CN102676415A - Genetic manipulation system based on Hfx. mediterranei and pyrF gene and its application - Google Patents

Abstract

The invention discloses a genetic manipulation system based on Hfx. mediterranei and pyrF genes and its application. The genetic manipulation system comprises recombinant halophilic archaea and a recombinant plasmid carrier. The recombinant halophilic archaea is prepared by defunctionalizing an encoding gene of a protein sequence of SEQ ID NO:1 in initial halophilic archaea. The recombinant plasmid carrier at least contains a replication origin required by replication of Escherichia coli, an expression cassette for screening resistance selectable marker genes of Escherichia coli transformants, an expression cassette of the encoding gene of the protein sequence of SEQ ID NO:1, and polycloning sites for allowing exogenous genes to insert. The genetic manipulation system can be used as a high-efficiency gene knockout system, and can carry out extensive genetic function research and metabolic pathway illumination on Hfx. mediterranei. According to the experiment, the frequency of positive recombinants obtained from genetic transformation by using the inventive system is greatly improved.

Description

A kind of genetic operating system and application thereof based on rich salt bacterium in Mediterranean Sea and pyrF gene

Technical field

The present invention relates to a kind of genetic operating system and application thereof based on rich salt bacterium in Mediterranean Sea and pyrF gene.

Background technology

1977, American Woese found tellurian the third life form-Gu bacterium, had just caused the proposition of life three territory theories, thought that promptly life is made up of ancient bacterium territory (Archaea), bacterium territory (Bacteria) and eukaryote territory (Eucarya).Ancient bacterium territory comprises the ancient bacterium door (Crenarchaeota) of spring, wide ancient bacterium door (Euryarchaeota), first ancient bacterium door (Korarchaeota) and the ancient bacterium door (Nanoarchaeota) of receiving.

Ancient bacterium is similar with eukaryote at (like dna replication dna, transcribe, translation etc.) aspect the transmission of genetic information; Then approaching aspect center metabolism (like production capacity) with bacterium.Therefore, study ancient bacterium and not only be significant, and some important biomolecules that help to understand in the more complicated eukaryote are learned processes for aspects such as the basic law of illustrating life movement, announcement origin of life and spores.See that from the angle of biotechnology the extreme enzyme that ancient bacterium produced that is grown in usually under the extreme environmental conditions more can tolerate rigors (like high temperature, soda acid, organic solvent etc.) than normal enzyme, thereby ancient bacterium has a good application prospect in a lot of fields.

Extremely halophilic archaea is positioned at a branch-wide ancient bacterium door in ancient bacterium territory in systematic evolution tree; It can be grown in the environment of the nearly saturated salt concentration (like salt field, salt lake and the Dead Sea etc.) that contains the 2-5M NaCl that has an appointment; And the speciality with ancient bacterium, extremely halophilic archaea cause biologist's concern day by day.In addition, extremely halophilic archaea has DEVELOPMENT PROSPECT, can supply extreme enzyme, biologically active substance, the biodegradable plastics PHA that develops in a large number and to can be used as the purple membrane etc. that nano meter biomaterial is used to construct biomolecular device as in this quasi-microorganism, existing.Though some progress aspect molecular genetics in recent years; Such as Polyethylene glycol (PEG; Polyoxyethylene glycol) foundation, the gene knockout of the extremely halophilic archaea protoplast transformation method of mediation, the application of technology such as gene complementation and rite-directed mutagenesis in extremely halophilic archaea, but only be confined in some kind; Do not have general applicability, thereby limited further investigation other bacterial strains.In addition; What generally be used for the selection of extremely halophilic archaea resistance mainly is Vulkamycin. PA-93, Anisomycin, nervinolin and thiostrepton etc.; But these resistance selectable marker gene multi-sources obtain in thalline autogene sudden change rear clone; After being applied to the conversion of integrated plasmid carrier system, be prone to take place and the corresponding native gene generation of thalline high frequency homologous recombination, cause the generation of false positive transformant.And these antibiotic selective pressures a little less than, usually can not get transformant.This situation has greatly hindered theoretical investigation and genetically engineered exploitation to the system of going deep into of halophilic archaea.

Summary of the invention

An object of the present invention is to provide a kind of reorganization halophilic archaea.

Reorganization halophilic archaea provided by the present invention; Method according to comprising the steps prepares: make the afunction of proteic encoding sox shown in the SEQ ID NO:1 in the halophilic archaea that sets out that contains proteic encoding sox shown in the SEQ IDNO:1, the reorganization bacterium that obtains is said reorganization halophilic archaea.

In the above-mentioned reorganization halophilic archaea, the halophilic archaea that sets out of proteic encoding sox shown in the said SEQ of the containing ID NO:1 is the rich salt bacterium (Haloferax mediterranei) in Mediterranean Sea.

In above-mentioned arbitrary said reorganization halophilic archaea, the rich salt bacterium in said Mediterranean Sea (Haloferax mediterranei) is the rich salt bacterium (Haloferax mediterranei) in Mediterranean Sea of CGMCC 1.2087 for deposit number.

In above-mentioned arbitrary said reorganization halophilic archaea, the afunction of proteic encoding sox is a proteic encoding sox shown in the SEQ ID NO:1 that knocks out in the said halophilic archaea that sets out shown in the said SEQ ID NO:1 that makes in the halophilic archaea that sets out that contains proteic encoding sox shown in the SEQ ID NO:1;

In above-mentioned arbitrary said reorganization halophilic archaea, said knocking out through homologous recombination realized;

In above-mentioned arbitrary said reorganization halophilic archaea; Said homologous recombination realizes through following homologous recombination vector: said homologous recombination vector makes up according to the method that comprises the steps: DNA shown in the Nucleotide of 1-602 position among the SEQ ID NO:2 is inserted between the KpnI and BamHI site of carrier pUBP recombinant vectors in the middle of the recombinant vectors note that obtains is done along the direction from KpnI to BamHI; DNA shown in the Nucleotide of 1419-1985 position among the SEQ ID NO:2 is inserted between the BamHI and PstI site of carrier pUBP along the direction from BamHI to PstI, and the recombinant vectors that obtains is said homologous recombination vector;

In above-mentioned arbitrary said reorganization halophilic archaea, proteic encoding sox is following 1 shown in the said SEQ ID NO:1) or 2) or 3) or 4) shown in:

1) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 611-1408 position among the SEQ ID NO:2;

2) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 512-1408 position among the SEQ ID NO:2;

3) under stringent condition with 1) or 2) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

4) with 1) or 2) dna sequence dna that limits has homology and the dna molecular of encoding said proteins more than 90%.

Another object of the present invention provides a kind of test kit.

Test kit provided by the present invention comprises above-mentioned arbitrary described reorganization halophilic archaea and following recombinant plasmid vector; At least contain the MCS and following other three elements that supply foreign gene to insert in the said recombinant plasmid vector: in intestinal bacteria, duplicate required replication origin, be used to screen the expression cassette of proteic encoding sox shown in the expression cassette, SEQ ID NO:1 of the resistance selectable marker gene of intestinal bacteria transformant;

The MCS that said confession foreign gene inserts is not overlapping with said other three elements.

