A and Fig. 3 B, WPGS3 crosses the leaf dish diameter of expressing plant and exceeds 20% than wild-type in sowing after 27 days.Shown in Fig. 4 A and Fig. 4 B, WPGS3 crosses the plant height of expressing plant and exceeded 20% at after planting 34 days than wild-type.Shown in Fig. 5 A and Fig. 5 B, WPGS4 crosses the leaf dish diameter of expressing plant and exceeds 40% than wild-type in sowing after 41 days.

Claims (5)

1. come from the gene of the increase phytomass of eucalyptus, it is characterized in that, comprise WPGS3 gene and WPGS4 gene, the cDNAs of said WPGS3 gene is one of following nucleotide sequence:

1) dna sequence dna of SEQ ID NO:3 in the sequence table;

2) the amino acid acid sequence of SEQ ID NO:1 in the code sequence tabulation;

And the cDNAs of said WPGS4 gene is one of following nucleotide sequence:

3) dna sequence dna of SEQ ID NO:4 in the sequence table;

4) the amino acid acid sequence of SEQ ID NO:2 in the code sequence tabulation.

2. a recombinant expression vector is used to express WPGS3 gene or WPGS4 gene, it is characterized in that, this recombinant expression vector comprises the described gene of claim 1 at least.

3. recombinant expression vector according to claim 4 is characterized in that, this recombinant expression vector is pEUV.

4. a method that improves phytomass is characterized in that, with the gene transfered plant tissue of the described increase phytomass of claim 1, cell or organ impel phytomass to obtain to improve.

5. method according to claim 4 is characterized in that, said plant is monocotyledons or dicotyledons.

Images