Not only contain escherichia coli plasmid replicon (promptly in intestinal bacteria, duplicating required replication origin) but also contain the expression cassette that is useful on the resistance selectable marker gene that screens the intestinal bacteria transformant in the recombinant plasmid vector in the mentioned reagent box, conveniently in intestinal bacteria, carry out genetic manipulation and in halophilic archaea, carry out genetic manipulation.

In above-mentioned arbitrary said test kit, putting in order between each element in the said recombinant plasmid vector do not require.

Preferably, not overlapped between each element in the said recombinant plasmid vector.

In above-mentioned arbitrary said test kit; Said recombinant plasmid vector prepares according to the method that comprises the steps: gene shown in the Nucleotide of 512-1408 position among the SEQ ID NO:2 is inserted between the MCS of carrier pUBP, and the recombinant vectors that obtains is said recombinant plasmid vector.

In above-mentioned arbitrary said test kit; Said recombinant plasmid vector specifically prepares according to the method that comprises the steps: gene shown in the Nucleotide of 512-1408 position among the SEQ ID NO:2 is inserted between the EcoRI and KpnI site of carrier pUBP along the direction from EcoRI to KpnI, and the recombinant vectors that obtains is said recombinant plasmid vector.The physical map of this plasmid is as shown in Figure 1, and the restriction enzyme digestion sites that its MCS comprises has SphI, PstI, BamHI, each one of restriction enzyme site such as KpnI and EcoRI, two HindIII restriction enzyme sites; These restriction endonuclease recognition sites can carry out the clone of exogenous segment and the structure of derivative vector thereof easily.

In above-mentioned arbitrary said test kit, comprise screening culture medium I and/or screening culture medium II in the said test kit;

Per 1 liter of said screening culture medium I is by acid hydrolysis casein, Sodium Glutamate, Trisodium Citrate, NaCl, MgSO ₄7H ₂O, KCl, FeSO ₄7H ₂O, MnCl ₂4H ₂O, uridylic, 5-FOA and water are formed, and wherein the concentration of each component in said screening culture medium I is: acid hydrolysis casein 5.0g/L, Sodium Glutamate 1.0g/L, Trisodium Citrate 3.0g/L, NaCl200g/L, MgSO ₄7H ₂O 20g/L, KCl 2.0g/L, FeSO ₄7H ₂O 0.36g/L, MnCl ₂4H ₂O 0.36mg/L, uridylic 50mg/L, 5-FOA 250mg/L; The pH value of said screening culture medium I is 7.1-7.2; (this is the substratum of screening double exchange bacterial strain)

Per 1 liter of said screening culture medium II is by acid hydrolysis casein, Sodium Glutamate, Trisodium Citrate, NaCl, MgSO ₄7H ₂O, KCl, FeSO ₄7H ₂O, MnCl ₂4H ₂O and water are formed, and wherein the concentration of each component in said screening culture medium II is: acid hydrolysis casein 5.0g/L, Sodium Glutamate 1.0g/L, Trisodium Citrate 3.0g/L, NaCl 200g/L, MgSO ₄7H ₂O20g/L, KCl 2.0g/L, FeSO ₄7H ₂O 0.36g/L, MnCl ₂4H ₂O 0.36mg/L; The pH value of said screening culture medium II is 7.1-7.2.(this changes the substratum of bacterial strain for the screening single cross)

Above-mentioned arbitrary said test kit is following 1) or 2) or 3) in application also belong to protection scope of the present invention:

1) knocks out goal gene in the genome of above-mentioned arbitrary said reorganization halophilic archaea;

2) in above-mentioned arbitrary said reorganization halophilic archaea, cross expression alien gene;

3) function of testing gene in the genome of research bacterium (Haloferax mediterranei).

Another object of the present invention provides a kind of albumen and encoding sox thereof.

Albumen provided by the present invention, be following a) or b) protein:

A) protein of forming by the aminoacid sequence shown in the SEQ ID NO:1;

B) with the aminoacid sequence shown in the SEQ ID NO:1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have Orotidine-5 '-'-single phosphate decarboxylase is active by a) deutero-protein.

Proteic encoding sox provided by the present invention is following 1) or 2) or 3) or 4) shown in:

1) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 611-1408 position among the SEQ ID NO:2;

2) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 512-1408 position among the SEQ ID NO:2;

3) under stringent condition with 1) or 2) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

4) with 1) or 2) dna sequence dna that limits has homology and the dna molecular of encoding said proteins more than 90%.

The recombinant vectors, reorganization bacterium, transgenic cell line, recombinant virus or the expression cassette that contain above-mentioned arbitrary said encoding sox also belong to protection scope of the present invention;

The application as selective marker in genetically engineered of proteic encoding sox shown in the SEQ ID NO:1 also belongs to protection scope of the present invention.

Said genetically engineered is and the relevant genetically engineered of extremely halophilic archaea that contains proteic encoding sox shown in the SEQ ID NO:1.

Proteic encoding sox is following 1 shown in the said SEQ ID NO:1) or 2) or 3) or 4) shown in:

1) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 611-1408 position among the SEQ ID NO:2;

2) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 512-1408 position among the SEQ ID NO:2;

3) under stringent condition with 1) or 2) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

4) with 1) or 2) dna sequence dna that limits has homology and the dna molecular of encoding said proteins more than 90%.

Genetic operating system of the present invention comprises 2 components, and a part is integrated plasmid carrier pHFX, and another part is a Hfx.mediterranei Δ pyrF uracil auxotrophy host bacterium.This genetic operating system can be used as a gene knockout system efficiently, can carry out that gene functional research and pathways metabolism are illustrated widely to Hfx.mediterranei.Experiment showed, that carrying out the frequency that genetic transformation obtains positive recombinant with system of the present invention improves greatly.The present invention has enriched the selectable marker gene in the halophilic archaea; Increase the pressure of selecting; Be easy to the screening of positive transformant; Be beneficial to large-scale functional genomics analysis, and therefrom find the hereditary metabolism of general character and individual character in this colony of halophilic archaea, the mechanism of evolve ecology, the origin of species etc. the halophilic archaea development system.The present invention will play a significant role in the research and development of extremely halophilic archaea for the research and development of extremely halophilic archaea provides important tool.

Description of drawings

Fig. 1 is an integrated plasmid carrier pHFX building process synoptic diagram

Fig. 2 is PyrF Argine Monohydrochloride sequence and Halobacterium salinarum Ura3 albumen (NCBI numbers AFl87997) multisequencing comparison synoptic diagram

Fig. 3 is the agarose gel electrophoretogram of pyrF gene RT-PCR

Fig. 4 knocks out the goal gene principle schematic for utilizing pHFX integrated plasmid carrier

Fig. 5 is that pyrF gene upstream and downstream structure iron and Hfx.mediterranei Δ pyrF two mutants PCR identify agarose gel electrophoresis figure and Southern blot checking result

Fig. 6 is that crtB gene upstream and downstream structure iron and Hfx.mediterranei Δ pyrF Δ crtB two mutants PCR identify agarose gel electrophoresis figure and Southern blot checking result

Embodiment

Employed experimental technique is ordinary method like no specified otherwise among the following embodiment.

Used material, reagent etc. like no specified otherwise, all can obtain from commercial sources among the following embodiment.

Rich salt bacterium (Haloferax mediterranei) CGMCC 1.2087 in Mediterranean Sea is available from Chinese common micro-organisms DSMZ (CGMCC).

The pUCm-T carrier is available from Beyotime, and catalog number is D2006.

Carrier pUBP document " Han; J.; Q.Lu; et al. (2007). " Molecular characterization of thephaEC (Hm); Genes, " Applied and Environmental Microbiology 73 (19): disclosed among the 6058-6065. ' ', the public can obtain from Institute of Microorganism, Academia Sinica required for biosynthesis of poly (3-hydroxybutyrate) in the extremelyhalophilic Archaeon Haloarcula marismortui..

Embodiment 1, Orotidine-5 '-'-acquisition of single phosphate decarboxylase PyrF and encoding sox thereof

Rich salt bacterium (Haloferax mediterranei) CGMCC 1.2087 carries out gene order-checking to Mediterranean Sea, studies its structure, has an orf to be noted as pyrF as a result in this genome.Design a pair of primer P1/P2 and carry out pcr amplification pyrF encoding sox and promoter sequence thereof, primer sequence is following:

P1：5′GGC GAATTCGTTTTCTTGTGTGCGGTT3′( EcoRI)

P2：5′GTT GGTACCTTACCGGTACTGGTTCAG3′( KpnI)

Genome with rich salt bacterium (Haloferax mediterranei) CGMCC 1.2087 in Mediterranean Sea is a template, uses primer that P1 and P2 are carried out pcr amplification as the upstream and downstream primer, obtains the PCR product of 897bp length.

Above-mentioned pcr amplification program is: 94 ℃ of preparatory sex change of 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 60s carry out 30 circulations then; 72 ℃ are extended 7min again.Amplification system is 25 μ l.

The pcr amplification product fragment is connected on the pUCm-T carrier checks order; Sequencing result be illustrated in the gene order inserted in the pUCm-T carrier as among the SEQ ID NO:2 from shown in the Nucleotide of 5 ' end 512-1408 position; Wherein SEQID NO:2 512-610 position Nucleotide is the promoter region of gene PyrF; 611-1408 position Nucleotide is the encoder block of gene PyrF, and 582-589 position nucleotides sequence is classified the promotor core sequence as; The aminoacid sequence of gene PyrF encoded protein is (note is made PyrF albumen) shown in SEQ ID NO:1.Show that primer has obtained the sequence of 897bp to P1/P2 amplification, correct.

The structure of embodiment 2, the evaluation of pyrF gene function and Hfx.mediterranei Δ pyrF

Every liter of AS-168 substratum prepares according to following method: with 5.0g acid hydrolysis casein (casamino acids), and 5.0g yeast extract (yeast extract), 1.0g Sodium Glutamate (sodium glutamate), 3.0g Trisodium Citrate, 200g NaCl, 20g MgSO ₄7H ₂O, 2.0g KCl, 0.36g FeSO ₄7H ₂O and 0.36mg MnCl ₂4H ₂O is dissolved in the zero(ppm) water, is settled to 1 liter with zero(ppm) water, pH 7.1-7.2.

The acid hydrolysis casein is available from Bacto Difco, and catalog number is 223120.Yeast extract is available from OXOID, and catalog number is LP0021.

1.RT-PCR detect pyrF gene transcription situation among the Hfx.mediterranei CGMCC 1.2087.

1) culture condition: picking Mediterranean Sea rich salt bacterium (Haloferax mediterranei) CGMCC 1.2087 single bacterium colonies are in 37 ℃ of shaking tables of AS-168 substratum, and 200rpm cultivated 4 days.

2) RNA extracts: the 1.5ml EP pipe of getting sterilization is collected 1.5ml bacterium liquid, and 4 ℃, 12000rpm, centrifugal 1min exhausts supernatant with liquid-transfering gun.Add 1ml TRIzol reagent (invitrogen) cracking thalline, cell debris, lipid and albumen are removed in the organic solvent extracting, obtain total RNA, are dissolved in the 20-30 μ l DEPC water.Get 1.5 μ l RNA solution and join in the 300 μ l TE solution, measure its concentration with Beckman DU800, contrast is that 300 μ l TE add 1.5 μ l DEPC water.Recording OD260/280 is 2.02, explains that the purity of RNA meets next step requirement of experiment.The concentration that calculates RNA is 6.28 μ g/ μ l.Get total RNA 15 μ g and handle with RNase-free RQ1DNase (Promega), 50 μ L systems (DNase buffer 5 μ l, DNase 5 μ l, 15 μ g RNA, DEPC water complements to 50 μ l), 37 ℃ of reaction 4-5h; 70 ℃, 10min inactivation DNase, with this as the RT template.

3) RT-PCR detects:

According to the nucleotide sequence of pyrF, design a pair of RT-PCR primer pyrFRTF/pyrFRTR, primer sequence is following:

pyrFRTF：5′TTCGTCCTCTGTCGCACCTCT3′

pyrFRTR：5′CTGGTTCAGCCGCTCTTTG3′

With the postdigestive RNA of DNase is template, utilizes OneStep RT-PCR test kit (Qiagen company), carries out RT-PCR according to the specification sheets step.Program was divided into for two steps: the first step, utilize primer pyrFRTR behind the RT-PCR, and be template with total RNA, purpose RNA reverse transcription is become cDNA; Second step, utilize primer to pyrFRTF/pyrFRTR, more than the cDNA in step is a template, carries out PCR.Total RNA with without Dnase digestion makes negative control.The result is as shown in Figure 3: swimming lane 1 is RT-PCR band 381bp; Swimming lane 2 is the total RNA template negative control without Dnase digestion; Swimming lane M is 100bp DNAladder marker.As can beappreciated from fig. 3 the pyrF gene is active transcribes.In addition,, find that this gene only has a copy in genome, help the acquisition of the knocking out of follow-up gene, complementation and auxotrophic strain through the retrieval genome annotation.

2. knock out the pyrF gene among the Hfx.mediterranei CGMCC 1.2087, obtain Hfx.mediterranei Δ pyrF

1) structure of pUBP Δ pyrF

< 1>is used to knock out the pcr amplification of the homologous recombination double exchange arm of pyrF

According to pyrF gene coded sequence and upstream and downstream nucleotide sequence thereof among the SEQ ID NO:2, designed a pair of pair/single cross and changed the amplimer pyrFF1/pyrFR1 and the pyrFF2/pyrFR2 of primers designed P3/P4 and two pairs of double exchange arms:

P3:TGTTGTGGGTTGTCGAAC, (with 483-500 coupling among the SEQ ID NO:2)

P4:CGAGGCCCATGATAAGTC, (with 1502-1519 coupling among the SEQ ID NO:2),

pyrFF1：5′GCT GGTACCCGTCAACATGGCGTACATCC3′( KpnI)

pyrFR1：5′GCG GGATCCAGTGCGACGACCGTATGTAAG3′( BamHI)

pyrFF2：5′GCG GGATCCATCACAGACTGGCACTGGACT3′( BamHI)

pyrFR2：5′ATA CTGCAGGCGTCTGGATGCGTCTCCT3′( PstI)

Genomic dna with Hfx.mediterranei CGMCC 1.2087 is a template, with the double exchange left arm 602bp of primer to pyrFF1/pyrFR1 amplification destruction pyrF, shown in Fig. 5 A.The pcr amplification program is: 94 ℃ of preparatory sex change of 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 40s carry out 30 circulations; 72 ℃ are extended 7min.Amplification system is 25 μ l.The pcr amplification product fragment is connected on the pUCm-T carrier checks order, sequencing result shows that amplification has obtained the sequence of 602bp to primer to pyrFF1/pyrFR1, has the nucleotide sequence from 5 ' end 1-602 position of SEQ ID NO:2;

Genomic dna with Hfx.mediterranei CGMCC 1.2087 is a template, and with primer pyrFF2/pyrFR2 being increased knocks out the double exchange right arm 567bp of pyrF, shown in Fig. 5 A.The pcr amplification program is: 94 ℃ of preparatory sex change of 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 40s carry out 30 circulations; 72 ℃ are extended 7min.Amplification system is 25 μ l.The pcr amplification product fragment is connected on the pUCm-T carrier checks order, sequencing result shows that amplification has obtained the sequence of 567bp to primer to pyrFF2/pyrFR2, has the nucleotide sequence from 5 ' end 1419-1985 position of SEQ ID NO:2.

< 2>knock out the structure of the integrated plasmid carrier pUBP Δ pyrF of pyrF

Will be through the carrier pUBP and the PCR product left arm 602bp of restriction enzyme BamHI and KpnI double digestion; 16 ℃ of connections of T4DNA ligase are spent the night; The heat shock conversion method will connect product transformed into escherichia coli JM109 competence then; Containing the dull and stereotyped enterprising row filter of amicillin resistance, the positive colony that obtains is being checked order; Sequencing result shows that fragment 602bp (its nucleotides sequence classify as sequence 2 in the sequence table from 5 ' terminal 1-602 position nucleotide sequence) has correctly inserted between the BamHI and KpnI site of carrier pUBP (along the direction from KpnI to BamHI), with its called after recombinant vectors pUBP602.

Will be through the recombinant vectors pUBP602 and the PCR product right arm 567bp of PstI and BamHI double digestion; 16 ℃ of connections of ligase enzyme T4DNA ligase are spent the night; The heat shock conversion method will connect product transformed into escherichia coli JM109 competence then; Containing the dull and stereotyped enterprising row filter of amicillin resistance, the positive colony that obtains is being checked order; The result shows that fragment 567bp (its nucleotides sequence classify as sequence 2 in the sequence table from 5 ' terminal 1419-1985 position nucleotide sequence) has correctly inserted between the PstI and BamHI site of carrier pUBP602 (along the direction from BamHI to PstI); Obtain containing the double exchange integrated plasmid carrier of left arm 602bp and right arm 567bp, and with its called after pUBP Δ pyrF.Left arm 602bp and the right arm 567bp fragment note that constitutes that connects together is made Δ pyrF in this plasmid.

2) make up Hfx.mediterranei Δ pyrF

Utilize the double exchange arm of pUBP Δ pyrF and the pyrF in Hfx.mediterranei CGMCC 1.2087 genomes to carry out homologous recombination, knock out the pyrF gene, concrete steps are following:

< 1>pUBP Δ pyrF transforms Hfx.mediterranei

The employing document (Cline, S.W., W.L.Lam, et al. (1989). " Transformation methods forhalophilic archaebacteria. " Can J Microbiol35 (1): the 148-152.) method for transformation of said PEG mediation; PUBP Δ pyrF is transformed rich salt bacterium (Haloferax mediterranei) CGMCC 1.2087 in Mediterranean Sea; Transform the back and on the AS-168 that contains the 3mg/L nervinolin (AS-168 substratum+3mg/L nervinolin) solid plate, screen transformant, the clone that can on the AS-168 that contains the 3mg/L nervinolin, grow is the reorganization bacterium that success changes pUBP Δ pyrF over to.

< 2>bacterial strain is changed in the single cross of screening and checking pUBP Δ pyrF generation integration

The transformant that step < 1>is obtained carries out the PCR checking respectively: extract total DNA, with primer P3/P4 is carried out the PCR reaction, the pcr amplification program is: 94 ℃ of preparatory sex change of 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 60s carry out 30 circulations; 72 ℃ are extended 7min.Amplification system is 25 μ l.The bacterium that produces 1037bp and 222bp band is changed bacterial strain for the purpose single cross.

The screening principle is changed in single cross: when the generation single cross was changed, pUBP Δ pyrF plasmid integration was gone into Hfx.mediterranei genome homology zone, changed the complete pyrF gene of a copy of existence in the bacterial strain and the Δ pyrF of a copy in single cross; With complete pyrF gene is template; Amplification obtains 1037bp, is template with Δ pyrF, and amplification obtains 222bp; Therefore, the genome that changes bacterial strain with single cross is that template can amplify two bands that size is respectively 1037bp and 222bp.

The PCR qualification result is shown in Fig. 5 B: swimming lane 1 changes bacterium for single cross; Swimming lane 3 is a pUBP Δ pyrF plasmid positive control; Swimming lane 4 is Mediterranean Sea rich salt bacterium (Haloferax mediterranei) CGMCC 1.2087 wild-type negative controls.From figure, find out, negative control PCR product size 1037bp, the PCR product size 222bp of positive control, the PCR product size of swimming lane 1 is respectively 1037bp and 222bp, explain that the bacterial strain of correspondence changes bacterial strain for the purpose single cross.

< 3>screening of double exchange bacterial strain Hfx.mediterranei Δ pyrF

With step<2>The pyrF single cross that screens is changed bacterial strain and in not containing the liquid A S-168 substratum of nervinolin, is gone down to posterity and cultivated for 50 generations, repeats to transfer to cultivate the nutrient solution dilution 10 that will go down to posterity after 4 times and cultivate ⁷Applying solid AS-168 culture medium flat plate was cultivated about a week.The picking mono-clonal is simultaneously on the AS-168 solid plate and contain on the solid medium of AS-168 of 3mg/L nervinolin and rule.After one week; Picking is not grown on resistant panel (solid medium that contains the AS-168 of 3mg/L nervinolin) but is gone up single bacterium colony of growth at non-resistance flat board (AS-168 solid plate); Be purpose double exchange bacterial strain, note is made reorganization bacterium Hfx.mediterranei Δ pyrF.

PCR checking: the genomic dna of extracting reorganization bacterium Hfx.mediterranei Δ pyrF carries out the PCR checking with primer to P3/P4 equally as template, reaction system and condition and screen single cross to change bacterial strain identical.It is purpose double exchange bacterial strain that amplification is had to the bacterial strain of 222bp one band.

Southern blot checking: carry out with reference to DIG-High Prime DNA Labeling and Detection Starter Kit I (Roche) specification sheets; Extract the genomic dna of reorganization bacterium Hfx.mediterranei Δ pyrF and the genomic dna of control strain Hfx.mediterranei wild-type earlier; SalI digests with restriction enzyme, and postdigestive product is used for hybridization (Fig. 5 A).The probe that uses among the Southern blot is the double exchange right arm 567bp fragment of above-mentioned pyrF, and uses digoxigenin labeled.The bacterial strain that hybridization obtains the 1608bp band is the double exchange bacterial strain, and the bacterial strain that hybridization obtains the 2424bp band is the Hfx.mediterranei wild type strain.

The PCR qualification result is shown in Fig. 5 B: swimming lane 2 is the double exchange bacterial strain.Show in the swimming lane 2 that PCR product size is 222bp, explain that corresponding bacterial strain is for the Mediterranean Sea rich salt bacterium Hfx.mediterranei that double exchange causes pyrF genetically deficient takes place.Southern blot qualification result is seen Fig. 5 C.Swimming lane 1 is a wild-type, and swimming lane 2 is the double exchange bacterial strain.Southern blot result shows that the double exchange bacterial strain only contains the 1608bp small segment, and the wild-type control strain contains the big fragment of 2424bp, shows that the purpose double exchange bacterial strain that obtains is correct.

Among the SEQ ID NO:2 among the integrated plasmid carrier pUBP Δ pyrF among DNA shown in the Nucleotide of 1-602 position and the SEQ ID NO:2 complete genome pyrF among DNA shown in the Nucleotide of 1419-1985 position and the Hfx.mediterranei homologous recombination takes place, make among the deletion mutantion strain Hfx.mediterranei Δ pyrF and lacked 603-1418 position Nucleotide among the SEQ ID NO:2 among the gene pyrF.

< 4>Hfx.mediterranei Δ pyrF detects 5-fluororotic acid (5-FOA) resistance

Every liter of AS-168SY substratum prepares according to following method: with 5.0g acid hydrolysis casein, 1.0g Sodium Glutamate, 3.0g Trisodium Citrate, 200g NaCl, 20g MgSO ₄7H ₂O, 2.0g KCl, 0.36g FeSO ₄7H ₂O and 0.36mg MnCl ₂4H ₂O is dissolved in zero(ppm) water, and with the distillation water capacity to 1 liter, the mixture that obtains is the AS-168SY substratum, with 10MNaOH manual regulation pH 7.1-7.2.

Hfx.mediterranei Δ pyrF and Hfx.mediterranei CGMCC 1.2087 wild-types are lined respectively to add final concentration be that 50 μ g/ml uridylics (Uracil) and final concentration are 250 μ g/ml 5-fluororotic acid (5-Fluorooroticacid; AS-168SY substratum 5-FOA); In 37 ℃ of cultivations, the growing state of week back observation bacterium.Hfx.mediterranei Δ pyrF two mutants has obtained the 5-FOA resistance as a result, be the uracil auxotrophy bacterial strain, and wild type strain is suppressed, and can not grow single bacterium colony, is uridylic prototroph.This be because; The approach that has the de novo synthesis uridylate in rich salt bacterium Hfx.mediterranei CGMCC 1.2087 bodies of Mediterranean Sea; Thereby can be that substrate utilization produces the virose 5 FU 5 fluorouracil (5-FU of pair cell with 5-FOA (5-fluoroorotic acid); 5-fluorouracil), thus wild type strain in containing the substratum of 5-FOA, can not survive; And gene pyrF (Orotidine 5 '-phosphatedecarboxylase) key enzyme of uridylate route of synthesis final step just; Lacked the pyrF gene among the Hfx.mediterranei Δ pyrF; Lost the uridylate synthesis capability; And lost catalysis 5-FOA and produce cytotoxic compound 5-FU ability, thereby Hfx.mediterranei Δ pyrF can grow having on the substratum of 5-FOA, and need contain uridylic in the substratum.

This plasmid of pUBP does not possess the replicon that in Hfx.mediterranei CGMCC 1.2087, duplicates, thereby can not change separately, can only after being cloned into homologous fragment, lean on homologous recombination just can be integrated into genome.

Above-mentioned experiment has only provided a circumstantial evidence; Prove that this gene pyrF works really in the uridylate route of synthesis; And the albumen multisequencing comparison result shows of Fig. 2; The PyrF protein sequence has 69% sequence similarity with Ura3 among the Hbt.Salinarum that reported, can prove this gene encode really orotidine-5 '-single phosphate decarboxylase.

Illustrating of pyrF gene function helps the follow-up structure that knocks out with expression vector, can be used as a ten minutes effectively selectable marker gene be applied to other genetic operating systems.

Embodiment 3, make up integrated plasmid carrier pHFX based on the pyrF gene

With pUCm-PyrF among the embodiment 1 (contain the pyrF total length and contain self promotor) with restriction enzyme EcoRI and KpnI double digestion and cut glue and reclaim goal gene pyrF fragment; Carrier pUBP with restriction enzyme EcoRI and KpnI double digestion, is reclaimed the big fragment of carrier, the big fragment of carrier is connected with T4DNA ligase16 ℃ with goal gene pyrF fragment spends the night, building process is as shown in Figure 1.The heat shock conversion method will connect product transformed into escherichia coli JM109 competence then; Containing the dull and stereotyped enterprising row filter of amicillin resistance; Inspect the positive colony that obtains by random samples survey soon, and the upgrading grain checks order, the result between the EcoRI of carrier pUBP and KpnI site along inserted gene shown in the Nucleotide of 512-1408 position the SEQ ID NO:2 from the direction of EcoRI to KpnI; The recombinant vectors that shows structure is correct, and positive recombinant vectors note is made pHFX.

Contain following four elements among the carrier pHFX: in intestinal bacteria, duplicate required replication origin, i.e. escherichia coli plasmid replicon E.coli ori; Be used to screen the resistance selectable marker gene Amp of intestinal bacteria transformant ^RThe expression cassette of (ampicillin resistance gene); Orotidine-5 '-expression cassette of the encoding sox pyrF of single phosphate decarboxylase; The MCS that supplies foreign gene to insert.Above-mentioned four elements are all not overlapped, and putting in order between each element do not have special demands.

The physical map of this carrier pHFX is as shown in Figure 1, and the restriction enzyme digestion sites that its MCS comprises has SphI, PstI, BamHI, each one of restriction enzyme site such as KpnI and EcoRI, two HindIII restriction enzyme sites; These restriction endonuclease recognition sites can carry out the clone of exogenous segment and the structure of derivative vector thereof easily.MCS with in the intestinal bacteria does not duplicate required replication origin, resistance selectable marker gene Amp at the upper reaches of the expression cassette of gene pyrF ^RThe expression cassette of (ampicillin resistance gene) and orotidine-5 '-expression cassette of the encoding sox pyrF of single phosphate decarboxylase is overlapping.

Among the carrier pHFX; Not only contain escherichia coli plasmid replicon (promptly in intestinal bacteria, duplicating required replication origin) but also contain the expression cassette that is useful on the resistance selectable marker gene that screens the intestinal bacteria transformant), conveniently in intestinal bacteria, carry out genetic manipulation and in halophilic archaea, carry out genetic manipulation.

Do not possess the replicon that in Hfx.mediterranei CGMCC 1.2087, duplicates among the carrier pHFX, but can be after being cloned into homologous fragment be integrated into the genome of Hfx.mediterranei by homologous recombination.

The pyrF gene can be given Hfx.mediterranei Δ pyrF uridylate de novo synthesis ability in this carrier, thereby can on uracil auxotrophy culture medium A S-168SY, grow, thereby reaches the purpose that forward is selected transformant.

So far, integrated plasmid carrier pHFX combines the Hfx.mediterranei Δ pyrF that obtains among the embodiment 2 to form a gene knockout system efficiently, can carry out that gene functional research and pathways metabolism are illustrated widely to Hfx.mediterranei.

Hfx.mediterranei Δ pyrF and carrier pHFX form the principle of genetic operating system: the approach that has the de novo synthesis uridylate in the Hfx.mediterranei; Thereby can with 5-FOA (5-fluoroorotic acid) be substrate utilization produce the virose 5 FU 5 fluorouracil of pair cell (5-FU, 5-fluorouracil).And pyrF (Orotidine 5 '-phosphatedecarboxylase) key enzyme of uridylate route of synthesis final step just; Bacterium after this genetically deficient sudden change will lose the uridylate synthesis capability and lose catalysis 5-FOA generation cytotoxic compound 5-FU ability; Thereby Hfx.mediterranei Δ pyrF can grow containing on the substratum of 5-FOA, and wild-type but can not.To contain foreign gene treat that integrated plasmid carrier pHFX transforms Hfx.mediterranei Δ pyrF after, at first single cross takes place and changes in plasmid vector pHFX and Hfx.mediterranei Δ pyrF, and then the generation double exchange, realizes knocking out of goal gene at last.

The application of embodiment 4, system-knock out phytoene synthetase crtB gene

Utilize Hfx.mediterranei Δ pyrF and pHFX Δ crtB to knock out the crtB gene among the Hfx.mediterranei Δ pyrF, concrete steps are following:

1, knocks out the structure of the integrated plasmid carrier pHFX Δ crtB of crtB

1) is used to knock out the pcr amplification of the homologous recombination double exchange arm of crtB

According to crtB gene coded sequence and upstream and downstream nucleotide sequence thereof among the SEQ ID NO:3, designed the amplimer crtBF1/crtBR1 and the crtBF2/crtBR2 of two pairs of double exchange arms:

crtBF1：5′ATA CTGCAGGTGCGGCGTGTGGGTACTTC3′( PstI)

crtBR1：5′AAT GGATCCCCGCGTACCGTCCCTGTCAC3′( BamHI)

crtBF2：5′GGT GGATCCGTTTGGTCGTTGATTTTTGA3′( BamHI)

crtBR2：5′ACA GGTACCGGCTTCCCGTGTTTTTCATC3′( KpnI)

DNA with rich salt bacterium (Haloferax mediterranei) CGMCC 1.2087 in Mediterranean Sea is a template, with the double exchange left arm 504bp of primer to crtBF1/crtBR1 amplification destruction crtB, shown in Fig. 6 A.The pcr amplification program is: 94 ℃ of preparatory sex change of 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 30s carry out 30 circulations; 72 ℃ are extended 7min.Amplification system is 25 μ l.The pcr amplification product fragment is connected on the pUCm-T carrier checks order, sequencing result shows that amplification has obtained the sequence of 504bp to primer to crtBF1/crtBR1, has the nucleotide sequence from 5 ' end 1-504 position of SEQ ID NO:3;

DNA with Hfx.mediterranei CGMCC 1.2087 is a template, and with primer crtBF2/crtBR2 being increased knocks out the double exchange right arm 528bp of crtB, shown in Fig. 6 A.The pcr amplification program is: 94 ℃ of preparatory sex change of 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 30s carry out 30 circulations; 72 ℃ are extended 7min.Amplification system is 25 μ l.The pcr amplification product fragment is connected on the pUCm-T carrier checks order, sequencing result shows that amplification has obtained the sequence of 528bp to primer to crtBF2/crtBR2, has the nucleotide sequence from 5 ' end 1534-2061 position of SEQ ID NO:3.

2) knock out the structure of the integrated plasmid carrier pHFX Δ crtB of crtB

Will be through the carrier pHFX and the PCR product left arm 504bp of restriction enzyme BamHI and PstI double digestion; 16 ℃ of connections of T4DNA ligase are spent the night; The heat shock conversion method will connect product transformed into escherichia coli JM109 competence then; Containing the dull and stereotyped enterprising row filter of amicillin resistance, the positive colony that obtains is being checked order; Sequencing result shows that fragment 504bp (its nucleotides sequence classify as sequence 3 in the sequence table from 5 ' terminal 1-504 position nucleotide sequence) has correctly inserted between the PstI and BamHI site of carrier pHFX (along the direction from PstI to BamHI), with its called after recombinant vectors pHFX504.

Will be through the recombinant vectors pHFX504 and the PCR product right arm 528bp of KpnI and BamHI double digestion; 16 ℃ of connections of ligase enzyme T4DNA ligase are spent the night; The heat shock conversion method will connect product transformed into escherichia coli JM109 competence then; Containing the dull and stereotyped enterprising row filter of amicillin resistance, the positive colony that obtains is being checked order; The result shows that fragment 528bp (its nucleotides sequence classify as sequence 3 in the sequence table from 5 ' terminal 1534-2061 position nucleotide sequence) has correctly inserted between the BamHI and KpnI site of carrier pHFX504 (along the direction from BamHI to KpnI); Obtain containing the double exchange integrated plasmid carrier of left arm 504bp and right arm 528bp, and with its called after pHFX Δ crtB.Left arm 504bp and right arm 528bp constitute recombinant fragment together, and note is made Δ crtB.

2, knock out crtB among the Hfx.mediterranei Δ pyrF

Utilize double exchange arm and the crtB in the Hfx.mediterranei Δ pyrF genome of pHFX Δ crtB to carry out homologous recombination to knock out crtB gene (principle schematic is seen Fig. 4); Make up crtB deletion mutantion strain Hfx.mediterranei Δ pyrF Δ crtB, concrete steps are following:

1) structure, screening and the verification method of bacterial strain changed in single cross

The employing document (Cline, S.W., W.L.Lam, et al. (1989). " Transformation methods forhalophilic archaebacteria. " Can J Microbiol35 (1): the 148-152.) method for transformation of said PEG mediation, pHFX Δ crtB is transformed Hfx.mediterranei Δ pyrF, transform back coating screening culture medium II solid plate, the bacterium that single cross is changed for taking place in bacterium that can normal growth on this solid plate.

Per 1 liter of said screening culture medium II is by acid hydrolysis casein, Sodium Glutamate, Trisodium Citrate, NaCl, MgSO ₄7H ₂O, KCl, FeSO ₄7H ₂O, MnCl ₂4H ₂O and water are formed, and wherein the concentration of each component in said screening culture medium II is: acid hydrolysis casein 5.0g/L, Sodium Glutamate 1.0g/L, Trisodium Citrate 3.0g/L, NaCl 200g/L, MgSO ₄7H ₂O20g/L, KCl 2.0g/L, FeSO ₄7H ₂O 0.36g/L, MnCl ₂4H ₂O 0.36mg/L; The pH value of said screening culture medium II is 7.1.(this changes the substratum of bacterial strain for the screening single cross)

The bacterial strain checking is changed in single cross: carry out the PCR checking: extract total DNA that bacterial strain is changed in single cross, with primer crtBF1/crtBR2 is carried out the PCR reaction, the pcr amplification program is: 94 ℃ of preparatory sex change of 3min; 94 ℃ of 30s, 57 ℃ of 30s, 72 ℃ of 60s carry out 30 circulations; 72 ℃ are extended 7min.Amplification system is 25 μ l.Genome so that the bacterium that single cross changes to be taken place is a template, amplify size be respectively 1032bp and 2061bp two bands change bacterial strain for the purpose single cross.

The principle of screening is changed in single cross: when changing because of generation crtB single cross, carrier pHFX Δ crtB all is incorporated on the genome of Hfx.mediterranei Δ pyrF through double exchange left arm or double exchange right arm.On the one hand, change bacterial strain and unconverted Hfx.mediterranei Δ pyrF, do not contain uridylic among the screening culture medium II in order to distinguish single cross; Single cross is changed and has been contained the pyrF gene in the bacterial strain, and bacterium self just can be synthesized uridylic, so single cross is changed bacterium and just can be grown at the AS-168SY solid plate that does not contain uridylic; And do not contain the pyrF gene among the unconverted Hfx.mediterranei Δ pyrF, and can not self synthesize uridylic, can not on the solid plate that does not contain uridylic, grow.On the other hand, crtBF1/crtBR2 amplifies the bacterium that size is respectively two bands of 1032bp and 2061bp and changes bacterial strain for the purpose single cross; The complete crtB gene that contains a copy in the bacterium that the generation single cross is changed; The Δ crtB that also contains another copy; Genome so that the bacterium that single cross changes to be taken place is that template is carried out pcr amplification with primer crtBF1/crtBR2; Can amplify size and be respectively two bands of 1032bp and 2061bp, 1032bp is the amplification to Δ crtB, and 2061bp is the amplification to complete crtB gene.

2) structure of double exchange bacterial strain, screening and verification method

The crtB single cross that step 1) is screened is changed bacterial strain and in liquid A S-168SY (adding final concentration 50 μ g/ml Uracil) substratum, is gone down to posterity and cultivated for 50 generations the nutrient solution dilution 10 of cultivating going down to posterity ⁷Coat the flat board of screening culture medium I, cultivate about a week for 37 ℃.The picking mono-clonal lines the flat board of screening culture medium I, and the bacterium colony that can on the flat board of screening culture medium I, grow is for the bacterium of double exchange is taken place, and note is made Hfx.mediterranei Δ pyrF Δ crtB.

Per 1 liter of said screening culture medium I is by acid hydrolysis casein, Sodium Glutamate, Trisodium Citrate, NaCl, MgSO ₄7H ₂O, KCl, FeSO ₄7H ₂O, MnCl ₂4H ₂O, uridylic, 5-FOA and water are formed, and wherein the concentration of each component in said screening culture medium I is: acid hydrolysis casein 5.0g/L, Sodium Glutamate 1.0g/L, Trisodium Citrate 3.0g/L, NaCl200g/L, MgSO ₄7H ₂O 20g/L, KCl 2.0g/L, FeSO ₄7H ₂O 0.36g/L, MnCl ₂4H ₂O 0.36mg/L, uridylic 50mg/L, 5-FOA 250mg/L; The pH value of said screening culture medium I is 7.1-7.2;

The checking of double exchange bacterial strain:

PCR checking: as template, with primer crtBF1/crtBR2 is carried out pcr amplification with the genomic dna of Hfx.mediterranei Δ pyrF Δ crtB, reaction system is changed bacterial strain with condition and single cross and is verified identical.Amplification be the 1032bp band should be purpose double exchange bacterial strain.

Southern blot checking: method is carried out with reference to DIG-High Prime DNA Labeling and Detection StarterKit I (Roche) specification sheets; Be specially: extract the genomic dna of Hfx.mediterranei Δ pyrF Δ crtB and the genomic dna of contrast bacterium Hfx.mediterranei Δ pyrF earlier; Digest with Restriction enzyme Sma I/KpnI, postdigestive product is used for hybridization (Fig. 6 A).The probe that uses among the Southern blot is the double exchange right arm 528p fragment of above-mentioned crtB, and uses digoxigenin labeled.Results of hybridization be the 2452bp band for purpose double exchange bacterial strain, results of hybridization be the 3481bp band be contrast bacterium Hfx.mediterranei Δ pyrF, this band is produced by the fragment between the SmaI/KpnI double enzyme site shown in Fig. 6 A.

Double exchange bacterial strain screening checking principle: after double exchange takes place; The complete crtB gene that single cross is changed in the bacterium is replaced; Plasmid pHFX Δ crtB breaks away from from the genome of bacterium is changed in single cross, so only contains the Δ crtB of a copy in the double exchange bacterial strain and no longer contain complete crtB gene and pyrF gene.On the one hand, screening culture medium I need contain uridylic and 5-FOA; Because do not contain the pyrF gene in the double exchange bacterium, self can not synthesize uridylic, and can not be that substrate utilization produces the cytotoxic substance 5 FU 5 fluorouracil with 5-FOA, therefore can in containing the substratum of 5-FOA, grow; And single cross is changed and is contained the pyrF gene in the bacterial strain, can be that substrate utilization produces the cytotoxic substance 5 FU 5 fluorouracil with 5-FOA, therefore can not in containing the substratum of 5-FOA, grow; So need contain uridylic and 5-FOA among the screening culture medium I.On the other hand, when with primer crtBF1/crtBR2 double exchange strain gene group being increased, having to a bacterium that obtains the band of 1032bp is purpose double exchange bacterial strain; Because contain Δ crtB in the double exchange bacterial strain, when double exchange strain gene group being increased, be amplification in fact to Δ crtB with primer crtBF1/crtBR2, therefore have to the band that obtains 1032bp to.Among the SEQ ID NO:3 among the integrated plasmid carrier pHFX Δ crtB among DNA shown in the Nucleotide of 1-504 position and the SEQ ID NO:3 complete genome crtB among DNA shown in the Nucleotide of 1534-2061 position and the Hfx.mediterranei Δ pyrF homologous recombination takes place, make among the deletion mutantion strain Hfx.mediterranei Δ pyrF Δ crtB and lacked 505-1533 position Nucleotide among the SEQ ID NO:3 among the gene crtB.

3) bacterial strain and the checking of double exchange bacterial strain are changed in single cross

The PCR qualification result is shown in Fig. 6 B: swimming lane 1 is double exchange bacterial strain amplification, and swimming lane 2 changes the bacterial strain amplification for single cross, and swimming lane 3 is a pHFX Δ crtB plasmid positive control, and swimming lane 4 is a Hfx.mediterranei Δ pyrF negative control.From figure, find out; The PCR product size 2061bp of negative control; The PCR product size 1032bp of positive control; The PCR product size of swimming lane 2 is respectively 1032bp and 2061bp, and instruction book exchange identification of strains is correct, and it is that the recombinant bacterial strain that is integrated into Hfx.mediterranei Δ pyrF genome homology zone is changed in pHFX Δ crtB plasmid generation single cross that bacterial strain is changed in single cross.The PCR product size of swimming lane 1 is 1032bp, explains that the double exchange identification of strains is correct.

Southern blot qualification result is seen Fig. 6 C.Swimming lane 1 changes the strain hybrid result for single cross, and swimming lane 2 is double exchange strain hybrid result.The hybridization band of swimming lane 1 is 3481bp, and the hybridization band of swimming lane 2 is 2452bp; Control strain Hfx.mediterranei Δ pyrF obtains the big fragment of 3481bp.Show that bacterial strain is changed in the single cross that obtains and the double exchange bacterial strain is all correct.

Embodiment 5, compliance test result

Experimental group: pHFX Δ crtB is transformed Hfx.mediterranei Δ pyrF, and bacterial strain is changed in the screening single cross, and the reorganization bacterium that the generation single cross that obtains is changed is the purpose recon.Method for transformation and screening method are with consistent described in the embodiment 4.Concrete experiment condition and result are as shown in table 1.

Control group: pUBP Δ pyrF is transformed rich salt bacterium (Haloferax mediterranei) CGMCC1.2087 in Mediterranean Sea, and bacterial strain is changed in the screening single cross, and the reorganization bacterium that the generation single cross that obtains is changed is the purpose recon.Method for transformation and screening method are with consistent described in the embodiment 2.Concrete experiment condition and result are as shown in table 1.

More than 3 repetitions, results averaged ± standard deviation are all established in experiment.

Recombination fraction calculation formula: the recombination fraction=used plasmid amount of every plate reorganization subnumber/conversion.

Table 1

Experimental result shows; The positive recombination fraction of experimental group is apparently higher than control group; Be 9.5 times of control group, the illustrative experiment group is compared the production rate of positive transformant with control group will hang down the 1-2 one magnitude, and the experimental group system for use in carrying obtains real positive transformant more easily.And the experimental group whole experiment is consuming time to have shortened half, has improved working efficiency.

Claims (10)

1. One kind the reorganization halophilic archaea; Method according to comprising the steps prepares: make the afunction of proteic encoding sox shown in the SEQ ID NO:1 in the halophilic archaea that sets out that contains proteic encoding sox shown in the SEQ ID NO:1, the reorganization bacterium that obtains is said reorganization halophilic archaea.
2. 2. reorganization halophilic archaea according to claim 1 is characterized in that: the halophilic archaea that sets out of proteic encoding sox shown in the said SEQ of the containing ID NO:1 is the rich salt bacterium (Haloferax mediterranei) in Mediterranean Sea.
3. 3. reorganization halophilic archaea according to claim 1 and 2 is characterized in that: the afunction of proteic encoding sox is a proteic encoding sox shown in the SEQ ID NO:1 that knocks out in the said halophilic archaea that sets out shown in the said SEQ ID NO:1 that makes in the halophilic archaea that sets out that contains proteic encoding sox shown in the SEQ ID NO:1;

   And/or said knocking out through homologous recombination realized;

   And/or; Said homologous recombination realizes through following homologous recombination vector: said homologous recombination vector makes up according to the method that comprises the steps: DNA shown in the Nucleotide of 1-602 position among the SEQ ID NO:2 is inserted between the KpnI and BamHI site of carrier pUBP recombinant vectors in the middle of the recombinant vectors note that obtains is done along the direction from KpnI to BamHI; DNA shown in the Nucleotide of 1419-1985 position among the SEQ ID NO:2 is inserted between the BamHI and PstI site of carrier pUBP along the direction from BamHI to PstI, and the recombinant vectors that obtains is said homologous recombination vector;

   And/or proteic encoding sox is following 1 shown in the said SEQ ID NO:1) or 2) or 3) or 4) shown in:

   1) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 611-1408 position among the SEQ ID NO:2;

   2) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 512-1408 position among the SEQ ID NO:2;

   3) under stringent condition with 1) or 2) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

   4) with 1) or 2) dna sequence dna that limits has homology and the dna molecular of encoding said proteins more than 90%.
4. 4. a test kit comprises arbitrary described reorganization halophilic archaea and following recombinant plasmid vector among the claim 1-3; At least contain the MCS and following other three elements that supply foreign gene to insert in the said recombinant plasmid vector: in intestinal bacteria, duplicate required replication origin, be used to screen the expression cassette of proteic encoding sox shown in the expression cassette, SEQ ID NO:1 of the resistance selectable marker gene of intestinal bacteria transformant;

   The MCS that said confession foreign gene inserts is not overlapping with said other three elements.
5. 5. test kit according to claim 4; It is characterized in that: said recombinant plasmid vector prepares according to the method that comprises the steps: gene shown in the Nucleotide of 512-1408 position among the SEQ ID NO:2 is inserted between the MCS of carrier pUBP, and the recombinant vectors that obtains is said recombinant plasmid vector.
6. 6. according to claim 4 or 5 described test kits, it is characterized in that, comprise screening culture medium I and/or screening culture medium II in the said test kit;

   Per 1 liter of said screening culture medium I is by acid hydrolysis casein, Sodium Glutamate, Trisodium Citrate, NaCl, MgSO ₄7H ₂O, KCl, FeSO ₄7H ₂O, MnCl ₂4H ₂O, uridylic, 5-FOA and water are formed, and wherein the concentration of each component in said screening culture medium I is: acid hydrolysis casein 5.0g/L, Sodium Glutamate 1.0g/L, Trisodium Citrate 3.0g/L, NaCl200g/L, MgSO ₄7H ₂O 20g/L, KCl 2.0g/L, FeSO ₄7H ₂O 0.36g/L, MnCl ₂4H ₂O 0.36mg/L, uridylic 50mg/L, 5-FOA 250mg/L; The pH value of said screening culture medium I is 7.1-7.2;

   Per 1 liter of said screening culture medium II is by acid hydrolysis casein, Sodium Glutamate, Trisodium Citrate, NaCl, MgSO ₄7H ₂O, KCl, FeSO ₄7H ₂O, MnCl ₂4H ₂O and water are formed, and wherein the concentration of each component in said screening culture medium II is: acid hydrolysis casein 5.0g/L, Sodium Glutamate 1.0g/L, Trisodium Citrate 3.0g/L, NaCl 200g/L, MgSO ₄7H ₂O20g/L, KCl 2.0g/L, FeSO ₄7H ₂O 0.36g/L, MnCl ₂4H ₂O 0.36mg/L; The pH value of said screening culture medium II is 7.1-7.2.
7. Among the claim 4-6 arbitrary said test kit following 1) or 2) or 3) in application:

   1) knocks out goal gene in the genome of arbitrary said reorganization halophilic archaea among the claim 1-3;

   2) in claim 1-3, cross expression alien gene in arbitrary said reorganization halophilic archaea;

   3) function of testing gene in the genome of research bacterium (Haloferax mediterranei).
8. 8. albumen, be following a) or b) protein:

   A) protein of forming by the aminoacid sequence shown in the SEQ ID NO:1;

   B) with the aminoacid sequence shown in the SEQ ID NO:1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have Orotidine-5 '-'-single phosphate decarboxylase is active by a) deutero-protein.
9. 9. the said proteic encoding sox of claim 8;

   And/or said encoding sox is following 1) or 2) or 3) or 4) shown in:

   1) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 611-1408 position among the SEQ ID NO:2;

   2) its nucleotide sequence is from dna molecular shown in the Nucleotide of 5 ' terminal 512-1408 position among the SEQ ID NO:2;

   3) under stringent condition with 1) or 2) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;

   4) with 1) or 2) dna sequence dna that limits has homology and the dna molecular of encoding said proteins more than 90%.
10. 10. the recombinant vectors, reorganization bacterium, transgenic cell line, recombinant virus or the expression cassette that contain the said encoding sox of claim 9;

    And/or, proteic encoding sox shown in the SEQ ID NO:1 in genetically engineered as the application of selective marker.

Images